ID: 1096620251

View in Genome Browser
Species Human (GRCh38)
Location 12:52860094-52860116
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096620245_1096620251 16 Left 1096620245 12:52860055-52860077 CCCAGGCTGGGAGTCAGGAACAC No data
Right 1096620251 12:52860094-52860116 TGCTGGTGCCTGAGAGAGGAAGG No data
1096620246_1096620251 15 Left 1096620246 12:52860056-52860078 CCAGGCTGGGAGTCAGGAACACA No data
Right 1096620251 12:52860094-52860116 TGCTGGTGCCTGAGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096620251 Original CRISPR TGCTGGTGCCTGAGAGAGGA AGG Intergenic
No off target data available for this crispr