ID: 1096620250

View in Genome Browser
Species Human (GRCh38)
Location 12:52860090-52860112
Sequence AAACTGCTGGTGCCTGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096620246_1096620250 11 Left 1096620246 12:52860056-52860078 CCAGGCTGGGAGTCAGGAACACA No data
Right 1096620250 12:52860090-52860112 AAACTGCTGGTGCCTGAGAGAGG No data
1096620245_1096620250 12 Left 1096620245 12:52860055-52860077 CCCAGGCTGGGAGTCAGGAACAC No data
Right 1096620250 12:52860090-52860112 AAACTGCTGGTGCCTGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096620250 Original CRISPR AAACTGCTGGTGCCTGAGAG AGG Intergenic