ID: 1096625173

View in Genome Browser
Species Human (GRCh38)
Location 12:52890707-52890729
Sequence GTGGGCCAAGTCAAGATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096625165_1096625173 17 Left 1096625165 12:52890667-52890689 CCAGGATGAGGCCTCAGAGGAGG No data
Right 1096625173 12:52890707-52890729 GTGGGCCAAGTCAAGATTTAGGG No data
1096625168_1096625173 6 Left 1096625168 12:52890678-52890700 CCTCAGAGGAGGAAGAGTAGGCA No data
Right 1096625173 12:52890707-52890729 GTGGGCCAAGTCAAGATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096625173 Original CRISPR GTGGGCCAAGTCAAGATTTA GGG Intergenic
No off target data available for this crispr