ID: 1096616749

View in Genome Browser
Species Human (GRCh38)
Location 12:52837466-52837488
Sequence CCCACCTGACACGTGCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096616745_1096616749 -5 Left 1096616745 12:52837448-52837470 CCTATTCACTACACAAACCCCAC 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1096616749 12:52837466-52837488 CCCACCTGACACGTGCCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1096616742_1096616749 12 Left 1096616742 12:52837431-52837453 CCCACGACCACGTGCAGCCTATT 0: 1
1: 0
2: 0
3: 19
4: 562
Right 1096616749 12:52837466-52837488 CCCACCTGACACGTGCCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1096616744_1096616749 5 Left 1096616744 12:52837438-52837460 CCACGTGCAGCCTATTCACTACA 0: 1
1: 0
2: 17
3: 13
4: 84
Right 1096616749 12:52837466-52837488 CCCACCTGACACGTGCCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1096616743_1096616749 11 Left 1096616743 12:52837432-52837454 CCACGACCACGTGCAGCCTATTC 0: 1
1: 13
2: 6
3: 14
4: 93
Right 1096616749 12:52837466-52837488 CCCACCTGACACGTGCCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096616749 Original CRISPR CCCACCTGACACGTGCCCGA GGG Intergenic