ID: 1096620252

View in Genome Browser
Species Human (GRCh38)
Location 12:52860095-52860117
Sequence GCTGGTGCCTGAGAGAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096620249_1096620252 -10 Left 1096620249 12:52860082-52860104 CCAGGAACAAACTGCTGGTGCCT No data
Right 1096620252 12:52860095-52860117 GCTGGTGCCTGAGAGAGGAAGGG No data
1096620246_1096620252 16 Left 1096620246 12:52860056-52860078 CCAGGCTGGGAGTCAGGAACACA No data
Right 1096620252 12:52860095-52860117 GCTGGTGCCTGAGAGAGGAAGGG No data
1096620245_1096620252 17 Left 1096620245 12:52860055-52860077 CCCAGGCTGGGAGTCAGGAACAC No data
Right 1096620252 12:52860095-52860117 GCTGGTGCCTGAGAGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096620252 Original CRISPR GCTGGTGCCTGAGAGAGGAA GGG Intergenic