ID: 1096621611

View in Genome Browser
Species Human (GRCh38)
Location 12:52869102-52869124
Sequence CAGTGACAGCACAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096621611_1096621628 25 Left 1096621611 12:52869102-52869124 CCTACTTCCCTGTGCTGTCACTG No data
Right 1096621628 12:52869150-52869172 CTCAAAGCCAGTGGTGGGCCAGG No data
1096621611_1096621617 -7 Left 1096621611 12:52869102-52869124 CCTACTTCCCTGTGCTGTCACTG No data
Right 1096621617 12:52869118-52869140 GTCACTGCCCCAGGGAGGCCTGG No data
1096621611_1096621626 20 Left 1096621611 12:52869102-52869124 CCTACTTCCCTGTGCTGTCACTG No data
Right 1096621626 12:52869145-52869167 TTTGCCTCAAAGCCAGTGGTGGG No data
1096621611_1096621623 16 Left 1096621611 12:52869102-52869124 CCTACTTCCCTGTGCTGTCACTG No data
Right 1096621623 12:52869141-52869163 GCCATTTGCCTCAAAGCCAGTGG No data
1096621611_1096621618 -6 Left 1096621611 12:52869102-52869124 CCTACTTCCCTGTGCTGTCACTG No data
Right 1096621618 12:52869119-52869141 TCACTGCCCCAGGGAGGCCTGGG No data
1096621611_1096621629 26 Left 1096621611 12:52869102-52869124 CCTACTTCCCTGTGCTGTCACTG No data
Right 1096621629 12:52869151-52869173 TCAAAGCCAGTGGTGGGCCAGGG No data
1096621611_1096621630 27 Left 1096621611 12:52869102-52869124 CCTACTTCCCTGTGCTGTCACTG No data
Right 1096621630 12:52869152-52869174 CAAAGCCAGTGGTGGGCCAGGGG No data
1096621611_1096621625 19 Left 1096621611 12:52869102-52869124 CCTACTTCCCTGTGCTGTCACTG No data
Right 1096621625 12:52869144-52869166 ATTTGCCTCAAAGCCAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096621611 Original CRISPR CAGTGACAGCACAGGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr