ID: 1096620249

View in Genome Browser
Species Human (GRCh38)
Location 12:52860082-52860104
Sequence AGGCACCAGCAGTTTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096620249_1096620261 29 Left 1096620249 12:52860082-52860104 CCAGGAACAAACTGCTGGTGCCT No data
Right 1096620261 12:52860134-52860156 CAACTCTGGGGGACCCTGAGAGG No data
1096620249_1096620258 17 Left 1096620249 12:52860082-52860104 CCAGGAACAAACTGCTGGTGCCT No data
Right 1096620258 12:52860122-52860144 GGACAAAGCTTCCAACTCTGGGG No data
1096620249_1096620253 -9 Left 1096620249 12:52860082-52860104 CCAGGAACAAACTGCTGGTGCCT No data
Right 1096620253 12:52860096-52860118 CTGGTGCCTGAGAGAGGAAGGGG No data
1096620249_1096620257 16 Left 1096620249 12:52860082-52860104 CCAGGAACAAACTGCTGGTGCCT No data
Right 1096620257 12:52860121-52860143 TGGACAAAGCTTCCAACTCTGGG No data
1096620249_1096620262 30 Left 1096620249 12:52860082-52860104 CCAGGAACAAACTGCTGGTGCCT No data
Right 1096620262 12:52860135-52860157 AACTCTGGGGGACCCTGAGAGGG No data
1096620249_1096620256 15 Left 1096620249 12:52860082-52860104 CCAGGAACAAACTGCTGGTGCCT No data
Right 1096620256 12:52860120-52860142 TTGGACAAAGCTTCCAACTCTGG No data
1096620249_1096620254 -4 Left 1096620249 12:52860082-52860104 CCAGGAACAAACTGCTGGTGCCT No data
Right 1096620254 12:52860101-52860123 GCCTGAGAGAGGAAGGGGATTGG No data
1096620249_1096620252 -10 Left 1096620249 12:52860082-52860104 CCAGGAACAAACTGCTGGTGCCT No data
Right 1096620252 12:52860095-52860117 GCTGGTGCCTGAGAGAGGAAGGG No data
1096620249_1096620259 18 Left 1096620249 12:52860082-52860104 CCAGGAACAAACTGCTGGTGCCT No data
Right 1096620259 12:52860123-52860145 GACAAAGCTTCCAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096620249 Original CRISPR AGGCACCAGCAGTTTGTTCC TGG (reversed) Intergenic