ID: 1096625870

View in Genome Browser
Species Human (GRCh38)
Location 12:52895677-52895699
Sequence ACATGTGAGCAGAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 488}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096625861_1096625870 9 Left 1096625861 12:52895645-52895667 CCACCCACCTGATTCTTGCTGAG 0: 1
1: 0
2: 0
3: 12
4: 268
Right 1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG 0: 1
1: 0
2: 6
3: 53
4: 488
1096625864_1096625870 6 Left 1096625864 12:52895648-52895670 CCCACCTGATTCTTGCTGAGGGC 0: 1
1: 0
2: 2
3: 19
4: 166
Right 1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG 0: 1
1: 0
2: 6
3: 53
4: 488
1096625865_1096625870 5 Left 1096625865 12:52895649-52895671 CCACCTGATTCTTGCTGAGGGCC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG 0: 1
1: 0
2: 6
3: 53
4: 488
1096625866_1096625870 2 Left 1096625866 12:52895652-52895674 CCTGATTCTTGCTGAGGGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 208
Right 1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG 0: 1
1: 0
2: 6
3: 53
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096625870 Original CRISPR ACATGTGAGCAGAAGGCAGA AGG Intergenic
900276605 1:1833747-1833769 ACATTTGAGCAGCAGGCAGATGG + Intronic
900554245 1:3271842-3271864 AGATGGGAGCAGAAGAGAGAAGG - Intronic
900647603 1:3716000-3716022 ACAGGTGAGCAGGAGCCACACGG - Intronic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
901034152 1:6326223-6326245 CCATGTGTGCAGTAGGGAGAGGG + Intronic
901391154 1:8947165-8947187 ACATGTGAGCCAAAGCTAGAAGG + Intronic
903353203 1:22730592-22730614 ACGTTTGAGCAGAGGCCAGAAGG + Intronic
903478649 1:23637675-23637697 ACAGTTGAGAAGAGGGCAGAAGG - Intronic
904174108 1:28613805-28613827 CCATGTAAGTAGAAAGCAGAAGG + Intronic
904475548 1:30762414-30762436 AGATGGGACCAGCAGGCAGAAGG + Intergenic
904903572 1:33877103-33877125 ATGTGTGGGCAGAAGGCAAATGG + Intronic
906059503 1:42939228-42939250 ACATGTGAAGAGAGGACAGAAGG - Intronic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906588356 1:47000801-47000823 ACAGGTGGGAAGAAGGCAGGTGG + Intergenic
906933742 1:50193976-50193998 TCATAAGAGCAGAAGGCTGATGG + Intronic
907451289 1:54547495-54547517 GCCTGTGGGCAGAAGTCAGAGGG + Intronic
908414322 1:63898178-63898200 ACATGTGAACAGAAAACAAATGG - Intronic
908420711 1:63955956-63955978 ATATGGGAAGAGAAGGCAGAAGG + Intronic
909897299 1:81088644-81088666 ACTTGTGAGAAAAAGGCAAATGG + Intergenic
910173531 1:84403515-84403537 TCAGCTGAGCAGAAGGAAGAAGG + Intronic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
911171941 1:94779352-94779374 ACATATCATCAGTAGGCAGATGG + Intergenic
911445387 1:97985638-97985660 AACGGTGAGCAGAAGGAAGATGG - Intergenic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
912935922 1:114003546-114003568 ACATGTGAGGAGGAGCCAAAAGG - Intergenic
913164802 1:116175231-116175253 ACATCTGAGCAGAAACCTGAAGG + Intergenic
914384934 1:147159333-147159355 ACATATGAGAAGAAGGTAAATGG - Exonic
915225658 1:154409351-154409373 GGAGGAGAGCAGAAGGCAGAGGG - Intronic
916202392 1:162284349-162284371 ACATCTGACCAGCAGGCAGGTGG + Intronic
917524848 1:175779278-175779300 ACATGTGACCAAAAAGCATATGG + Intergenic
918389883 1:184048062-184048084 ACATGTGGGCAGATGCAAGAAGG - Intergenic
918576933 1:186072785-186072807 AAATGTGAGCAGAAGACTAATGG + Intronic
920683212 1:208089130-208089152 ACATCTTTCCAGAAGGCAGATGG - Intronic
920778631 1:208966174-208966196 AAATGTAAGCAGATGACAGAGGG + Intergenic
921252412 1:213310315-213310337 AGAGGTGAGCAGGAGCCAGATGG - Intergenic
921709736 1:218361870-218361892 ATATGTGAGCAGATGTCAGCTGG + Intronic
922235920 1:223722532-223722554 ACTTGGGAGGATAAGGCAGAAGG - Intronic
923402984 1:233633223-233633245 ACCTGTCAGAAGAAGGCAAATGG - Intronic
923685294 1:236149266-236149288 ACATGAGAGCAGAAGGCACTGGG + Intronic
923985675 1:239379041-239379063 ACAAGTGAATAGATGGCAGAAGG - Intergenic
924644498 1:245865102-245865124 ACATGTGTGCACAATGCTGAAGG + Intronic
1062979347 10:1708886-1708908 GTATGTGAGCAGAGGGCTGAGGG + Intronic
1063065391 10:2602708-2602730 ACATGTGGGCAGCAGAGAGATGG - Intergenic
1063105267 10:2986997-2987019 ACCTGGGAGCAGAAAGGAGAAGG - Intergenic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1064348897 10:14558562-14558584 TCAGGTGAGCAGTAGCCAGATGG - Intronic
1065239557 10:23692574-23692596 AGTTGTGAACAGAAGGCAGTGGG + Intergenic
1065875291 10:29992632-29992654 ACATGTGAGGGCAAGGAAGAGGG + Intergenic
1065922586 10:30405946-30405968 ACATTTGAACAGAAGCCTGAAGG - Intergenic
1067048128 10:42997357-42997379 ACATGTGATCAGAGGGAAGCTGG - Intergenic
1067177329 10:43959236-43959258 ACACATGAGGAGAAGGCAGCTGG + Intergenic
1067524484 10:47029854-47029876 CCATGTGAGGACATGGCAGAAGG - Intergenic
1068801465 10:61145277-61145299 CCATGTGAGCAGCAAGCAAAAGG - Intergenic
1069852806 10:71421274-71421296 ACATGGTGGCAGAAGGCAGAGGG - Intronic
1070500957 10:77072036-77072058 ACATGACAGCAAAAGGCAGGAGG + Intronic
1070696356 10:78566560-78566582 CCATGTCAGCATCAGGCAGATGG + Intergenic
1071978304 10:90977405-90977427 ACATTTAGGCAGAAGGCAGTGGG + Intergenic
1072433170 10:95391519-95391541 AGATGTTAGCAGAAGGGAGGGGG - Intronic
1072811108 10:98462691-98462713 GCATCTGAGAAGCAGGCAGAGGG - Intronic
1073200715 10:101732929-101732951 ACATGAGAGAAGAAGAGAGAAGG - Intergenic
1073600888 10:104845086-104845108 ACCTGGGAGCACTAGGCAGAGGG - Intronic
1074250306 10:111738536-111738558 ACATTTGGGCAGAAGGCTTAGGG - Intergenic
1075153424 10:119955355-119955377 ACATTTGAGCAGAGACCAGAGGG + Intergenic
1075202736 10:120419629-120419651 ACCTGTGAGCTGATGCCAGAAGG + Intergenic
1075240051 10:120770224-120770246 AAATGTGAGCAAAGTGCAGAGGG + Intergenic
1075660769 10:124194022-124194044 TCTTTTGAGCAGAAGGAAGAAGG + Intergenic
1075810572 10:125222007-125222029 TCCTGTGAGCAGGAGGCAAAGGG - Intergenic
1076013088 10:127006255-127006277 GCAGGAGAGCAGAAGGCAGGAGG - Intronic
1076103879 10:127804665-127804687 TCATGGGAGAAGAAGACAGAAGG + Intergenic
1076984203 11:223624-223646 ACGTGTGAGGAGAAGGGAGAAGG - Intronic
1077636270 11:3843265-3843287 ACATGAGAGCAGGAGGCACAAGG + Intergenic
1078139205 11:8679751-8679773 GCATGTGACCAGCAGGAAGAGGG - Intergenic
1078339299 11:10487510-10487532 GCATATGTGCAGAAGGAAGATGG + Intronic
1078480322 11:11669655-11669677 GCATGGGAGCAGAAGGCAGCGGG + Intergenic
1078889547 11:15542110-15542132 ACATATGCGCAGATGGAAGAAGG - Intergenic
1078915543 11:15775173-15775195 AAATGTGAGGAGATGGCAGCAGG - Intergenic
1078962648 11:16296424-16296446 GCAGCTGAGCAGAAGGAAGATGG + Intronic
1079120453 11:17680394-17680416 CCAGGTGAGCAGAAGCCATATGG - Intergenic
1079935874 11:26615319-26615341 ACATGAGAACAGAAGGAATAGGG - Intronic
1080195684 11:29605828-29605850 ACATGTGAGGAAAAGCTAGAAGG - Intergenic
1080985406 11:37457940-37457962 ACCTGAGAGTAGAAGGAAGATGG - Intergenic
1083944132 11:65914717-65914739 AGATGAGAGCAGCAGGCAGGCGG + Intergenic
1084150073 11:67284008-67284030 ACAGGTGATAAGAAGGGAGAGGG - Intronic
1084553911 11:69864729-69864751 AGAGGTGAGCAGGAGGCAGCTGG + Intergenic
1084783073 11:71424085-71424107 ACATGTGTGGAGCAGGCAGAAGG + Intergenic
1085000002 11:73024479-73024501 ACATGTAAACAGATGGCAGAGGG + Intronic
1085039088 11:73316529-73316551 ACATTTGAGCAGAAGCCTGGAGG + Intronic
1085432979 11:76471954-76471976 ACATATGAACAGAAACCAGAAGG - Intronic
1086203780 11:84234346-84234368 ACTGATGGGCAGAAGGCAGAAGG - Intronic
1086882661 11:92167587-92167609 GCATGTTAGCAGAAGCCATAAGG + Intergenic
1087734487 11:101816746-101816768 ACTTGTGAACAGATGGCAGGAGG - Intronic
1088041076 11:105382822-105382844 ACAGGGGAGCAGAATACAGAAGG - Intergenic
1089386998 11:118074946-118074968 AAATGGGAGCAGAAGCCAGGAGG + Intergenic
1089539967 11:119183854-119183876 ACAGGTGAGCATAAGGCAGGAGG - Exonic
1089773160 11:120817592-120817614 AGAGGTGAGCAGAATGGAGAGGG - Intronic
1090231108 11:125104404-125104426 ACATTTAAGCAGAAATCAGAAGG - Intronic
1090887781 11:130894379-130894401 GCATTAGAGCAGAAGGAAGAAGG + Intronic
1090929626 11:131283863-131283885 AGATGTGAGCAGAAAACAGAAGG - Intergenic
1091002242 11:131919421-131919443 ATGTGTGAGCTGAAGGGAGAAGG + Intronic
1091186452 11:133651989-133652011 ACAAGAAAGCAGAAGGCAGCAGG + Intergenic
1091239523 11:134043184-134043206 ACAGATGCTCAGAAGGCAGAAGG - Intergenic
1091907208 12:4198617-4198639 ATCTGAGAGCAGAAAGCAGAGGG + Intergenic
1092001555 12:5036799-5036821 ACATGTTACCACATGGCAGAAGG + Intergenic
1092236518 12:6814121-6814143 ACCTGGGAGCAGAAGACATATGG - Exonic
1092494002 12:8973442-8973464 TCATATGGGCAGAAGGCAGAAGG - Intronic
1095736000 12:45556878-45556900 ACATATGAGCAGAAGTCTGTTGG - Intergenic
1096380257 12:51151069-51151091 ACATGTGAGCAGAAACCTAAAGG + Intronic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1096816093 12:54202791-54202813 ACATGGGAGGCCAAGGCAGAAGG + Intergenic
1097368249 12:58743302-58743324 ACATGGCAGCAGAAAGAAGAAGG - Intronic
1097442801 12:59632126-59632148 ACATGCTAGCAGAGGGAAGATGG + Intronic
1097922076 12:65086633-65086655 ACTTGGGAGAAGAAGGGAGAGGG + Intronic
1099136532 12:78910807-78910829 ACATGTGAGCTGACACCAGAAGG + Intronic
1099990706 12:89718002-89718024 CCATGTGAGGACAGGGCAGAAGG - Intergenic
1100109501 12:91221823-91221845 ACCACTGAACAGAAGGCAGAAGG - Intergenic
1100735280 12:97522487-97522509 ACATGTGACCATAAAGCAAAAGG - Intergenic
1100789541 12:98115417-98115439 CCATGTGAGCATAAGTCATAGGG + Intergenic
1100806763 12:98293393-98293415 ACTTGGGAGCCGAAGGCAGGAGG - Intergenic
1100861241 12:98809638-98809660 TGATGTCACCAGAAGGCAGAGGG + Intronic
1101401984 12:104396414-104396436 ATTTGGGTGCAGAAGGCAGATGG - Intergenic
1101410711 12:104465707-104465729 CCATGTGCGCAGAACTCAGAAGG + Intronic
1103147859 12:118610972-118610994 AGCTGTGATCTGAAGGCAGAAGG - Intergenic
1103214893 12:119194407-119194429 ACATCTGGGCAGAGGGCAGAAGG - Exonic
1103848956 12:123918613-123918635 AGATGTGGGCAGAGGGCAGGAGG - Intronic
1104568768 12:129907270-129907292 AAATGTGAGCAGAAGTCATGGGG + Intergenic
1104849081 12:131862652-131862674 AAAATTGAGCAGAAGGTAGAGGG + Intergenic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1105250958 13:18698111-18698133 ACAGGCGAGCAGCAGGCCGAGGG - Intergenic
1105284407 13:18992904-18992926 AGACGAGAACAGAAGGCAGAAGG + Intergenic
1105284940 13:18996008-18996030 CCAGATGAGCGGAAGGCAGAAGG + Intergenic
1105644697 13:22304251-22304273 ACATGGCAGCAGTAGGGAGAAGG + Intergenic
1106748546 13:32731403-32731425 ACATGTGAGCAGAGTTCTGAGGG - Intronic
1106758766 13:32847698-32847720 GCATGTGTGAAGAAGGGAGAGGG + Intergenic
1107056069 13:36104938-36104960 ATATGAGAACAGAAGGGAGAAGG + Intronic
1107575103 13:41710171-41710193 ACATGTAATCAGAATGCAAAGGG - Intronic
1110242247 13:73282298-73282320 GCCAGTGAGAAGAAGGCAGAAGG - Intergenic
1112586050 13:100719807-100719829 ACATGGCAGCAGGAGGGAGAGGG - Intergenic
1112938396 13:104829262-104829284 ACATGTGAGAAGGATGCTGAGGG + Intergenic
1113316571 13:109186382-109186404 ACAGATGAGCACAAGGCAGATGG + Intronic
1114430869 14:22659245-22659267 AAATGTTAAGAGAAGGCAGAGGG - Intergenic
1114763658 14:25346266-25346288 ACATGAGAGCCCAAGGCAGGAGG + Intergenic
1115037420 14:28875380-28875402 ACTTGGGAGAAGAAGGAAGAGGG + Intergenic
1115521200 14:34234635-34234657 ACATGGCAGAAGAAGGCAAAGGG - Intronic
1115780321 14:36761256-36761278 AGAGGAGAGCAAAAGGCAGACGG - Intronic
1116070918 14:40044528-40044550 TTTTGTGAACAGAAGGCAGATGG - Intergenic
1117234850 14:53761967-53761989 ACATGTGAGCATCAGGTAGAAGG + Intergenic
1117504162 14:56385043-56385065 ACATGGTAGCAGGAGACAGAGGG - Intergenic
1117762150 14:59040539-59040561 GCATGTGAGAAGAAAGTAGAAGG + Intergenic
1118276383 14:64389201-64389223 AAATGAGAGTAGAAGGAAGAGGG + Intronic
1118518808 14:66557721-66557743 ACATTTAAGCAGAATCCAGAGGG - Intronic
1118630409 14:67697317-67697339 ACATTTGAGCGGAGGCCAGAGGG + Intergenic
1119002998 14:70899842-70899864 ACATGTGAGAAAATGGCAGCAGG - Intergenic
1119480026 14:74953315-74953337 ACATATGTACAGAAGGCAGGAGG - Intronic
1119896702 14:78225841-78225863 ACATGTGAGCAGTAACCATAAGG - Intergenic
1120217164 14:81692617-81692639 AAATGTGAGAATAAGGGAGATGG + Intergenic
1120605700 14:86574586-86574608 ACATATGAGCATAATGAAGACGG + Intergenic
1120829613 14:88986422-88986444 TCCTGTGAGGAGGAGGCAGAGGG - Intergenic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1121551637 14:94807215-94807237 AAATGTTTGCAGAAGGTAGAAGG - Intergenic
1121978211 14:98426335-98426357 ACATGTGATCAGAAAGAATAAGG - Intergenic
1121994338 14:98590440-98590462 AGATGGGAGCAGAAGGGAGATGG + Intergenic
1122309434 14:100785244-100785266 GCAGGGGAGCAGAAGGCAGGGGG - Intergenic
1122319749 14:100846964-100846986 ACAAGTGATCAAAAGGGAGAAGG + Intergenic
1122349858 14:101082836-101082858 ACTTATGAGCAGAGGACAGAGGG + Intergenic
1124949258 15:34301370-34301392 ACATAAGAGCTGAAGACAGAAGG + Intronic
1126062396 15:44795517-44795539 ACATTTGAGCAGAGAGCTGAAGG + Intergenic
1126368615 15:47922208-47922230 ACTTAAGAGCAGAATGCAGATGG - Intergenic
1126461502 15:48919660-48919682 AGAAGAGAGCTGAAGGCAGAGGG - Intronic
1126599263 15:50412728-50412750 ACTTGGGAGGAGAAGGGAGAGGG - Intergenic
1127768320 15:62209481-62209503 ACAGGTGAGAAGAAGCCATAGGG + Intergenic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1128357537 15:66938620-66938642 AGATGTAAGCAGAAGTCAGCTGG + Intergenic
1129446236 15:75620479-75620501 ACATTTGGGCTGAAGGCAGATGG + Intronic
1130657100 15:85799290-85799312 ACATGTGAGCAGAAACCAGAAGG - Intergenic
1131116303 15:89798140-89798162 AAATGTGTACAGAAGGCAGGAGG - Intronic
1132663521 16:1071805-1071827 ACCTGTGAACAGACGGCAGGCGG + Intergenic
1134030773 16:10990615-10990637 GGATGGGAGCAGGAGGCAGATGG + Intronic
1134224075 16:12378245-12378267 TCGTGGCAGCAGAAGGCAGAGGG + Intronic
1134605093 16:15564046-15564068 TCATGTGTGCAGAAGTCACAGGG - Intronic
1135098129 16:19581504-19581526 CCCTGTGGGGAGAAGGCAGAAGG - Exonic
1135596303 16:23745987-23746009 ATTAGTGAGCAGAAGGGAGATGG + Intergenic
1135677816 16:24432147-24432169 ACATGTTGTCAGAAGGCAAAGGG + Intergenic
1136579749 16:31144002-31144024 CCCTGTAAGCAGAAGGCCGATGG + Intronic
1137015417 16:35369466-35369488 ACCTGTGAGCAGAACCAAGAAGG + Intergenic
1138135486 16:54517653-54517675 ACATGTAAGCAGAGGCCTGAAGG - Intergenic
1138163677 16:54779438-54779460 GCATGGGAGCAAAAGGCAGAGGG + Intergenic
1138801167 16:60031744-60031766 ACATTTAAGGAGAGGGCAGAAGG - Intergenic
1140716686 16:77733004-77733026 ACAGGTGAAAAGAAGGCTGATGG - Intronic
1140733577 16:77877962-77877984 ACATGTGAGTCAAATGCAGATGG + Intronic
1140908067 16:79427192-79427214 AAATGTGAGGAGTAGGCAAATGG + Intergenic
1140988890 16:80188806-80188828 ACATCTGAGCAGAGGCCTGAAGG - Intergenic
1141685724 16:85568784-85568806 AGATGGGAGCAGAAATCAGAGGG + Intergenic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143300809 17:5909591-5909613 AGCTGTGAGCCCAAGGCAGAGGG + Intronic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1144388621 17:14772859-14772881 AACTGAGAGCAGAAGGCAGAAGG + Intergenic
1144574097 17:16418079-16418101 ACATGACCTCAGAAGGCAGAAGG - Intronic
1144628366 17:16857058-16857080 AGCTGTGAGCAGGAGGCAGGAGG + Intergenic
1144950600 17:18991638-18991660 CCATGTGAGCAGCTGGCACAGGG + Intronic
1145058740 17:19719339-19719361 TCATGTCAGCAGATGGAAGAAGG + Intergenic
1145159958 17:20567628-20567650 AGCTGTGAGCAGGAGGCAGGAGG + Intergenic
1145224372 17:21115885-21115907 ACATGTAAGCAGAAGTGACATGG - Intergenic
1145245219 17:21264689-21264711 AGCTCTGGGCAGAAGGCAGATGG - Intergenic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146842419 17:36165111-36165133 AGACATGAGCTGAAGGCAGAGGG + Intergenic
1146854730 17:36253070-36253092 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1146865890 17:36335306-36335328 AGACGTGAGCTGAAGGCAGAGGG - Intronic
1146870630 17:36376962-36376984 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1146877988 17:36428043-36428065 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1147068760 17:37935918-37935940 AGACGTGAGCTGAAGGCAGAGGG - Intergenic
1147073513 17:37977586-37977608 AGACGTGAGCTGAAGGCAGAGGG + Intergenic
1147080283 17:38015455-38015477 AGACGTGAGCTGAAGGCAGAGGG - Intronic
1147085035 17:38057124-38057146 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1147096231 17:38139415-38139437 AGACGTGAGCTGAAGGCAGAGGG - Intergenic
1147100981 17:38181090-38181112 AGACGTGAGCTGAAGGCAGAGGG + Intergenic
1147586528 17:41656459-41656481 ACCTGGGAGCAGGAGGCAGCAGG - Intergenic
1147859780 17:43512080-43512102 ACCTAAGAGTAGAAGGCAGATGG + Intronic
1148536457 17:48443047-48443069 ACATGTGAGCAAACGGAAGTGGG - Intergenic
1149682678 17:58517137-58517159 ACCTGTGATCAGAGGGCAGCAGG + Intronic
1150083921 17:62264136-62264158 AGACATGAGCAGAAGGCAGAGGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150691540 17:67371305-67371327 ACTTGGGAGATGAAGGCAGAAGG - Intergenic
1150984400 17:70179196-70179218 ACATGTCATTAGAATGCAGACGG + Exonic
1151351720 17:73535864-73535886 TCATGTGGGGAGAAGGCAGGGGG + Intronic
1151365015 17:73611546-73611568 CCATGTGAGCAGAGGCCACAGGG - Intronic
1151545525 17:74790648-74790670 ACATGAGGGCACAAGGCAGGAGG - Intronic
1151567151 17:74905038-74905060 ACATGGGGACAGAAGGCAGCGGG + Intergenic
1151980711 17:77506798-77506820 TGCTGGGAGCAGAAGGCAGAGGG - Intergenic
1153526224 18:5997506-5997528 ACATGTGAGAGGAAGGTAGAGGG - Intronic
1155101519 18:22615023-22615045 GCCTATGAGCAGAAGGCAGCGGG + Intergenic
1155581020 18:27306340-27306362 ACATGTGAGCATGAGTCGGAAGG - Intergenic
1155676097 18:28430679-28430701 ACAAGTGAGCAGAAACCAAATGG + Intergenic
1156019608 18:32584940-32584962 ATATGTGAGCAGAAACAAGAAGG + Intergenic
1156530524 18:37810653-37810675 ACATGGGAGAAGAAGGCATGAGG + Intergenic
1157091669 18:44644060-44644082 ACATCTGGGCAGAAATCAGAAGG + Intergenic
1157150127 18:45208520-45208542 ACATGTGGAAAGAAGGGAGAAGG + Intergenic
1157190960 18:45581196-45581218 AGATGAGAACAGAGGGCAGAGGG + Intronic
1158073807 18:53505204-53505226 ACAGGTGAGTTAAAGGCAGATGG - Intronic
1158326558 18:56319620-56319642 ACATCTGAGCAGAGTGGAGAAGG + Intergenic
1159573108 18:70143128-70143150 ACATGTGGCCAAAAGGCATATGG - Intronic
1159790317 18:72771170-72771192 TTATGTGAACAAAAGGCAGATGG + Intronic
1160030898 18:75258868-75258890 ACATGTGAGTAAATGGCAGCTGG - Intronic
1162400645 19:10444570-10444592 ACATTTGAGCAGAGGCCTGAAGG + Intronic
1163755078 19:19101748-19101770 ACATGTGATCAGAGGTCAGAGGG - Intronic
1163779448 19:19238935-19238957 ATGGATGAGCAGAAGGCAGAGGG - Intronic
1166614825 19:44233981-44234003 ACATGTGAGCAGAGACCTGAAGG + Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1166866333 19:45840032-45840054 ACATGGGATCAGGAGGCACATGG - Intronic
1168197600 19:54787070-54787092 ACATGAGAGGAGAAGGAAGAGGG + Intronic
925620636 2:5789227-5789249 ACATGAGTGCAGAAGGAAGGAGG + Intergenic
926228755 2:10986925-10986947 CCATGTAGGAAGAAGGCAGAGGG + Intergenic
926618351 2:15021949-15021971 AATTGTAGGCAGAAGGCAGAAGG + Intergenic
927138079 2:20111872-20111894 ACAAGTGAGCAGAGGGCTCAAGG + Intergenic
927187388 2:20491766-20491788 ACCTGTGAAAAGAAGGCGGAGGG - Intergenic
927987195 2:27420333-27420355 CCATGTAAGAGGAAGGCAGAGGG - Intergenic
929781695 2:44961341-44961363 TCCTGTGAGCAGGAGGTAGATGG - Intergenic
929896252 2:45963225-45963247 ACATGTTCCCAGAAAGCAGAGGG - Intronic
931418353 2:62102582-62102604 ACAGGAGAGCAGGGGGCAGAAGG - Intronic
931878808 2:66544180-66544202 ACCTGTGGGCAGAAGGCAACAGG + Intronic
932267159 2:70377705-70377727 ACATGTGAGCAGGGGGCTGGAGG + Intergenic
932901939 2:75710973-75710995 AGCGGTGAGCAGAAGGCAGGCGG - Exonic
933099497 2:78234769-78234791 ACATGTGGGAAGAGGACAGAAGG + Intergenic
933730504 2:85452608-85452630 ACATCTGAGCAGAGACCAGAAGG - Intergenic
934492353 2:94770156-94770178 ACTTGTGATCAGAAGGCTCACGG - Intergenic
935158808 2:100510869-100510891 ACATGTGAGGCGGAGGCAGGAGG + Intergenic
935511591 2:103982866-103982888 TCATTTGGGAAGAAGGCAGAGGG + Intergenic
935640603 2:105286409-105286431 TCATCTGAGCAGAGGGCAGGAGG - Intronic
936905572 2:117532313-117532335 ACATGGGAGCACAAACCAGATGG - Intergenic
937674709 2:124577604-124577626 GAATGTGGGCAGAAGGGAGATGG + Intronic
938105437 2:128526799-128526821 ACATGTGCACAGGAGGCAGTGGG + Intergenic
938390160 2:130898678-130898700 ACCTGTGAGGAGAAGGCAGTGGG + Intronic
939597438 2:144143773-144143795 ACATGTGTTCATAAGTCAGAGGG + Intronic
941885915 2:170527211-170527233 TCCAGTGAGAAGAAGGCAGAGGG + Intronic
942533509 2:176938185-176938207 TGATGGGAGCAGAAGTCAGAAGG + Intergenic
942588622 2:177515468-177515490 ACTTGGGGGCAGAAGGAAGAAGG - Intronic
943753220 2:191531724-191531746 ACCTGTGGGAGGAAGGCAGATGG + Intergenic
943854180 2:192767281-192767303 CCATATGAGCAGAAGGCAAGAGG - Intergenic
943855264 2:192782487-192782509 ACATTTGAGCAGAATACTGAAGG + Intergenic
944273052 2:197804821-197804843 CGATGTGAGCGGGAGGCAGAAGG - Exonic
944939334 2:204606527-204606549 AAATGTGAGCAGAAGTAACATGG - Intronic
947077419 2:226360909-226360931 ACCTGTGAGCACAAGGCTGTGGG + Intergenic
947115367 2:226764432-226764454 ACATGGGAGGATAAGGCAGGAGG + Intronic
947322939 2:228942723-228942745 ACATGTGAGAAGACACCAGAAGG + Intronic
948685459 2:239666970-239666992 ACATCTGAGCAGAGGGCTGGAGG - Intergenic
949064019 2:241978757-241978779 CAATGTGAGCACAAGTCAGAAGG - Intergenic
1168857687 20:1020209-1020231 ACATTTGAGCAGAAGCCTGAAGG + Intergenic
1169241956 20:3989602-3989624 ACATGTGTGCAGAAGGAAGATGG - Intronic
1169908805 20:10630362-10630384 ACTGGTGAGAAGAACGCAGAAGG + Intronic
1170281125 20:14650033-14650055 GAATGGGAGCAGGAGGCAGAAGG + Intronic
1171188959 20:23144820-23144842 ACAGGTTAGCAGGAGGCAGGAGG + Intergenic
1171370854 20:24661277-24661299 GCAAGTGAGCAGAAGAAAGAAGG + Intronic
1171471899 20:25378872-25378894 TAATGAGAGCAGAGGGCAGATGG - Intronic
1172036969 20:32018040-32018062 CCAGGTGAGCAGCAGGCAGCGGG - Exonic
1172069555 20:32246557-32246579 ACATTTGAGCAGAGGCCTGAAGG + Intergenic
1172397570 20:34619907-34619929 ACATGGGAGCTGAAGGGTGAAGG - Intronic
1172417402 20:34781417-34781439 AAATGTGTGAAGAAGCCAGATGG + Intronic
1172435245 20:34924436-34924458 ACATTTGAGCAGAGGCCTGAAGG + Intronic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173922330 20:46755650-46755672 ACATTTGAGCAGAGGTCAGAAGG - Intergenic
1174177013 20:48651603-48651625 ACATCTGAGCAGAGATCAGAGGG + Intronic
1174180734 20:48672721-48672743 ACATTTGAGCAGAGGGCTGAGGG - Intronic
1175744490 20:61445597-61445619 ACAGGTCAGCAGGAGGCAAAGGG + Intronic
1178238677 21:30873719-30873741 AAATGTGAGCAGAAGTCGTAGGG + Intergenic
1179571204 21:42279861-42279883 ACACGGGACCCGAAGGCAGATGG + Intronic
1180393977 22:12312526-12312548 AGGTGTAAGCAGGAGGCAGAAGG - Intergenic
1180405770 22:12552224-12552246 AGGTGTAAGCAGGAGGCAGAAGG + Intergenic
1180786872 22:18552495-18552517 CCATGTGAGCAGCAGCCAGCGGG + Intergenic
1180841429 22:18960635-18960657 CCCTGTGTGCAGATGGCAGATGG - Intergenic
1181060067 22:20278159-20278181 CCCTGTGTGCAGATGGCAGATGG + Intronic
1181243783 22:21492016-21492038 CCATGTGAGCAGCAGCCAGCGGG + Intergenic
1181608140 22:23992881-23992903 ACATGGGAGGGTAAGGCAGAAGG - Intergenic
1181982786 22:26777873-26777895 ACATCTCAGCAGAAGCCAGTGGG + Intergenic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182044392 22:27262877-27262899 ACAGGTGAGCAGAGGGCCTAGGG - Intergenic
1184495768 22:44840438-44840460 TCTAGTGAGCAGAAGGGAGAGGG - Intronic
1184924999 22:47630510-47630532 AGGTGAGACCAGAAGGCAGAGGG - Intergenic
949571514 3:5298025-5298047 ACATCTGAGCAGCAGCCAGAAGG - Intergenic
949754825 3:7397026-7397048 ACATGTGAGTAGTAGGAAAATGG - Intronic
950112088 3:10425741-10425763 ACCAGTGTGCAGATGGCAGAGGG - Intronic
950281963 3:11715735-11715757 AAATGTGACCAGAAGCCGGAAGG - Intronic
951174032 3:19578344-19578366 ACATGGCAGCAGAAGAGAGAAGG + Intergenic
951500429 3:23380553-23380575 AAATATGAGCAGAAGGTATAGGG - Intronic
952184066 3:30949378-30949400 AGATGTAAGTAGAAGGCAGTAGG + Intergenic
952725163 3:36575827-36575849 ACATGAAGGCAGAAGGCAAAAGG - Intergenic
953070602 3:39515724-39515746 ATATTTGAGCAGAAGGCACCTGG - Exonic
953282942 3:41576140-41576162 GGATGTGAGGAGAAGGCTGAAGG - Intronic
953390132 3:42529048-42529070 ACATGTGCACAGGAGGCAGCAGG - Intronic
953479989 3:43243119-43243141 ACATGTAAGTATAAGGGAGATGG - Intergenic
954117497 3:48475361-48475383 AGGAGGGAGCAGAAGGCAGAGGG + Intronic
954363638 3:50135060-50135082 TCATGTGAGCAGCAGGCATCTGG + Intergenic
954645193 3:52127044-52127066 ACCTGTGTGAAGAAGGCAGGAGG - Intronic
955206733 3:56902753-56902775 ACATGTGAGCAGACCAGAGAAGG + Intronic
955857342 3:63287323-63287345 AAAGGTGAGCAAAAGGGAGAGGG - Intronic
955917444 3:63921008-63921030 ACTTTTGAGAAAAAGGCAGAGGG + Intronic
956674512 3:71721845-71721867 ACATGTGAGCAGAGGCTTGAAGG + Intronic
956791037 3:72680316-72680338 ATATATGGGAAGAAGGCAGATGG - Intergenic
957140957 3:76356270-76356292 ACAAGTGAGCAAAAAACAGATGG + Intronic
957363262 3:79186674-79186696 AAATGTGAGCAGAAGATTGAAGG + Intronic
958127688 3:89379115-89379137 AAATCTGAGCAGAAAGCAAAGGG - Intronic
959273324 3:104242279-104242301 AAATTTCAGCAGCAGGCAGATGG - Intergenic
959829353 3:110841961-110841983 CCATTTAAGCAGAAGTCAGATGG + Intergenic
961435496 3:126913684-126913706 ACATGTAGGCAGCAGGGAGAAGG - Intronic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
962273371 3:133994554-133994576 TCATGTGGGGAGAAGGAAGAGGG - Intronic
962368205 3:134799701-134799723 ACAAGTCAATAGAAGGCAGAAGG - Intronic
962621406 3:137183612-137183634 GCATGTGATCAGTAGGCATATGG - Intergenic
963323811 3:143838784-143838806 AAATGTGAGCATAAAGAAGAAGG + Intronic
963661684 3:148134385-148134407 AGATGTGTGCAGAAGGCAAAGGG + Intergenic
964006321 3:151833612-151833634 ACATGTGAAGAGTAGGCAGTAGG - Intergenic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
964709090 3:159652689-159652711 ACATCTGAGCTGAAACCAGAAGG + Intronic
964735561 3:159913688-159913710 ACATCTGCTCAGAAGGCAGCTGG + Intergenic
966850780 3:184163991-184164013 AGAGATGAGCAGATGGCAGAAGG - Intronic
966921760 3:184616586-184616608 ACATGTGAGCGGAATGCTGCCGG - Intronic
967656679 3:192058567-192058589 ACATTTGAGCTGAAGGTAGTTGG - Intergenic
967776095 3:193387625-193387647 AGATCTGAGCAGACTGCAGACGG - Intergenic
967910630 3:194539826-194539848 AGATCTGAGCAGAATGGAGAAGG - Intergenic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
968601258 4:1510957-1510979 ACATGAGAGTAGGAGGCTGAGGG + Intergenic
969148001 4:5141289-5141311 ACATGTGAGCAGAGACCTGAAGG + Intronic
969290686 4:6237357-6237379 ACATCTGAGCAGAAGGGACTCGG - Intergenic
969648130 4:8445589-8445611 ACATTTGAGCAGAGAGCCGAAGG - Intronic
970012884 4:11479986-11480008 GCATGTGAGCAGAACCCTGAAGG + Intergenic
970589356 4:17545992-17546014 ACAGGTGAGCAGATCGCAGTAGG - Intergenic
972529162 4:39946271-39946293 ATATGTGGGAAAAAGGCAGATGG + Intronic
972604139 4:40598777-40598799 ACATATGAGCAGAGGACAGATGG - Intronic
972639948 4:40916351-40916373 TCTTGTGAGCAGAAGCCACAAGG - Intronic
973808432 4:54547626-54547648 AGGTGGAAGCAGAAGGCAGAAGG - Intergenic
975668197 4:76754570-76754592 TCCTGTGAGCAGTAGCCAGAGGG - Exonic
975844254 4:78508241-78508263 ACAAGTTAGCGGAAGTCAGAAGG - Intronic
976047622 4:80970144-80970166 ACTTGGGAGAATAAGGCAGAAGG - Intergenic
977792296 4:101121827-101121849 ACATATGAACAGAAAACAGATGG + Intronic
978610104 4:110528424-110528446 ACATCTGAACAGAAAGTAGATGG - Intronic
980628800 4:135408112-135408134 ACCAGTGAGCAGTAGGCAAAAGG + Intergenic
981048909 4:140292045-140292067 ACAGAGGAGCAGGAGGCAGAGGG - Intronic
982846094 4:160254181-160254203 ACATTTGAGCAGAAACCTGATGG - Intergenic
984883571 4:184430508-184430530 ACATAGGAGCTGGAGGCAGAGGG - Intronic
984897436 4:184554022-184554044 AGATCTGAGCAGAAGGCAGATGG - Intergenic
985363700 4:189203347-189203369 ACATGTGAGCTGAGAGCTGATGG - Intergenic
986229828 5:5852960-5852982 AGATGTGGGCAGAGGGCAGCAGG + Intergenic
986269275 5:6217295-6217317 ACAGGGGAGCAGCAGGCAGCAGG - Intergenic
986881148 5:12173272-12173294 ACTTGGGAGCAGAAAGCAGCAGG - Intergenic
987304602 5:16625530-16625552 AGATGTCAGCAGATTGCAGAAGG - Intergenic
987801255 5:22699682-22699704 ACATGTAAATATAAGGCAGAAGG + Intronic
988123918 5:27004152-27004174 ACATTTGAGCAGAAAGCTGAAGG + Intronic
988959333 5:36353923-36353945 AAAAGAGAGCAGAGGGCAGAAGG + Intergenic
988991830 5:36679218-36679240 GCAAGGGAGCAGGAGGCAGAGGG + Intronic
989195385 5:38711651-38711673 ACTTGGGAGCAGGAGGCAGGAGG - Intergenic
989783997 5:45305112-45305134 AGAGGTGAAAAGAAGGCAGAAGG + Intronic
990191318 5:53263301-53263323 ATGTGTGAGTAGAAAGCAGAGGG - Intergenic
990515196 5:56524719-56524741 AAATGTGAGAAGCAGGCAGCTGG - Intronic
990963909 5:61424150-61424172 ACATAGGAGCAGAAGTTAGAAGG + Intronic
990991239 5:61686067-61686089 AGAGGTGAGAAGAAGGAAGAGGG - Intronic
991048237 5:62245262-62245284 ACTGATGGGCAGAAGGCAGAAGG - Intergenic
991202556 5:64010970-64010992 AACTGAGAGAAGAAGGCAGAAGG - Intergenic
993396467 5:87395784-87395806 ACTTGAGCCCAGAAGGCAGAGGG + Intronic
993533124 5:89047985-89048007 AAATGTGAGCAGTTGGCAGTTGG - Intergenic
993573969 5:89578553-89578575 ACAGGTGATCAGAAGAAAGATGG + Intergenic
994459587 5:100054922-100054944 AGATGCGAGCAGAAGGAAGGAGG + Intergenic
994919448 5:106024514-106024536 ACAGGAGAACCGAAGGCAGAAGG + Intergenic
996500002 5:124205975-124205997 ACAATTGAGCAGATGGGAGATGG - Intergenic
997093138 5:130879675-130879697 ACATTTGAGCAAAAGCCTGAAGG + Intergenic
998280919 5:140807013-140807035 ACATGAGAGAAGGAGGAAGAAGG + Intronic
999096123 5:148979449-148979471 ACAAGAGGGCAGAAGCCAGATGG - Intronic
999228225 5:150045282-150045304 AAATGTGACCAAAAGGCAGGTGG + Intronic
1000846999 5:166294047-166294069 ACATCTGGGCAGAAGGGAAAAGG + Intergenic
1000901522 5:166917049-166917071 ACATGTGAGCAGAGACCTGAAGG - Intergenic
1000996905 5:167968751-167968773 ACATGTAATGAGAAGGCACAGGG + Intronic
1001200235 5:169709279-169709301 AGTTGTGGGGAGAAGGCAGAGGG + Intronic
1001755860 5:174167848-174167870 ACAGGTGAGGAGGAGGAAGAGGG + Intronic
1002106506 5:176881856-176881878 ACATGTGTGCACTCGGCAGAAGG + Intronic
1003781200 6:9429148-9429170 ACATGGCAGCAGGAGACAGAAGG + Intergenic
1003935333 6:10970165-10970187 ACATTTGAGCTGAAGTCTGAAGG + Intronic
1005039641 6:21589190-21589212 ACAAGTGAGCAGGAGGCGGCGGG + Intergenic
1006175667 6:32119963-32119985 GCAAGTGAGCAGAGGTCAGAGGG + Intronic
1006507040 6:34496034-34496056 ACAGGGGAGCAGCAGGCAGCTGG - Intronic
1006832947 6:36979812-36979834 ACAGGTGGGCAGATGGAAGAGGG - Intronic
1007251332 6:40497168-40497190 ACGTGGAAGCAGAAGGCAAACGG - Intronic
1007446101 6:41907353-41907375 AGATGGGAGCAGGAGGCAGGAGG - Intronic
1008160034 6:48065941-48065963 ACATCTTAGTAGAAGTCAGAGGG - Intronic
1008389151 6:50929365-50929387 ACATTTGAGCAGAGGCCAGAAGG + Intergenic
1008997146 6:57672485-57672507 GCCTTTGAGCAGAATGCAGAAGG - Intergenic
1010049134 6:71482781-71482803 AAATGTGAGCAGAGGTGAGATGG - Intergenic
1010455806 6:76053007-76053029 ACATGTGAGGAGATGGCAGCAGG - Intronic
1011079012 6:83469079-83469101 AAATGTGAGAAAATGGCAGATGG + Intergenic
1011344834 6:86357992-86358014 TCCTGTGAGCTGAAGACAGAGGG + Intergenic
1011656571 6:89557280-89557302 GCATGTGAGCAGAAGGGAGGGGG + Intronic
1011780816 6:90787377-90787399 AAATGTGTGCAGAGGGTAGAAGG + Intergenic
1012817182 6:104039096-104039118 AAACGGGAGCAGAAGGCAGAAGG + Intergenic
1012889491 6:104882478-104882500 ATATTTGAGCAGAAGCCTGAGGG - Intergenic
1013348414 6:109284427-109284449 ACATGGGAGCCCAAGGCAGGAGG - Intergenic
1013384755 6:109615274-109615296 ACATTTTAATAGAAGGCAGAAGG - Intronic
1015952730 6:138570164-138570186 ACATGTGAGCATGAGGCTGTAGG - Intronic
1016105826 6:140160830-140160852 AGATTTGAGCAAAATGCAGATGG - Intergenic
1016291087 6:142528892-142528914 AAATGTGAGCTGAAGGGGGATGG - Intergenic
1016369599 6:143358740-143358762 TCATATGACAAGAAGGCAGAGGG + Intergenic
1016989450 6:149919276-149919298 TCTTGTGAGCAGAAAGCCGAAGG - Exonic
1016993686 6:149946398-149946420 TCTTGTGAGCAGAAAGCTGAAGG + Exonic
1017004648 6:150021138-150021160 TCTTGTGAGCAGAAAGCTGAAGG - Exonic
1017005752 6:150027216-150027238 ACCTGTGGGCAGAAGGCAGAGGG + Intergenic
1017012121 6:150069984-150070006 ATCTGTGGGCAGAAGCCAGAGGG + Intergenic
1017722706 6:157255160-157255182 GAATGTGAGCAGAAGGCATGTGG + Intergenic
1018651261 6:165992986-165993008 ACATGGCAGAAGGAGGCAGAAGG - Intergenic
1018888348 6:167961496-167961518 AGATGTGAGCAGAAGGATAAAGG + Intronic
1019173597 6:170148451-170148473 ACGTGTTGGTAGAAGGCAGAAGG - Intergenic
1019691496 7:2416842-2416864 ACATGTGAAAAGAAGGGAGTGGG + Intronic
1020836551 7:13159762-13159784 AAATGTGAGGAGAAGGGTGATGG + Intergenic
1020846911 7:13297251-13297273 AAATGACAGCAGCAGGCAGAAGG - Intergenic
1021751564 7:23806042-23806064 ATATGTGATGTGAAGGCAGAAGG - Intronic
1021762929 7:23918962-23918984 ACATGTGAAAAGAAGCCAGCAGG - Intergenic
1022852281 7:34276373-34276395 ACATGTGAGCAGAAGTAATGTGG - Intergenic
1023266342 7:38410200-38410222 TCAGGTTGGCAGAAGGCAGAGGG + Intronic
1023551578 7:41375670-41375692 AAAATTGAGCAGAAGGCACAGGG + Intergenic
1023958462 7:44906902-44906924 ACATGTTAGTAGAAAGTAGAAGG - Intergenic
1028016165 7:85716136-85716158 AAATATGAGCAGAGGGCAAATGG - Intergenic
1028623257 7:92847502-92847524 TGTTGTGTGCAGAAGGCAGAGGG - Intergenic
1028636957 7:92999912-92999934 ACCTTTGAGCAGAGAGCAGAAGG + Intergenic
1029877350 7:103768303-103768325 ACACGACAGCAGAATGCAGATGG + Intronic
1030116931 7:106069111-106069133 ACATTTGGGCAGAAGCCTGAAGG + Intergenic
1030360034 7:108586106-108586128 ACATAGGAGAAGAAGGGAGACGG - Intergenic
1030953069 7:115816881-115816903 ACATTTGAGCAGAAGGGAATAGG - Intergenic
1031129062 7:117810156-117810178 ACATGTGAGCAGGAGGCTTGAGG + Intronic
1031173918 7:118325066-118325088 CCATGCCAGCAGAGGGCAGAGGG + Intergenic
1031255207 7:119438082-119438104 GCATGTGGTCACAAGGCAGATGG + Intergenic
1031705343 7:124974428-124974450 ACATATGAGCAGAATCCATAAGG + Intergenic
1031799255 7:126222522-126222544 ACATGGCAGCAGGAGGCAGGAGG + Intergenic
1032128397 7:129210944-129210966 ACCTGAGAGCAGAAGGGATAGGG - Exonic
1032275640 7:130452964-130452986 ATATGTGAGCAGAAGGGGGGTGG + Intergenic
1032508306 7:132452400-132452422 ACATGTTAGCAGAGCTCAGAAGG + Intronic
1032689138 7:134265354-134265376 AGAGGTGAAAAGAAGGCAGATGG + Intergenic
1032975890 7:137221798-137221820 ACATGGAAGCAGAATGTAGATGG + Intergenic
1033917995 7:146351203-146351225 TCATGTGAACAGAAGACTGAGGG + Intronic
1034503706 7:151468558-151468580 ACATTTGAGGAGAAGGGACAAGG - Intronic
1034670027 7:152850784-152850806 ACAGGTAAGCAGAAGTCACAGGG - Intronic
1034674736 7:152884315-152884337 CCAGGGGAGCAGGAGGCAGAAGG + Intergenic
1035796263 8:2360004-2360026 AAATGTGGGCAGCAGGAAGAGGG + Intergenic
1037377011 8:18241769-18241791 ACTTGGGAGGACAAGGCAGAAGG - Intergenic
1037380538 8:18280778-18280800 AGTTGTGAGCAGAACTCAGATGG + Intergenic
1037817256 8:22118788-22118810 ACAGGTGCAGAGAAGGCAGAGGG - Intronic
1038022322 8:23561004-23561026 ACATGTGAAAAGAAGGGAGTTGG + Intronic
1038073300 8:24042429-24042451 ACATATTTCCAGAAGGCAGAAGG - Intergenic
1038484384 8:27923276-27923298 GCACGTGAGCAGAAGGGAAAGGG - Intronic
1039447466 8:37644073-37644095 AAGGGTGAGCAGAAGGCAGGTGG + Intergenic
1039980583 8:42406723-42406745 ACATGTGACAAAAAGGAAGAGGG + Intergenic
1041452672 8:58023641-58023663 ACATGTGAGCAGCAGCTAGATGG - Intronic
1041464114 8:58142058-58142080 ACCTGTGAGGAGCTGGCAGATGG + Intronic
1041599536 8:59700135-59700157 ACTTGGGAGCCGGAGGCAGAAGG - Intergenic
1042357600 8:67846243-67846265 ACATTTGAACAGAAAGCTGATGG - Intergenic
1042640861 8:70932690-70932712 ACATGTGAGGACACAGCAGAAGG - Intergenic
1042818955 8:72909374-72909396 GCATGTGAGAGGAAGGGAGAGGG + Intronic
1043553667 8:81404448-81404470 ACATTTAAGCAGAAACCAGAGGG + Intergenic
1044467108 8:92520355-92520377 AAAGCTGAACAGAAGGCAGAAGG + Intergenic
1045455469 8:102374672-102374694 CTATGTGTGCAGAAGGCAGTAGG - Intronic
1046804091 8:118461099-118461121 AACTGTGAGAACAAGGCAGAGGG - Intronic
1047942933 8:129843643-129843665 ACTTGTGAGCCCAAGGCAGGAGG - Intronic
1048228532 8:132614227-132614249 ACATCTGAGCAGAGGCCTGAAGG + Intronic
1048233975 8:132673025-132673047 AGATGTTAGCAAGAGGCAGAAGG + Intronic
1048459209 8:134606016-134606038 ACATTTGAGCAGAAAGCTGAAGG + Intronic
1048779866 8:137988995-137989017 ACAAGTGAGCCAAAAGCAGATGG - Intergenic
1049363546 8:142225555-142225577 CCCTGTGGTCAGAAGGCAGAGGG - Intronic
1050069442 9:1795090-1795112 ACATGGGAGGAAAAGCCAGATGG - Intergenic
1050372938 9:4940867-4940889 CCAGCGGAGCAGAAGGCAGATGG + Intergenic
1051975712 9:22945945-22945967 ACAAGGGAGCAGAATGAAGAAGG - Intergenic
1052523346 9:29579864-29579886 ACATGGCAGCAGAAGAGAGAGGG + Intergenic
1052724042 9:32207690-32207712 ACATGGCAGCAGGAGGGAGAGGG - Intergenic
1055277107 9:74630468-74630490 GAATGTCAGCAGCAGGCAGAAGG - Intronic
1055438646 9:76317719-76317741 ACATGTTAGCAGAAGAAAGGTGG + Intronic
1055731845 9:79286685-79286707 ACCTTGGACCAGAAGGCAGAGGG + Intergenic
1056266773 9:84905036-84905058 AGATGAGAGAAGAAGGCACACGG + Intronic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1056446852 9:86674686-86674708 ACACTTGAGCAGGAGGCAGAAGG + Intergenic
1056722694 9:89085319-89085341 AAAAGTGAACAGAAGGCTGAGGG - Intronic
1057221752 9:93261253-93261275 AAATGGGGGCAGAAGACAGAGGG + Intronic
1057336690 9:94161181-94161203 ACTTGGGCGCAGGAGGCAGAGGG - Intergenic
1058233080 9:102454933-102454955 ACAGGTAAGTAGAAGGCTGAAGG + Intergenic
1058539792 9:105999764-105999786 ACAGGTCAGCAGAGGGCTGAAGG + Intergenic
1058568884 9:106319259-106319281 ACATGTGGACAGAAGCCAAATGG - Intergenic
1058832049 9:108826620-108826642 ACAAGTGAGGGGAAGGGAGAAGG - Intergenic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1060199716 9:121645404-121645426 TCCTGTGGGCAGAAGGCAGCAGG + Intronic
1060254516 9:122015434-122015456 AGCTGTCAGAAGAAGGCAGATGG - Intronic
1060320266 9:122552593-122552615 ATATGTGAGCTGAGGGCAGTAGG - Intergenic
1060756023 9:126214359-126214381 ACATGAGATCAGAAGGCGGGAGG - Intergenic
1061246911 9:129405312-129405334 TCATGTGGGCTGAGGGCAGAGGG - Intergenic
1062169477 9:135127043-135127065 ACATGGGAGCAGAAGTCTGCCGG - Intergenic
1062177135 9:135169556-135169578 ACATCTGAGCTGAGTGCAGAAGG + Intergenic
1062726451 9:138076655-138076677 ACTTGGGAGCAGAAGGGAGGTGG + Intronic
1185559376 X:1047524-1047546 TTATGTGAGCAGAAGGAAGATGG - Intergenic
1186003210 X:5038166-5038188 ACATGAGAGCATGGGGCAGAGGG + Intergenic
1186931689 X:14398299-14398321 ACATTTAAGCAGAAATCAGAAGG - Intergenic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187328197 X:18311508-18311530 ACATGTGAGCAGAAATCTGAAGG + Intronic
1188596417 X:31906816-31906838 AGATGTGAGCATAAAGTAGAAGG - Intronic
1188873283 X:35399690-35399712 ACATGTGAGGAGAACCCAGTGGG - Intergenic
1189437481 X:41005890-41005912 TAAAGAGAGCAGAAGGCAGAAGG - Intergenic
1192059086 X:67804700-67804722 ACAAGTAAGCAGAAGCCAGGAGG + Intergenic
1192474413 X:71427551-71427573 AAAAGTAAGCAGAGGGCAGATGG + Intronic
1192955508 X:76065808-76065830 ACATGTTAGTATAAGACAGAGGG + Intergenic
1194418934 X:93648927-93648949 ACATGTGGGTAACAGGCAGAGGG + Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1196740340 X:119019577-119019599 GCATGTAAGCAGAAACCAGATGG + Intergenic
1196821376 X:119703797-119703819 ACTTGGGAGCCCAAGGCAGAAGG - Intergenic
1198019179 X:132641832-132641854 ACATTTGAGTAGGAGGCAGTTGG + Intronic
1200858664 Y:7966473-7966495 ACCTGTGAGCAGAAGCAAGGGGG + Intergenic
1201709554 Y:16975365-16975387 TCATGGGAGCAGTAGGCAGAAGG + Intergenic
1202260542 Y:22965852-22965874 ACCTGTGAGCAGAAGCAAGGTGG - Intergenic
1202413529 Y:24599593-24599615 ACCTGTGAGCAGAAGCAAGGTGG - Intergenic
1202457256 Y:25070493-25070515 ACCTGTGAGCAGAAGCAAGGTGG + Intergenic