ID: 1096615040

View in Genome Browser
Species Human (GRCh38)
Location 12:52827465-52827487
Sequence GAACCTAATGGACCACAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096615030_1096615040 28 Left 1096615030 12:52827414-52827436 CCAAAGAAAAGCCAATTCCTAAA 0: 1
1: 1
2: 4
3: 30
4: 387
Right 1096615040 12:52827465-52827487 GAACCTAATGGACCACAAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 99
1096615034_1096615040 11 Left 1096615034 12:52827431-52827453 CCTAAACATTCAGAAAAGAGGGG 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1096615040 12:52827465-52827487 GAACCTAATGGACCACAAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 99
1096615031_1096615040 17 Left 1096615031 12:52827425-52827447 CCAATTCCTAAACATTCAGAAAA 0: 1
1: 0
2: 0
3: 45
4: 410
Right 1096615040 12:52827465-52827487 GAACCTAATGGACCACAAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096615040 Original CRISPR GAACCTAATGGACCACAAGG AGG Intronic
901356662 1:8655807-8655829 GAACCTAACTGACCAAAAGTGGG + Intronic
901458624 1:9378139-9378161 GAAGCTGCTGGGCCACAAGGAGG - Intergenic
906402170 1:45512755-45512777 GAACCTCATCTCCCACAAGGGGG + Exonic
910136499 1:83977998-83978020 AAACCTAATGGACTAAAATGAGG - Intronic
913156483 1:116104621-116104643 GACCCTAAGGAACCACAGGGAGG - Intergenic
914505714 1:148287510-148287532 GAACCTAAGGGAACTCTAGGAGG - Intergenic
914506843 1:148296661-148296683 GAACCTAAGGGAACTCTAGGAGG + Intergenic
924909723 1:248497419-248497441 GAACCTGACGGTCCACATGGTGG - Intergenic
924914379 1:248550641-248550663 GAACCTGACGGTCCACATGGTGG + Intergenic
1070603119 10:77879363-77879385 GAACCTTATGGGCCACACAGAGG + Intronic
1071860945 10:89671998-89672020 TTACCTAATTGACCACATGGGGG - Intergenic
1073261962 10:102197228-102197250 TAACCTAAGGGATGACAAGGTGG + Intergenic
1073457737 10:103647742-103647764 GAACCTCATTGCCCACAGGGTGG - Intronic
1073506897 10:104003053-104003075 GAACATAATGGACATCAATGAGG + Exonic
1074919692 10:117994454-117994476 GAACCCAATGGGCTACAATGTGG + Intergenic
1075918190 10:126187815-126187837 GGACCTAGTGGAACATAAGGAGG - Intronic
1076107584 10:127835502-127835524 GAACCTTAAGGACCAAGAGGGGG + Intergenic
1077431326 11:2517314-2517336 GCACCTGATGGACCTCCAGGTGG + Intronic
1079587912 11:22149176-22149198 GAACCTAAATGACCTGAAGGAGG - Intergenic
1082166003 11:48951721-48951743 GAACGTATTGCACCACAAGTGGG - Intergenic
1082237199 11:49833289-49833311 GAACATATTGCACCACAAGTGGG + Intergenic
1082241493 11:49876466-49876488 GAACATATTGCACCACAAGTGGG - Intergenic
1082610588 11:55292215-55292237 GAACATATTGCACCACAAGTGGG + Intergenic
1082659354 11:55891458-55891480 GAACATATTGCACCACAAGTGGG - Exonic
1083138408 11:60701397-60701419 GACCAAAATAGACCACAAGGTGG + Intronic
1086697512 11:89862719-89862741 GAACATATTGCACCACAAGTGGG - Intergenic
1086708646 11:89981769-89981791 GAACATATTGCACCACAAGTGGG + Intergenic
1093743024 12:22709485-22709507 TATCCTAAAAGACCACAAGGTGG + Intergenic
1094476138 12:30842077-30842099 GAACCAAGGGAACCACAAGGTGG + Intergenic
1096615040 12:52827465-52827487 GAACCTAATGGACCACAAGGAGG + Intronic
1098612134 12:72471891-72471913 GAACATAGTGGACCAGGAGGAGG - Intronic
1109814962 13:67569414-67569436 GGACCATGTGGACCACAAGGAGG + Intergenic
1113514092 13:110878087-110878109 AAACTTAATAGACCACAATGAGG - Intergenic
1122933091 14:104943690-104943712 GGACCTAAAAGACCCCAAGGTGG - Exonic
1122934244 14:104948640-104948662 GGACCTAAAAGACCCCAAGGTGG - Exonic
1122934357 14:104949135-104949157 GGACCTAAAAGACCCCAAGGTGG - Exonic
1122934829 14:104951115-104951137 GGACCTAAAAGACCCCAAGGTGG - Exonic
1123767302 15:23494284-23494306 CACCCTAATGGACTACAAGGAGG + Intergenic
1126247085 15:46519621-46519643 GAACCTTATGGGCCAGAAGGGGG + Intergenic
1133970813 16:10566813-10566835 GAAAGACATGGACCACAAGGTGG + Intronic
1134356603 16:13488083-13488105 GAAGATAATGGACCACCAGGGGG + Intergenic
1135063738 16:19291935-19291957 AAACCTAAAGGACCAGAATGGGG + Intronic
1135985535 16:27181135-27181157 GAGCCTGAGGGACCCCAAGGAGG + Intergenic
1136229670 16:28878986-28879008 GAACTTGATGAACCTCAAGGTGG + Intronic
1136460680 16:30408173-30408195 GATCCCCATGGACAACAAGGAGG + Exonic
1146679587 17:34797449-34797471 GAACCTAAAGGCCCACAGGAAGG - Intergenic
1153461539 18:5339275-5339297 GAAACTAAAAGACCACAAGAAGG + Intergenic
1159254056 18:65922481-65922503 GAACCTAATTTACAACAAAGTGG + Intergenic
1163754821 19:19100484-19100506 GACCCTGGGGGACCACAAGGAGG - Intronic
1165769609 19:38371420-38371442 GATCCTGCTGGACCACAGGGAGG - Intergenic
1167525935 19:49983814-49983836 TAACCAAGGGGACCACAAGGGGG - Intronic
925676303 2:6365468-6365490 GATCCTGATGGACCAGAATGTGG - Intergenic
926404742 2:12539774-12539796 GTACCTAATGGAAAACAAGCGGG - Intergenic
931240040 2:60444071-60444093 GAAACTAGTGGAACATAAGGTGG - Intergenic
936973271 2:118195034-118195056 GTAACTAATGGACCACTCGGTGG + Intergenic
941220623 2:162775689-162775711 CAACTTAATGGACATCAAGGAGG - Intronic
942684631 2:178518654-178518676 AAACCTAAAGGACCACTAAGGGG - Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
948052569 2:234989594-234989616 AGACCTTATGGCCCACAAGGTGG - Intronic
948937189 2:241174532-241174554 GAACTTTCAGGACCACAAGGAGG - Intronic
1172028700 20:31967286-31967308 GATCCTAAGGGGCCAGAAGGTGG - Intergenic
1172212669 20:33212010-33212032 GAACACTCTGGACCACAAGGGGG - Intergenic
1175697353 20:61112469-61112491 CAAACTAATGGAACCCAAGGGGG + Intergenic
1175708402 20:61199125-61199147 GACGCTAATGGAACACAAGAAGG + Intergenic
950707026 3:14789182-14789204 AGACCAAAGGGACCACAAGGAGG - Intergenic
951206193 3:19928176-19928198 GAACATAATATATCACAAGGAGG + Intronic
952015056 3:28946495-28946517 GAACCCAAGGGACCACTTGGGGG + Intergenic
952666298 3:35908574-35908596 GAAAATAATCGACCACGAGGTGG - Intergenic
953477174 3:43215395-43215417 GAACTCAATGTATCACAAGGAGG + Intergenic
956594434 3:70950184-70950206 GTACCTAATGGTTCACAGGGAGG - Intergenic
965158349 3:165095660-165095682 GAATCTAATGTACCATAATGGGG - Intergenic
976743925 4:88384693-88384715 GAATCTAATGGAACTCAAAGAGG - Intronic
976811352 4:89104427-89104449 CAAATTAATGGAACACAAGGAGG + Intronic
980218861 4:129888119-129888141 GAATTTTATGCACCACAAGGAGG + Intergenic
985577751 5:681610-681632 GACCCTATGGGACCACAAGTGGG + Intronic
990921802 5:60976502-60976524 GAAGGAAATGGACCCCAAGGGGG + Intronic
991160589 5:63495323-63495345 GAACCTAATGGAGTACCTGGAGG + Intergenic
991921163 5:71658257-71658279 GAACCTTATAGACCCTAAGGTGG - Exonic
994098219 5:95866599-95866621 GAACCTAAAGGACCAGCTGGAGG - Intergenic
995051924 5:107716785-107716807 GAACCTAATAGAGCTCCAGGTGG - Intergenic
997685989 5:135788442-135788464 GAATATAATGGACCATATGGCGG - Intergenic
1000805904 5:165791826-165791848 GAACATATGGGACCACAAGTAGG - Intergenic
1000815116 5:165911516-165911538 GAACCTCATGGACCTCAATATGG - Intergenic
1003202842 6:3978148-3978170 GCACATTGTGGACCACAAGGAGG - Intergenic
1003367553 6:5490030-5490052 CAACCGAAAGGGCCACAAGGAGG - Intronic
1014303144 6:119708510-119708532 GAACCTGATGGACCACCATTTGG - Intergenic
1017124030 6:151049697-151049719 GAACTTAATTGAACCCAAGGAGG - Intronic
1019332951 7:469922-469944 GAAAGTCATGGAACACAAGGAGG - Intergenic
1022467461 7:30661254-30661276 GCAACTACTGGACCACAGGGAGG + Intronic
1029641777 7:101825433-101825455 GAGCCTGGAGGACCACAAGGTGG + Intronic
1029836587 7:103318541-103318563 GAACCTTAAGGACCAAAAGATGG - Intronic
1030340562 7:108375182-108375204 GTAGCTCATGGACTACAAGGAGG - Intronic
1030583708 7:111390660-111390682 GGAGCTAATGGACCATAAGAGGG - Intronic
1031829919 7:126613898-126613920 GAACCTACTGCAGCTCAAGGAGG + Intronic
1042556719 8:70039514-70039536 GAAACAAATGGAGCAGAAGGAGG - Intergenic
1052108768 9:24552998-24553020 GAACTTAATGGAGCATAAAGGGG - Intergenic
1056442823 9:86637627-86637649 GGACATCAGGGACCACAAGGTGG + Intergenic
1057394103 9:94664211-94664233 GAGCCTTATGGGCCACAATGAGG + Intergenic
1187106413 X:16247459-16247481 TAAACTAATGCACAACAAGGGGG + Intergenic
1187659797 X:21530678-21530700 TTAACTAATGGTCCACAAGGGGG + Intronic
1193204932 X:78736905-78736927 GAACCTAGTTGAGCACTAGGAGG + Intergenic
1193673212 X:84415454-84415476 GTACCTCTTGGAGCACAAGGAGG - Intronic
1195624716 X:106996295-106996317 GAAGCTCATGGAATACAAGGGGG + Intronic