ID: 1096620245

View in Genome Browser
Species Human (GRCh38)
Location 12:52860055-52860077
Sequence GTGTTCCTGACTCCCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096620245_1096620248 -1 Left 1096620245 12:52860055-52860077 CCCAGGCTGGGAGTCAGGAACAC No data
Right 1096620248 12:52860077-52860099 CACATCCAGGAACAAACTGCTGG No data
1096620245_1096620251 16 Left 1096620245 12:52860055-52860077 CCCAGGCTGGGAGTCAGGAACAC No data
Right 1096620251 12:52860094-52860116 TGCTGGTGCCTGAGAGAGGAAGG No data
1096620245_1096620250 12 Left 1096620245 12:52860055-52860077 CCCAGGCTGGGAGTCAGGAACAC No data
Right 1096620250 12:52860090-52860112 AAACTGCTGGTGCCTGAGAGAGG No data
1096620245_1096620254 23 Left 1096620245 12:52860055-52860077 CCCAGGCTGGGAGTCAGGAACAC No data
Right 1096620254 12:52860101-52860123 GCCTGAGAGAGGAAGGGGATTGG No data
1096620245_1096620252 17 Left 1096620245 12:52860055-52860077 CCCAGGCTGGGAGTCAGGAACAC No data
Right 1096620252 12:52860095-52860117 GCTGGTGCCTGAGAGAGGAAGGG No data
1096620245_1096620253 18 Left 1096620245 12:52860055-52860077 CCCAGGCTGGGAGTCAGGAACAC No data
Right 1096620253 12:52860096-52860118 CTGGTGCCTGAGAGAGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096620245 Original CRISPR GTGTTCCTGACTCCCAGCCT GGG (reversed) Intergenic