ID: 1096625505

View in Genome Browser
Species Human (GRCh38)
Location 12:52893107-52893129
Sequence TTACTTAACCAGTCCTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096625505_1096625507 -1 Left 1096625505 12:52893107-52893129 CCAATAGAGGACTGGTTAAGTAA 0: 1
1: 0
2: 6
3: 47
4: 203
Right 1096625507 12:52893129-52893151 AATTGTGGCACATCCCAAAGTGG 0: 1
1: 0
2: 0
3: 7
4: 155
1096625505_1096625510 27 Left 1096625505 12:52893107-52893129 CCAATAGAGGACTGGTTAAGTAA 0: 1
1: 0
2: 6
3: 47
4: 203
Right 1096625510 12:52893157-52893179 TATGCAGCTGTGAAAAAGAGTGG 0: 1
1: 1
2: 6
3: 59
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096625505 Original CRISPR TTACTTAACCAGTCCTCTAT TGG (reversed) Intergenic
906629552 1:47354694-47354716 TTACTTAGCCATTCCTATATTGG + Intronic
906751169 1:48262548-48262570 TAATTTAACCATTCCTCTATTGG - Intergenic
906758980 1:48354486-48354508 TTACTTATTCATTCCTCCATTGG - Intronic
910172901 1:84397216-84397238 TTTCTTACCCATTCCTCCATTGG - Intergenic
910350042 1:86286195-86286217 GTATTTAACCAGTCCCTTATTGG - Intergenic
910451052 1:87345742-87345764 TTACTTAACCACGCCATTATTGG + Exonic
912339120 1:108893434-108893456 TTTTTTACCCAGTACTCTATTGG + Intronic
912589716 1:110804265-110804287 TTCTTTATCCAGTCCACTATTGG + Intergenic
914046198 1:144094953-144094975 TTATTTAACCAGTCTCCTTTAGG - Intergenic
914131912 1:144865732-144865754 TTATTTAACCAGTCTCCTTTAGG + Intergenic
915329665 1:155102734-155102756 GTATTTAGCCAGTCCTCCATAGG - Intergenic
916488156 1:165277611-165277633 TTACTCTACCAGCCCTCTCTGGG + Intronic
918028910 1:180783709-180783731 GTACTTAACCACTCCCCTTTTGG + Intronic
920331788 1:205213686-205213708 TTATTTAACAAGTCTTCTATTGG + Intergenic
920891549 1:209992111-209992133 TTCTTTATCCAGTCATCTATTGG - Intronic
923619184 1:235564027-235564049 TTTCTTATCCAGTCCACTGTTGG - Intronic
924550347 1:245070335-245070357 TTACATATCCATTCATCTATTGG + Intronic
1066003157 10:31123468-31123490 TTCCTTAACTATTCTTCTATTGG + Intergenic
1066313828 10:34223583-34223605 TTACTTAACAAGAACTCTAAAGG + Intronic
1068075301 10:52246574-52246596 TTATTTAAAGAGTCCCCTATAGG + Intronic
1069764327 10:70842154-70842176 TTATTTAACCATTCTTCTGTGGG + Intronic
1070066059 10:73035577-73035599 TTATTTAACCAGTACTTAATTGG - Intronic
1071103822 10:82071031-82071053 TTAAGTAGCCAATCCTCTATTGG - Intronic
1071465807 10:85938696-85938718 TTAAAAACCCAGTCCTCTATGGG + Intronic
1071603277 10:86969259-86969281 TTACTTCACCAGTGCTCCAGGGG + Intronic
1071889223 10:89984342-89984364 TTACTTGACCATTCCACTAAGGG - Intergenic
1071979566 10:90989842-90989864 TTACTTATCCATTTCCCTATTGG + Intergenic
1074397524 10:113110457-113110479 GCACTTAACCAGTCCTTAATTGG + Intronic
1074511834 10:114119950-114119972 TAACTTAATGAGTTCTCTATTGG - Intergenic
1074749066 10:116566161-116566183 TTGTTTATCCATTCCTCTATTGG - Intronic
1080889278 11:36395200-36395222 TTATTTAACCAGTCCCCTATGGG - Intronic
1081844921 11:46233547-46233569 TTTATTTACCAGTCCTCTACTGG - Intergenic
1085021204 11:73210069-73210091 GTATTTAACCAGTCCTCTGTTGG - Intergenic
1086095458 11:83046114-83046136 TTACTTACCCAGGCATATATGGG + Intronic
1086253151 11:84841848-84841870 TTTTTTAACCATTCCTCTACAGG + Intronic
1086799143 11:91149900-91149922 TTATTTATCCATTCATCTATAGG + Intergenic
1087255393 11:95947613-95947635 TTACTTAATGAGTACTGTATTGG + Intergenic
1087897087 11:103598363-103598385 TTATTCAACTAGTCCTCTATCGG + Intergenic
1094197497 12:27764698-27764720 TCATTTATCCAGTCTTCTATTGG + Intronic
1095153804 12:38827579-38827601 TTATTTATCCAGTCCACCATTGG - Intronic
1096625505 12:52893107-52893129 TTACTTAACCAGTCCTCTATTGG - Intergenic
1097238821 12:57559106-57559128 TTATTTAACCAGGCCTCTGTTGG + Intronic
1098176318 12:67795266-67795288 TTACTTCAGGAGTCCTCAATGGG - Intergenic
1098982896 12:76977202-76977224 TTACTTAATCATTCCCCTACTGG - Intergenic
1100661961 12:96709238-96709260 TTATTCAATCATTCCTCTATTGG - Intronic
1101618043 12:106357400-106357422 TTATTTAATCAATCTTCTATTGG + Intergenic
1101701305 12:107176895-107176917 TTATTTAACTAGCCCTCTAGGGG - Intergenic
1102760222 12:115378686-115378708 TTATTTAACCAGTCTCCTACTGG + Intergenic
1103024673 12:117563892-117563914 TCACTTCCCCATTCCTCTATTGG + Intronic
1103707443 12:122885365-122885387 TTATATAACCATTCCTTTATTGG - Intronic
1104659866 12:130603428-130603450 TTCCTTATCCATTTCTCTATTGG - Intronic
1105002462 12:132699752-132699774 TTCTTTATCCAGTCCTCTGTTGG + Intronic
1105208126 13:18240089-18240111 TTACTTAAGCACCCCGCTATGGG - Intergenic
1105326975 13:19379624-19379646 TTGCTTATCCATTCATCTATCGG + Intergenic
1105864674 13:24448726-24448748 TTGCTTATCCATTCATCTATCGG - Intronic
1106472432 13:30069195-30069217 TTACTTAACAATTCCTCTTTTGG - Intergenic
1107575603 13:41717377-41717399 TTACTTAACTAATTCTCTATTGG - Intronic
1108444887 13:50498288-50498310 TTATTTAACCATTCCCCTATTGG + Intronic
1108861740 13:54868948-54868970 ATACTTAAAAAGTACTCTATGGG + Intergenic
1110131419 13:72016214-72016236 TTTGTTAATCAGTCTTCTATTGG - Intergenic
1112617237 13:101018203-101018225 CTTCTTACCCAGTCCTCAATGGG + Intergenic
1114540693 14:23455722-23455744 ATTCTTATCCATTCCTCTATAGG - Intergenic
1116782174 14:49248543-49248565 TTATTTAGCCAGTCAACTATTGG + Intergenic
1120418146 14:84245860-84245882 TTGCTGAACCAGTCCTCCTTGGG + Intergenic
1120667100 14:87319043-87319065 TAACTTAACCACTCCTTTAAAGG + Intergenic
1122085368 14:99297369-99297391 TTAATTAATCACTCCTCCATTGG - Intergenic
1124562379 15:30786914-30786936 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1125394236 15:39229553-39229575 TTATTAAACCTGTCCCCTATTGG - Intergenic
1125963828 15:43856169-43856191 TTATTTAACCAGATCTCTCTTGG + Intronic
1126674699 15:51150207-51150229 GTATATAACCATTCCTCTATTGG + Intergenic
1127778013 15:62283753-62283775 ATATTTAATCAGTCCCCTATTGG + Intergenic
1129032114 15:72626763-72626785 TTGCTTAACCATTCACCTATGGG + Intergenic
1129406882 15:75325501-75325523 TTGCTTAACCATTCACCTATTGG + Intergenic
1129488091 15:75895966-75895988 ATATTTAATCAGTCCCCTATTGG - Intronic
1129734940 15:77954769-77954791 TTGCTTAACCATTCACCTATTGG - Intergenic
1129837204 15:78716924-78716946 TGACTTAACCAGTTCCCTGTTGG - Intronic
1130267936 15:82425670-82425692 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1130389850 15:83446222-83446244 TTACTTGCCCAGTCCTCACTAGG + Intergenic
1130504089 15:84521164-84521186 TTACTTAACCAGTTCCCTGTTGG + Intergenic
1132183945 15:99787218-99787240 TTACTTAACCAGTTCCCATTTGG - Intergenic
1132434436 15:101785927-101785949 TTACTTAACCAATTCCCTTTTGG + Intergenic
1133969018 16:10553742-10553764 TTACTTAACTGGTTCCCTATTGG + Intronic
1134395313 16:13857088-13857110 ATAGTTAACCAGTTCCCTATTGG - Intergenic
1134445043 16:14324668-14324690 ATACTTAACCTGTCTTCTACTGG + Intergenic
1137465446 16:48704601-48704623 TTATTTAACCAATCCACTAAGGG + Intergenic
1143673608 17:8414169-8414191 TTATTAAACCAGTCTCCTATTGG + Intronic
1144815919 17:18034836-18034858 TTACTTATCCATTCATCCATTGG - Intronic
1145931490 17:28689264-28689286 TTATTTAACCAGTTCCCCATTGG + Intronic
1146247356 17:31300534-31300556 TTATTCAACCAGTCCCCTATTGG + Intronic
1148389615 17:47261944-47261966 TTACTTAACCAATTCCCTGTTGG + Intronic
1149120413 17:53157217-53157239 TTTCTGAAACAGTCCTCTTTAGG + Intergenic
1150317547 17:64182087-64182109 TTGCTTATCCATTCCTCCATCGG - Intronic
1150715090 17:67566059-67566081 GTACTTAACCAGCCTTCTACTGG + Intronic
1153869223 18:9301542-9301564 TTATTTAATCAGTCCTCTCCTGG + Intergenic
1155963079 18:32011557-32011579 TTATTTAACCAGTCACCTATTGG + Intergenic
1157342761 18:46794076-46794098 TTACTAAACCAGCCCTCAAGGGG + Intergenic
1157785433 18:50477755-50477777 TTATTGAACCAGTCCCCTATTGG - Intergenic
1158635819 18:59156475-59156497 TTATTTAACCAATCCCCTTTTGG + Intronic
1158846679 18:61450858-61450880 TTACTTAGCCAATCCTGTGTTGG + Intronic
1160203805 18:76816616-76816638 TGACTTAACCTGTCTTCTCTCGG - Intronic
1164611035 19:29631845-29631867 TGACTTAATCAGTGCTCTGTAGG - Intergenic
1164627783 19:29740935-29740957 CTCCTTAACCAGACCTCTAAAGG - Intergenic
1202685751 1_KI270712v1_random:48368-48390 TTATTTAACCAGTCTCCTTTAGG - Intergenic
925159070 2:1670237-1670259 TTATTTAACAAGTTCTCTTTTGG - Intronic
928023018 2:27718468-27718490 TTACTTAACCATTTCCTTATTGG - Intergenic
928961198 2:36927966-36927988 TTATTTAACCAGTCTCCTTTAGG - Intronic
929031161 2:37651010-37651032 TAACTGAACCAGTCCTCCATAGG - Intronic
931523282 2:63124007-63124029 TTATTTAACCACTCCTTTTTTGG + Intronic
932374131 2:71220058-71220080 TTACTTAACCAGTTCCCTGATGG + Intronic
932843929 2:75115556-75115578 TTATTTAACCAATCATTTATTGG - Intronic
933109604 2:78380881-78380903 TTATTTAACCAGTCTCCTACTGG - Intergenic
933824156 2:86143324-86143346 TTAATTCAGCAGCCCTCTATGGG - Intergenic
934245973 2:90306456-90306478 TTATTTAACCAGTCTCCTTTAGG + Intergenic
934262773 2:91490579-91490601 TTATTTAACCAGTCTCCTTTAGG - Intergenic
935229746 2:101085223-101085245 TTACTCATCCAATCCTTTATTGG - Intronic
936327857 2:111521316-111521338 TTACAAAATCAATCCTCTATTGG - Intergenic
939481666 2:142755690-142755712 TCAATTAACCAGTCATCTCTAGG - Intergenic
940494702 2:154411418-154411440 TTATTTAACCATTCCCCTCTTGG - Intronic
941497647 2:166226262-166226284 TTAATTATTCAATCCTCTATAGG + Intronic
941852874 2:170201653-170201675 TGACTTAACCAGTCAACTAAAGG - Intronic
944428174 2:199605214-199605236 TTAATTAACCAGCCAGCTATGGG - Intergenic
945599720 2:211845399-211845421 ATACTCAGCCAGTCCTCTATAGG - Intronic
945701117 2:213172007-213172029 TTATTTAGCCAGACCTCGATTGG + Intergenic
946250694 2:218409893-218409915 GTATTTAACCAGTTCTTTATTGG - Intergenic
948345419 2:237292968-237292990 TCACATTACCAGTCCTATATAGG + Intergenic
1169005117 20:2200413-2200435 TTATTTACCCAGTTCCCTATTGG + Intergenic
1169282948 20:4282477-4282499 TTAATTAACCAGTTCTCTACAGG + Intergenic
1171117650 20:22539831-22539853 TTTTTTAACCAGTCCATTATGGG - Intergenic
1172851410 20:37968975-37968997 ATACTTAACCAGTTGTCTCTAGG - Intergenic
1172856546 20:38008379-38008401 GTATTTAACCAGTCCTTTCTTGG - Intronic
1173457682 20:43216550-43216572 TCACTTCCCCATTCCTCTATGGG - Intergenic
1173506764 20:43593504-43593526 TTATTTAACCAGTCATCTACTGG - Intronic
1174675601 20:52351137-52351159 TTACTTCACCAGGCCTCTGCTGG + Intergenic
1176699806 21:10031964-10031986 TTACTTAGCCATTTCTCTATTGG - Intergenic
1180758687 22:18181978-18182000 TTACTTAAGCACCCCGCTATGGG - Intergenic
1180768974 22:18365770-18365792 TTACTTAAGCACCCCGCTATGGG - Intergenic
1180777338 22:18496625-18496647 TTACTTAAGCACCCCGCTATGGG + Intergenic
1180810058 22:18753935-18753957 TTACTTAAGCACCCCGCTATGGG + Intergenic
1180826849 22:18868994-18869016 TTACTTAAGCACCCCGCTATGGG - Intergenic
1181196204 22:21188187-21188209 TTACTTAAGCACCCCGCTATGGG + Intergenic
1181213325 22:21304937-21304959 TTACTTAAGCACCCCGCTATGGG - Intergenic
1181929466 22:26388475-26388497 TCACTTCACCACTCCTCTACTGG - Intergenic
1185174013 22:49309130-49309152 TTATATAATCAGTCCCCTATTGG + Intergenic
1203230596 22_KI270731v1_random:106654-106676 TTACTTAAGCACCCCGCTATGGG - Intergenic
1203276989 22_KI270734v1_random:94904-94926 TTACTTAAGCACCCCGCTATGGG - Intergenic
950629229 3:14271041-14271063 TTATTTAACCAGTTCCCTGTTGG + Intergenic
950991589 3:17444485-17444507 TTATTTAACCATTCTTCAATTGG + Intronic
951029453 3:17864799-17864821 TTATTTAACCATTCCTTTATTGG + Intronic
951266689 3:20576401-20576423 TTACATAACCAGTCCTTCTTGGG + Intergenic
953791999 3:45954679-45954701 TAACTTAATCATTCCTCTACAGG - Intronic
954000433 3:47552680-47552702 CTATTTAACTAGGCCTCTATTGG - Intergenic
956414974 3:69015966-69015988 TTATTCAACCAGCCTTCTATTGG - Intergenic
957013574 3:75036773-75036795 TTATTTATCCAGTCCACCATTGG + Intergenic
959123358 3:102259715-102259737 TTATTTAACCAGTTCTGTATTGG + Intronic
959953494 3:112209116-112209138 GTACTTACCCAGTCTTCAATCGG - Intronic
960154711 3:114287667-114287689 TTATTGAACCATTCCTCTACTGG + Intronic
961054498 3:123776538-123776560 TTACTGAATCATTCCTCTGTTGG - Intronic
963378286 3:144497531-144497553 TTACTTACCCAGTCTCCAATTGG + Intergenic
965858022 3:173112519-173112541 TTACTTAACCTGTCCACCCTTGG + Intronic
966587777 3:181646505-181646527 TTATTTAGCCAGTCCCCTGTTGG - Intergenic
967970738 3:194997218-194997240 TTATTTAACCAATGCCCTATTGG - Intergenic
968263748 3:197346064-197346086 TTACTTAACCACTTCTTTATTGG + Intergenic
972297245 4:37751778-37751800 GTATTTAACCAGTCCTCTACTGG + Intergenic
973184504 4:47309588-47309610 TTACTTAACAATTCAGCTATTGG - Intronic
973192005 4:47396022-47396044 TTAGTTAACCACTCTTCTGTCGG + Intronic
973824181 4:54688489-54688511 TTTCTAAACCTGTCCTCTTTTGG - Intronic
976448492 4:85160097-85160119 TTCTTTATCCAGTCTTCTATAGG + Intergenic
976873597 4:89826838-89826860 TTACTTAACTACTTCTCTGTTGG + Intronic
977307279 4:95341292-95341314 TTATTTAACCATTCCTCAGTTGG - Intronic
977373596 4:96171292-96171314 CAACTTAACCATTCCTCTTTAGG - Intergenic
978383330 4:108153777-108153799 TTATTTAACCAGTATTTTATTGG - Intronic
978414151 4:108457987-108458009 TTATTTAACTAGTCCGCTATTGG - Intergenic
979105098 4:116675199-116675221 TTACTAAACCAATCATGTATGGG - Intergenic
979337332 4:119478419-119478441 TTATTTAATTAGTCCTCTAAGGG + Intergenic
979723317 4:123929693-123929715 TCACTTAAGAAGTCCTCTCTTGG - Intergenic
980372218 4:131890574-131890596 TTACTTAGTCATTTCTCTATTGG - Intergenic
982906456 4:161080741-161080763 TTACTTTTCCAGGCCTCTAAAGG - Intergenic
987357075 5:17073122-17073144 TTACTTATCCATTCATCAATTGG + Intronic
990566419 5:57033966-57033988 TTATTTAACTACTTCTCTATTGG - Intergenic
991624358 5:68584532-68584554 TTACTTAACTATTCCCTTATTGG - Intergenic
991966954 5:72102123-72102145 TTACTCAACCAGTCCATTGTTGG - Intergenic
994111029 5:96004499-96004521 CTACTTAACCAGTCCTATGCTGG + Intergenic
995121200 5:108536693-108536715 TTATTTTACCAGTCCACTACTGG + Intergenic
995296258 5:110526810-110526832 TTATTTAACCAATTTTCTATTGG - Intronic
997319449 5:132965256-132965278 TTATTTAACCAATCCCCTACAGG + Intergenic
998782662 5:145675623-145675645 CCACTAAACCAGTTCTCTATTGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999726701 5:154444537-154444559 TTACTTAACCACTTCCCTTTTGG + Intergenic
1000937064 5:167315020-167315042 TTACTTAACCATTCCTTTCTTGG + Intronic
1001047055 5:168382109-168382131 TTATTTAACCAGACCTCGATGGG - Intronic
1002077788 5:176719452-176719474 TTAGTTAACCAGTCCCCTACCGG + Intergenic
1004054278 6:12119553-12119575 ATACTTAAACAGTGCTCCATGGG - Intronic
1004403372 6:15309467-15309489 TAATTTAACCAATCCCCTATTGG - Intronic
1005720446 6:28596219-28596241 TTATTTAACCAGTTCTCTGTTGG - Intronic
1009955010 6:70442904-70442926 TTATTCAACCAGTCCCCTATTGG + Intronic
1011709632 6:90039165-90039187 TTATATAACCAATTCTCTATTGG + Intronic
1012409884 6:98945252-98945274 TTATTTAGCCAGTCCCCTGTTGG - Intronic
1012770665 6:103429476-103429498 TTCTTTAACCAGTCCACTGTTGG - Intergenic
1012817272 6:104039985-104040007 TTATTTAATCAGTCCTTTAATGG - Intergenic
1012860497 6:104553513-104553535 TTTCTTATCCATTCATCTATTGG - Intergenic
1013374359 6:109499961-109499983 TTACTCAACCATTTATCTATTGG + Intronic
1015470984 6:133606174-133606196 TAAGTTAACCAGTCCTCTATTGG - Intergenic
1016278982 6:142391068-142391090 TTATTTAACCAGTATCCTATTGG + Intronic
1017067717 6:150545105-150545127 TTATTTAACCATTCTTCCATAGG - Intergenic
1017259400 6:152369550-152369572 TTACTCAGCCAGTCCTGGATAGG + Exonic
1017382809 6:153849758-153849780 TTAGTTATCCATTCATCTATTGG - Intergenic
1018205176 6:161430431-161430453 TTGCTTAACCTGTTCTCTCTTGG + Intronic
1019228829 6:170539834-170539856 TTACCTAACCAGTCCTCTAAAGG - Intronic
1021466662 7:20951860-20951882 TAATTTAACCAGTCCACTGTTGG - Intergenic
1026325867 7:69309864-69309886 TTATTTCACCAGTCCTCTCTTGG - Intergenic
1026462702 7:70628985-70629007 TTACTAAACTCGTCCTCTCTTGG - Intronic
1026554264 7:71392250-71392272 TTACTTCCCCAGTCCCCTACTGG - Intronic
1033735937 7:144221886-144221908 TTACTTAATCAGTCCTGTATTGG + Intergenic
1033747114 7:144329066-144329088 TTACTTAATCAGTCCTGTATTGG - Intergenic
1033836402 7:145317507-145317529 TTATTTAACCAGTCTCCTATTGG + Intergenic
1034515477 7:151574193-151574215 TTATTTAACTAGTCCTATTTGGG - Intronic
1037849758 8:22317547-22317569 TTATTTAACCAATCCTCTCTTGG + Intronic
1039017393 8:33166909-33166931 TTATTTAGCCAGTTCTCTATTGG - Intergenic
1041337029 8:56797324-56797346 TTGCTTAGTCAGTCCTCCATTGG + Intergenic
1042037419 8:64550659-64550681 TTATTCAACCAGTCCTCTCTTGG + Intergenic
1044983584 8:97738988-97739010 TTACTTAACCATTTCCCTATTGG + Intergenic
1046272914 8:111919207-111919229 TTCCTTAGAAAGTCCTCTATTGG + Intergenic
1047095201 8:121617567-121617589 TTTCTTAAACAGACCTCTAGGGG - Intronic
1047322876 8:123804770-123804792 TTAGTTAACCAGTCCCCTGTTGG + Intronic
1047339315 8:123965232-123965254 TAACTTAATCAGTTCTCTATTGG + Intronic
1049946028 9:596667-596689 TTACTTTACCAGTTCCCCATTGG + Intronic
1050168149 9:2788025-2788047 TTGCTTAATCACTTCTCTATGGG - Intronic
1053345457 9:37374899-37374921 TAACTTAATCACCCCTCTATAGG - Intergenic
1053636955 9:40018433-40018455 TTACTTAGCCATTTCTCTATTGG - Intergenic
1053769074 9:41446469-41446491 TTACTTAGCCATTTCTCTATTGG + Intergenic
1054317784 9:63615226-63615248 TTACTTAGCCATTTCTCTATTGG - Intergenic
1054547745 9:66357970-66357992 TTACTTAGCCATTTCTCTATTGG + Intergenic
1055258393 9:74401515-74401537 TTGCTTATGCAGTCCTCTTTTGG - Intergenic
1055683476 9:78743278-78743300 TTGCTTAACCACACCTCCATGGG - Intergenic
1055912086 9:81364375-81364397 ATACTTAACCAGTTGTCTCTAGG + Intergenic
1055991387 9:82110197-82110219 TTTCTTACCCAGTCCTATTTTGG + Intergenic
1057292648 9:93816820-93816842 TTCCTTATCCAGTCATCTGTTGG + Intergenic
1058968369 9:110057689-110057711 TTACTAAACCAGTGCTGTAGGGG + Intronic
1058978900 9:110150977-110150999 TAACTTAACCATTCTTCAATAGG + Intronic
1061057037 9:128229041-128229063 TTACTTAACCATTTTCCTATTGG - Intronic
1061771956 9:132931930-132931952 TTTCTCAGCCAGTCTTCTATAGG - Intronic
1202784819 9_KI270719v1_random:2023-2045 TTACTTAGCCATTTCTCTATTGG - Intergenic
1185870978 X:3664564-3664586 TTCTTTATCCAGTCATCTATTGG - Intronic
1186774065 X:12846592-12846614 TTACTTAACCATTTCTCTAACGG - Intergenic
1186935447 X:14445754-14445776 TAATTTATCCAGTCCTCTCTTGG + Intergenic
1187165985 X:16804308-16804330 TTATTTAACCAGTTCCCTATTGG + Intronic
1187544926 X:20240697-20240719 TTATTTAACCAGTCCCTTGTTGG - Intronic
1189024592 X:37379495-37379517 TTATTTAATCAGTCCTCTATTGG - Intronic
1192982007 X:76354021-76354043 ATACTTAACCAGGCATCTGTAGG + Intergenic
1194947694 X:100089076-100089098 TTACTTATCCAGTCTATTATTGG - Intergenic
1194966274 X:100292202-100292224 CTACTTAACCAGTGCTGTAATGG + Exonic
1195289538 X:103418895-103418917 TTACTCAATCAGCCTTCTATTGG + Intergenic
1196777989 X:119358340-119358362 TTATTTAACTAGTCTTATATTGG - Intergenic
1198509235 X:137332605-137332627 TTCCTTAACAACTCCACTATAGG - Intergenic
1198536967 X:137595890-137595912 TTATTTTACCAGTGCTCCATCGG + Intergenic
1202365817 Y:24163432-24163454 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1202504965 Y:25506690-25506712 TTACTTAACCAGTTCCCTGTTGG + Intergenic