ID: 1096627374

View in Genome Browser
Species Human (GRCh38)
Location 12:52903969-52903991
Sequence CCCGCCCACGCTGCCGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 281}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096627363_1096627374 -3 Left 1096627363 12:52903949-52903971 CCCCTCACCCCGCCCTCGGCCCC 0: 1
1: 0
2: 13
3: 115
4: 1315
Right 1096627374 12:52903969-52903991 CCCGCCCACGCTGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 20
4: 281
1096627365_1096627374 -5 Left 1096627365 12:52903951-52903973 CCTCACCCCGCCCTCGGCCCCGC 0: 1
1: 3
2: 27
3: 245
4: 1731
Right 1096627374 12:52903969-52903991 CCCGCCCACGCTGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 20
4: 281
1096627360_1096627374 4 Left 1096627360 12:52903942-52903964 CCCGCAGCCCCTCACCCCGCCCT 0: 1
1: 0
2: 3
3: 114
4: 1012
Right 1096627374 12:52903969-52903991 CCCGCCCACGCTGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 20
4: 281
1096627359_1096627374 16 Left 1096627359 12:52903930-52903952 CCGAGACTGCTGCCCGCAGCCCC 0: 1
1: 0
2: 3
3: 35
4: 421
Right 1096627374 12:52903969-52903991 CCCGCCCACGCTGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 20
4: 281
1096627361_1096627374 3 Left 1096627361 12:52903943-52903965 CCGCAGCCCCTCACCCCGCCCTC 0: 1
1: 1
2: 12
3: 175
4: 1803
Right 1096627374 12:52903969-52903991 CCCGCCCACGCTGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 20
4: 281
1096627364_1096627374 -4 Left 1096627364 12:52903950-52903972 CCCTCACCCCGCCCTCGGCCCCG 0: 1
1: 0
2: 10
3: 70
4: 767
Right 1096627374 12:52903969-52903991 CCCGCCCACGCTGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 20
4: 281
1096627366_1096627374 -10 Left 1096627366 12:52903956-52903978 CCCCGCCCTCGGCCCCGCCCACG 0: 2
1: 2
2: 25
3: 259
4: 1202
Right 1096627374 12:52903969-52903991 CCCGCCCACGCTGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 20
4: 281
1096627358_1096627374 17 Left 1096627358 12:52903929-52903951 CCCGAGACTGCTGCCCGCAGCCC 0: 1
1: 0
2: 0
3: 37
4: 344
Right 1096627374 12:52903969-52903991 CCCGCCCACGCTGCCGGCGCAGG 0: 1
1: 0
2: 1
3: 20
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096627374 Original CRISPR CCCGCCCACGCTGCCGGCGC AGG Intronic
900349813 1:2228934-2228956 CGCGGCCGCGGTGCCGGCGCCGG + Exonic
901137855 1:7009327-7009349 CCCACCCACGATGCCGCCTCTGG - Intronic
902323643 1:15684489-15684511 CCCGCCGCCGCTTCCCGCGCCGG - Exonic
904500128 1:30908534-30908556 GCCGCCCACGGGGCCGGCGCCGG - Exonic
905580799 1:39081724-39081746 GCAGCCCCCGCGGCCGGCGCCGG + Intronic
905643747 1:39610086-39610108 CCTGCCCCCGCGGCCGGCTCCGG - Intergenic
907249371 1:53127948-53127970 CCCGCCCAGACTGCTGGCCCAGG + Intronic
908131846 1:61082378-61082400 CCCGCTCGCGCCGCCGCCGCGGG - Intronic
912538769 1:110396596-110396618 CCCGCCAGCCCTGCCGGCCCCGG - Intergenic
914428599 1:147600194-147600216 GCCGCCGCCGCTGCCGCCGCCGG + Intronic
916783015 1:168056464-168056486 CCCGCCCCGCCTCCCGGCGCGGG - Intronic
918302769 1:183219060-183219082 TCCCCCCAAGCTGCCGGTGCAGG + Intronic
918388731 1:184036934-184036956 CACCCCCTCGCTGCCCGCGCCGG - Intronic
918512019 1:185321936-185321958 CCCGCCATCCCTGCCGGCCCTGG - Intergenic
919386861 1:196933810-196933832 CCGGCCCGCGCAGCCGGCCCAGG + Intronic
919486855 1:198157105-198157127 CCGGCGGACGCTGCAGGCGCGGG - Exonic
919727717 1:200894892-200894914 CCCTCCCAGGCTGCCGGGCCAGG - Exonic
922730843 1:227948093-227948115 CCGGCCGCCGCTCCCGGCGCGGG + Intergenic
923678817 1:236102672-236102694 CCACCCCAGGCTGCCGGGGCAGG - Intergenic
924613451 1:245592259-245592281 GCCGCCCAGGGTGCAGGCGCAGG + Intronic
1063393618 10:5666387-5666409 CCCGCCCACGGAGCCAGCGCGGG + Intronic
1064167865 10:13001790-13001812 CCCGCCCACGCCCCAGCCGCAGG - Intronic
1064209078 10:13348112-13348134 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1064478870 10:15719934-15719956 CCCGCCCGCCCAGCCGGCTCGGG + Exonic
1065024202 10:21526065-21526087 CCCGCCCCCGCCGCCAGCCCCGG + Intergenic
1065712734 10:28533158-28533180 CCCGCCGCCGCCGCCGCCGCTGG - Intronic
1066100038 10:32109764-32109786 CCGCCCCAAGCTGCCGGCGGAGG - Intergenic
1067342779 10:45418536-45418558 CCTGCCCACCCTGCAAGCGCAGG - Intronic
1067369779 10:45672598-45672620 CCCAGCCGCGCTGCCGCCGCCGG - Intronic
1069775726 10:70926067-70926089 CCCGTCCACACTGCCCGCGTGGG + Intergenic
1071328792 10:84541068-84541090 CGCGCCCACGCTTCTGGCCCTGG - Intergenic
1072331971 10:94362975-94362997 CCCGCCCTCACTTCCGGCGGCGG - Intergenic
1073241959 10:102065191-102065213 CCCGGGCACGCTCTCGGCGCAGG - Intergenic
1074056066 10:109923610-109923632 CCCGCCCACACTCCCGGACCTGG + Intergenic
1076790696 10:132775287-132775309 CGCTCCCACGCTGTAGGCGCAGG + Intronic
1076890904 10:133282875-133282897 CCTGCCCACGCTGCCAGGGCAGG + Intronic
1078101668 11:8333849-8333871 CCTGCCCACCCTGGCGGGGCAGG - Intergenic
1078256583 11:9664027-9664049 CCCCGCCCTGCTGCCGGCGCCGG - Intergenic
1078474911 11:11621953-11621975 ACCGCCAAGGCAGCCGGCGCTGG - Exonic
1081422057 11:42881481-42881503 CCAGCCGGCGCTGCCGGCCCGGG + Intergenic
1083879045 11:65539323-65539345 CTCACCCACGCAGCGGGCGCGGG + Exonic
1083899790 11:65638105-65638127 CCCGCTACCGCTCCCGGCGCCGG - Intronic
1083940157 11:65891331-65891353 ACTGCCCACGCTGCCAGTGCTGG - Exonic
1084165299 11:67372612-67372634 CCCGCCCCCGCCCCCGCCGCGGG - Intronic
1084192197 11:67504360-67504382 GCCGCCCGCGCCGCCGGGGCCGG + Intronic
1084743655 11:71154858-71154880 CCCGCCCACGCTCCCAGAGGAGG + Intronic
1084743680 11:71154925-71154947 CCCGCCCACGCTCCCAGAGGAGG + Intronic
1084743728 11:71155062-71155084 CCAGCCCACGCTCCCGGAGGAGG + Intronic
1084743742 11:71155097-71155119 CCAGCCCACGCTCCCGGAGGAGG + Intronic
1084743756 11:71155132-71155154 CCAGCCCACGCTCCCGGAGGAGG + Intronic
1084743792 11:71155231-71155253 CCAGCCCACGCTCCCGGAGGAGG + Intronic
1084743861 11:71155429-71155451 CCCGCCCACGCTCCCAGAGGAGG + Intronic
1087855919 11:103091879-103091901 CCTGCCCACCCTGCCGGGGAGGG - Exonic
1089384787 11:118060488-118060510 CCTGCCCTCGCTGCCGGCCTGGG - Intergenic
1089452909 11:118609772-118609794 CCTGCCCAGGCTGCCCGCGTGGG - Intronic
1091227690 11:133967415-133967437 CCCGCCCGGGCTACAGGCGCTGG + Intergenic
1094218544 12:27970464-27970486 CCCTCCCGCGCTGCCGACCCCGG + Intronic
1095096698 12:38152990-38153012 CCCGCCCACTGTCCTGGCGCAGG - Intergenic
1096627374 12:52903969-52903991 CCCGCCCACGCTGCCGGCGCAGG + Intronic
1096788218 12:54029892-54029914 TCCGCCCAGGCTGTCGGCGGTGG - Exonic
1097848657 12:64390568-64390590 CTCCGCCACGCTGCGGGCGCCGG - Exonic
1098369136 12:69738842-69738864 CCCGGCCCCGCTTCCGGCGCAGG + Intronic
1102233112 12:111277221-111277243 CCCGCCCTCCCAGCCTGCGCAGG + Intronic
1102884015 12:116508339-116508361 CCCTCCCAGGCTGCCCGGGCGGG + Intergenic
1103828731 12:123762219-123762241 CCCGCCGACGGCGCCGGCGCTGG - Intergenic
1104977740 12:132559861-132559883 CCCGCGCCCGCCGCCGGCCCGGG - Intronic
1105745706 13:23375441-23375463 CCCGCCCTCCCGGCCCGCGCGGG - Intronic
1106683383 13:32031331-32031353 CCGGCCCACACGGCCGCCGCGGG - Exonic
1108247488 13:48532688-48532710 CCTGCCCAGGCCGCCGGCCCAGG - Intronic
1110705977 13:78602267-78602289 CGCGCCCGCGCCGCCCGCGCCGG + Exonic
1112271902 13:97976480-97976502 CCCGCCGCGGCCGCCGGCGCCGG - Intronic
1113874281 13:113584859-113584881 CCCGCCCGCGCGGCCGGACCGGG + Exonic
1113944084 13:114033889-114033911 CCCGCCCACAGTGCTGGCGTGGG - Intronic
1114629030 14:24147568-24147590 CCGGCCCACGCAGCCGCCCCAGG - Exonic
1115592142 14:34874705-34874727 CCGGCCCACGCTGCCGCCGAGGG - Intronic
1116820381 14:49621241-49621263 CCCGCCTGCGCTCCCGGCCCTGG + Exonic
1117082579 14:52166844-52166866 CCAGCCAGCGCTGCCGGCCCTGG + Intergenic
1117699163 14:58396121-58396143 CCCGCCCGCGCTGCCCGGCCCGG - Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1121137160 14:91509754-91509776 CCCGGCCTCACTGCCGCCGCTGG + Exonic
1121667873 14:95686350-95686372 CCCGCCCCCACTGCCGGCCCGGG + Intergenic
1122486630 14:102086682-102086704 CCCGGCCCCGCTGGGGGCGCAGG - Intronic
1123050332 14:105538263-105538285 CAGGCCCTCGCTGCCGGGGCAGG - Intergenic
1124500728 15:30225039-30225061 CCCGCCGCCGCCGCCGCCGCAGG + Intergenic
1124742841 15:32313628-32313650 CCCGCCGCCGCCGCCGCCGCAGG - Intergenic
1125732502 15:41901031-41901053 CACGCCCACGCAGCTGGTGCAGG - Exonic
1129829971 15:78662179-78662201 CCTGCCCACCCTGCTGGCTCTGG - Intronic
1129948219 15:79560539-79560561 CCCGCCCGCGCGGCCGGACCGGG - Intergenic
1130656419 15:85794696-85794718 CGCGCCCCCGCTCCCTGCGCTGG - Intronic
1132743771 16:1428463-1428485 CCAGCCCAGGCTTCGGGCGCAGG - Intergenic
1132889481 16:2196743-2196765 CCCGGGCGCGCGGCCGGCGCGGG - Intergenic
1132900474 16:2251429-2251451 CTCCCCCACGCTGCCTTCGCAGG - Exonic
1132955962 16:2593692-2593714 GCCTCCCACGCTGCCTGCCCCGG + Intronic
1135821972 16:25692705-25692727 GCCGCCCGCGCCGCCGCCGCTGG + Exonic
1136278218 16:29191973-29191995 CCTGACCACGTTGCCGGCCCAGG - Intergenic
1136365400 16:29806992-29807014 CCCGCCCACGCCCCAGGCCCCGG + Exonic
1136566467 16:31073528-31073550 CCCGCCCGCGCTGCTCGCGCTGG + Intronic
1138521691 16:57574917-57574939 CCCGCTCCCGCAGCCTGCGCAGG - Exonic
1139433924 16:66925572-66925594 CCCGCCCCCGCTCCCGCCCCCGG + Exonic
1139705576 16:68738198-68738220 CCCTCCCTCGCTCCCGGCGTCGG - Intronic
1141086057 16:81096320-81096342 CCCGCCCCGCCTCCCGGCGCGGG - Exonic
1141513512 16:84527588-84527610 CCTGCCCACCCTGCCCGCCCCGG - Intronic
1141704553 16:85657554-85657576 CCGGCCCCCGGTGCCGGCGGAGG + Exonic
1141830142 16:86505793-86505815 CCCGCCCGCGCGGCCGGCCTGGG + Intergenic
1141839725 16:86567030-86567052 CCTGCCCGCGCTGCCGCCGCCGG + Intergenic
1142082595 16:88158007-88158029 CCTGACCACGTTGCCGGCCCAGG - Intergenic
1142107863 16:88315900-88315922 CCCGCCCAGGCTGCCTGCTCCGG + Intergenic
1142184047 16:88686111-88686133 CCCGCCCGCCCTGCCGGAGGCGG + Intronic
1142421445 16:89972836-89972858 CGCTCCCCCGCGGCCGGCGCAGG - Intergenic
1142586861 17:979455-979477 CCGGCCCCCGCTCCCGGCCCCGG + Exonic
1143117879 17:4590878-4590900 GCCGCCCAAGCTGCTGGCCCTGG - Intronic
1143503635 17:7352362-7352384 CCTGGCCTGGCTGCCGGCGCGGG - Exonic
1143628071 17:8122267-8122289 CCCGCCCACTCTGCCCCGGCCGG + Intronic
1144849254 17:18235772-18235794 CCCGCCCAGCCTGCCTGCCCTGG + Intronic
1145925652 17:28644947-28644969 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1146492320 17:33292015-33292037 GCCGCCAACGCCGCGGGCGCCGG + Exonic
1147155235 17:38541438-38541460 CCCGACCACGCTGCCCCAGCCGG - Intronic
1147617045 17:41835909-41835931 CCCGCCCAGGCTGCCGCATCAGG + Exonic
1148268352 17:46244069-46244091 ACAGCCCACGCTGCTGGAGCTGG + Intergenic
1148684739 17:49495187-49495209 CCCGCCCGCCCTGCCGCCTCGGG - Intergenic
1150108609 17:62479136-62479158 CCCGCCCGGGCAGCCGCCGCCGG - Exonic
1151828712 17:76537623-76537645 GCCGCGCACGCAGCCGGCCCCGG - Exonic
1152616817 17:81341695-81341717 CCCGCTCTAGCTGCCGACGCCGG + Intergenic
1152711208 17:81871217-81871239 CCCGCCCCCGCCGGCGCCGCCGG + Intronic
1152711341 17:81871657-81871679 ACAGCCCACGCGGCCGCCGCAGG - Intergenic
1152924489 17:83080867-83080889 CCCGCCCCCGCCCCCGCCGCGGG + Intronic
1152932868 17:83119197-83119219 CCCGCCCACGTTCCCGCCGGTGG - Intergenic
1154358775 18:13642218-13642240 CCGTCCCTCGCTGCTGGCGCCGG + Intronic
1156488945 18:37485283-37485305 CCGCCCCAGGCTGCCCGCGCAGG + Intronic
1157383816 18:47246660-47246682 CCCGCCCCCGCCGCCGCCCCTGG - Intronic
1157529536 18:48409499-48409521 CGCGCCCGCGCCGCCGGCTCGGG + Intronic
1158553805 18:58459274-58459296 GGCGCCCACTCTGGCGGCGCTGG + Intergenic
1160134278 18:76259372-76259394 CCCGCCCAAGCTGCAGGCTGTGG - Intronic
1160242542 18:77133374-77133396 TCCGCGCACGCTTCCTGCGCCGG - Intronic
1160342909 18:78104610-78104632 CAGGCTCACGCTGCCGGCCCTGG - Intergenic
1160691431 19:462047-462069 CCCGGCCCCGCGGGCGGCGCCGG - Intergenic
1160811431 19:1014631-1014653 CCCTCCCACGCTGACTGCACCGG + Intronic
1160829193 19:1095068-1095090 CCCTTCCCCGCTGCCGGCTCAGG + Intronic
1160904843 19:1447173-1447195 CCCGGCCACCCAGCCGGCGGCGG + Intronic
1161072798 19:2270879-2270901 CCCGCCCCCGCTCCAGGCCCGGG - Intronic
1161077185 19:2291536-2291558 CCTGGCCGCGCTGCCCGCGCTGG - Exonic
1161364231 19:3868909-3868931 CCCGGCCAGGCTGCAGGGGCCGG + Intronic
1161802633 19:6424546-6424568 CCCGCCCGGGCCGCCGCCGCCGG + Exonic
1161849739 19:6732155-6732177 CCCACCCCCGCCGCCTGCGCAGG - Exonic
1162104797 19:8363953-8363975 CCCGCCCCCGCTCCAGGCTCAGG - Intronic
1162733846 19:12734770-12734792 CCCGCCCCCGCTGCGGGCGCTGG - Exonic
1162932376 19:13963432-13963454 CCCGCCCAGCCTGCAGGCTCGGG + Intronic
1163128640 19:15258237-15258259 CTCTCCCACGCTGCTGGAGCAGG + Intronic
1163145743 19:15378604-15378626 ACCGCGCACGCTGCCGCCTCAGG + Intronic
1163252165 19:16132401-16132423 CCCGCCCACGCCGCGGCCACCGG + Exonic
1165056008 19:33176730-33176752 CCCGGCCGCGCTGGCGGGGCCGG + Intergenic
1166283205 19:41808843-41808865 CCCGGTCACGATGCCGGCGACGG - Exonic
1166762650 19:45234583-45234605 CCGGCGCACGCTCCCGGCCCGGG + Intronic
1166983956 19:46648967-46648989 AGCGCCCACGCTGGCGGCCCAGG - Exonic
1167045899 19:47048478-47048500 CCCGGCCACGGTCCCCGCGCCGG - Exonic
1168350833 19:55674809-55674831 GACGCCCCTGCTGCCGGCGCCGG + Intergenic
1168602307 19:57727642-57727664 CCCGCCCACGCACCCCCCGCAGG + Intronic
1168707927 19:58480229-58480251 CCCTCCCAGGCTGCCGGCCCTGG - Exonic
926153027 2:10435084-10435106 CCCGACCGCGCTGCCACCGCGGG + Intergenic
927702516 2:25277105-25277127 CCCGCCCACGCGGCCCCCGCGGG - Intronic
927900418 2:26814568-26814590 CCGGCCGGCCCTGCCGGCGCCGG + Intergenic
931708677 2:64969102-64969124 CCGGCCAGCCCTGCCGGCGCCGG + Intergenic
932592480 2:73075640-73075662 CCCGCTCCCGCTGCAGGAGCAGG + Exonic
932812031 2:74833950-74833972 CCTCCCCAGGCTGCCGGCTCCGG + Intergenic
933778317 2:85785212-85785234 CCCGCCCAGGCAGCCAGCGCCGG + Intronic
934031862 2:88055596-88055618 GCCGCCCCCGCCGCCGGGGCGGG + Intronic
935593655 2:104863510-104863532 GCCGCCCACGCTGCTGACGGTGG + Intergenic
936088153 2:109483778-109483800 CCTCCCCAGGCTGCAGGCGCTGG + Intronic
936433260 2:112482222-112482244 CCGGCCCCCGCCGCCCGCGCCGG - Exonic
938126095 2:128672387-128672409 CCGGCCAACCCTGCCGGCCCTGG - Intergenic
938139475 2:128784169-128784191 CCCACCCACGGTGCCTGCGAGGG - Intergenic
941110312 2:161414367-161414389 CCTGCCCAGGCCGCCAGCGCAGG + Intergenic
941119112 2:161507856-161507878 CCCGCCGCCGCCGCCGCCGCGGG + Intronic
941997202 2:171611912-171611934 CCTGCCCACGCTGCCTGCCTGGG + Intergenic
946529982 2:220560376-220560398 CCTGCCCAGCCTGCCGCCGCTGG - Intergenic
947860504 2:233354487-233354509 CCCGCCCGCGGTGCGCGCGCTGG + Exonic
948307589 2:236960747-236960769 CCCGCCCATGCGGCTGGGGCGGG + Intergenic
948584987 2:239013632-239013654 CCAGGCCACGCTGCCTGCCCTGG + Intergenic
948750747 2:240131442-240131464 GCTGCCCTCGCTGCCGGGGCCGG + Intronic
1168965160 20:1894496-1894518 CCAGCCCTCGCGGGCGGCGCAGG + Exonic
1169065680 20:2693160-2693182 CCCGCCCGCGGCGCCAGCGCGGG - Intronic
1172587026 20:36092410-36092432 CCCGCGAACCCTCCCGGCGCTGG - Intronic
1172775893 20:37406693-37406715 CTCGCCCGCGCTGCCGCGGCGGG + Intergenic
1172876144 20:38165375-38165397 CGGGCCCACGCCGCCAGCGCTGG + Intronic
1175074455 20:56360996-56361018 CCCACCCACGCTGCCTTGGCAGG + Intronic
1175967084 20:62665202-62665224 CCCACCCCCGCTGCCAGAGCAGG + Intronic
1176380692 21:6111020-6111042 CCCGCCCCCGCCGCCCGGGCGGG - Intergenic
1176546839 21:8205894-8205916 ACCGACCACGCCGCCGGCCCAGG - Intergenic
1176554744 21:8250103-8250125 ACCGACCACGCCGCCGGCCCAGG - Intergenic
1176565790 21:8388941-8388963 ACCGACCACGCCGCCGGCCCAGG - Intergenic
1176573665 21:8433128-8433150 ACCGACCACGCCGCCGGCCCAGG - Intergenic
1176882620 21:14216077-14216099 CCAGCGCGCGCTCCCGGCGCCGG + Intergenic
1178610397 21:34074037-34074059 CCCGACCCCGATCCCGGCGCCGG + Intronic
1178701933 21:34841185-34841207 CCCGCCCACACTCCCTGTGCAGG + Intronic
1179742780 21:43427220-43427242 CCCGCCCCCGCCGCCCGGGCGGG + Intergenic
1180226115 21:46393511-46393533 CGCGCCCAGCCAGCCGGCGCTGG + Intronic
1180866433 22:19122459-19122481 CCCGCCCGCGACGCAGGCGCGGG + Intergenic
1180981282 22:19879288-19879310 ACCGCCCAGGCTGCAGGCTCCGG + Intronic
1182546819 22:31081426-31081448 CCAGCCCACCCGTCCGGCGCAGG - Exonic
1183349157 22:37325043-37325065 CCCACCCTCCCTGCCGCCGCCGG + Intergenic
1183428603 22:37752488-37752510 CCTGCCCACACTGCCTGGGCAGG + Intronic
1183667534 22:39254231-39254253 CCCGGCCAAGCTGCCTGGGCTGG - Intergenic
1185321136 22:50200709-50200731 TCGGTCCCCGCTGCCGGCGCCGG + Intergenic
1185368282 22:50446870-50446892 CCAGCACACGCTGACGGGGCCGG + Exonic
1203251714 22_KI270733v1_random:122179-122201 ACCGACCACGCCGCCGGCCCAGG - Intergenic
1203259764 22_KI270733v1_random:167261-167283 ACCGACCACGCCGCCGGCCCAGG - Intergenic
950831191 3:15877942-15877964 CGCGGCCACGCTGCTGCCGCGGG - Intergenic
951208321 3:19947260-19947282 GCCGCCGCCGCCGCCGGCGCTGG - Exonic
952329078 3:32347377-32347399 CCAGCACACGCTGACGGGGCTGG + Intronic
954649742 3:52153923-52153945 CCCGCTCACACTGCAGGCCCGGG + Intronic
954823010 3:53347671-53347693 CGCGCGCACGCTCCGGGCGCCGG + Intergenic
956414600 3:69013327-69013349 CCCGCCTGCGCTCCGGGCGCTGG + Intronic
957560180 3:81812270-81812292 CCGGCCCACCCTGCCGGCCCGGG - Intergenic
963939438 3:151085393-151085415 CCCTTCCACGCTCCCGGCGCAGG + Intergenic
964438096 3:156674886-156674908 GCCCCGCACACTGCCGGCGCGGG - Exonic
966595868 3:181724371-181724393 TTCGCTCCCGCTGCCGGCGCGGG + Intergenic
966711927 3:182980447-182980469 CCCGCCCGCCCTGCCGGCTGGGG - Intronic
967165066 3:186773040-186773062 ACCGCCCAGGCTGCCTGCTCTGG - Intergenic
968010435 3:195270845-195270867 CGCGCCCTCGCCGCCCGCGCTGG - Exonic
968481871 4:836876-836898 CAAGGCCACGCTGCCGGCGAGGG - Intergenic
968515074 4:1012338-1012360 CCCGCCCGCGCTCCAGGCGGAGG - Intronic
968654717 4:1773518-1773540 CCCACCCCCGCTGCCCGCACTGG + Intergenic
969439171 4:7207339-7207361 CCCGCCCACACAGCCTGGGCCGG + Intronic
971409908 4:26359549-26359571 GACGCCCCTGCTGCCGGCGCCGG + Intronic
971905208 4:32716487-32716509 CCGGCCAGCCCTGCCGGCGCCGG - Intergenic
976431236 4:84965994-84966016 GCCGCCCACCCTGGCGGCGGCGG + Intronic
982985750 4:162203686-162203708 CCGGCCGGCGCTGCCGGCCCTGG + Intergenic
985448113 4:190038589-190038611 CCCTCCCACCCTGCCCGCGCTGG + Intergenic
985544862 5:504495-504517 CCCTCCCTGGCTGCCGCCGCCGG - Intronic
987156803 5:15096817-15096839 CCGGCCGACCCTGCCGGCCCCGG - Intergenic
987532797 5:19143032-19143054 CCGGCCGACCCTGCCGGCCCCGG - Intergenic
992105739 5:73448067-73448089 CCTGCCCCCGCCGCCGGGGCCGG + Exonic
995650595 5:114363277-114363299 CCAGCCCACGCTACCGGAGTCGG + Intronic
996221326 5:120936703-120936725 GGCGTCCACGCTGCCTGCGCTGG + Intergenic
996530382 5:124521720-124521742 CCGGCCGCCGCTGCCGGCCCTGG + Intergenic
997453892 5:134004189-134004211 GCCGGCCACGCTGCCGCCTCGGG - Intronic
1002131859 5:177086890-177086912 CGCGGCCACGCCGCCGTCGCGGG + Exonic
1002927107 6:1611048-1611070 CCCGCCCGCGCCGCCGGAGCAGG + Exonic
1002927239 6:1611551-1611573 GCCGCCCGAGCTGCCCGCGCTGG - Exonic
1005935622 6:30518643-30518665 CCCGAGCACGTTGCCGCCGCTGG - Intergenic
1013106144 6:107028176-107028198 CCCGCCCCTTCCGCCGGCGCCGG - Intergenic
1013575723 6:111482654-111482676 CGCGCACACGCCACCGGCGCCGG - Intronic
1013836551 6:114342203-114342225 CCCGCCCGCGCCGCCACCGCCGG - Exonic
1014116786 6:117675584-117675606 TCCGCCCCTGCGGCCGGCGCGGG - Exonic
1015601312 6:134913716-134913738 CCCGCCCACCCTGCCCGCCAGGG + Intergenic
1016738970 6:147508626-147508648 GCCGCCGACGCTGCCGCCGCGGG - Intergenic
1019504688 7:1385120-1385142 TCCACCCACCCTGCCGGTGCAGG - Intergenic
1019577707 7:1745511-1745533 CCTGCCCACGCTGGCCACGCAGG + Exonic
1020281806 7:6653631-6653653 TCCGCCAGCGCGGCCGGCGCGGG - Exonic
1022285966 7:28956539-28956561 CCCTCCGTCGCTGCCGCCGCGGG - Exonic
1024700651 7:51901156-51901178 CCGGCCCGCCCTGCCGGCCCCGG - Intergenic
1026665511 7:72337057-72337079 CCCGCTCCCGCTGGCCGCGCGGG + Intronic
1027177672 7:75915084-75915106 CCCACCCCCGCGGCCGGCGAAGG + Exonic
1027232584 7:76281488-76281510 CGCACCCACGCCGCCCGCGCGGG + Exonic
1031056544 7:116998259-116998281 CCAGCCGGCGCTGCCGGCCCAGG - Intronic
1031088344 7:117324384-117324406 ACCGCGCTCGCTGCCGGCGAGGG - Intergenic
1031743903 7:125468898-125468920 CCCGCCCCAGATGCCGGCCCAGG - Intergenic
1032020702 7:128405956-128405978 CGCGGCCACGCTGCTGCCGCGGG + Intronic
1032151778 7:129435041-129435063 CCCTCCCAGGCTGCCTGCGGCGG + Intronic
1032437107 7:131909426-131909448 CCGGCCGGCGCTGCCGGCCCCGG + Intergenic
1034434718 7:151057936-151057958 CCCGCCCCGTCTGCCCGCGCAGG + Exonic
1035463914 7:159063401-159063423 CCGGCCGGCGCTGCCGGCCCCGG - Intronic
1036664631 8:10730593-10730615 CCCTCCCTCGGTGTCGGCGCGGG + Intronic
1039875065 8:41578210-41578232 CCCGCCCTTGCCGCCGCCGCGGG - Exonic
1039996862 8:42541692-42541714 GCCACTCACGCTGCCGGCTCCGG - Intronic
1041489010 8:58411241-58411263 CGCGCCCCCGCTTCCGGTGCTGG - Intergenic
1043129953 8:76447875-76447897 CCCGCCGGCCCTGCCGGCCCCGG - Intergenic
1044788668 8:95823737-95823759 CCGGCCGACCCTGCCGGCCCCGG + Intergenic
1045516294 8:102863626-102863648 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1045847876 8:106658302-106658324 CCCGGCCACGTTGCCCGCCCCGG - Intronic
1048812969 8:138304951-138304973 GCCGGCCACCCTGCCGGCCCTGG + Intronic
1049109580 8:140635069-140635091 CCCGGCCTCGCTGCCCGGGCGGG - Intronic
1049406218 8:142452843-142452865 CAGGCCCAGGCGGCCGGCGCGGG + Intronic
1055091117 9:72365283-72365305 CCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1056643404 9:88388987-88389009 CCCGCCCCCGTCGCCGGCCCGGG - Intronic
1056773941 9:89498043-89498065 CCAGCCGCCGCTGCCGCCGCCGG - Intronic
1057351292 9:94300848-94300870 CCCGCCCACACTGGGGGCACAGG - Exonic
1058799354 9:108530244-108530266 CCGGCCAGCGCTGCCGGCCCGGG + Intergenic
1058851185 9:109013402-109013424 CCCGCCGGCGTTGGCGGCGCCGG - Exonic
1058885849 9:109320725-109320747 CCCGCGCAGGCCGCCGGCCCGGG - Exonic
1061170103 9:128947636-128947658 CCCGCCCACGCTCCGGGTCCGGG + Intronic
1061293507 9:129665537-129665559 CCCACCCCGGCTGCTGGCGCTGG - Intergenic
1061522192 9:131125396-131125418 CCCGCCTTCGCAGCCAGCGCGGG - Intergenic
1061726957 9:132587281-132587303 CCCGGCCTCGCAGCCGCCGCCGG - Intronic
1062363029 9:136196533-136196555 CCTGCCCTCCCTGCCGGAGCCGG - Exonic
1062433628 9:136536489-136536511 CCCGCCCAGTCTGCCTGCTCCGG - Intronic
1062475139 9:136722976-136722998 CCTGCCTTCCCTGCCGGCGCTGG + Exonic
1062533776 9:137012819-137012841 CCCGCCCACACTGCTGGGGCAGG + Exonic
1062574613 9:137200372-137200394 CCCGCCCGCGCCGCCCGCCCCGG - Exonic
1062600296 9:137316229-137316251 CCCGCCCCCGCGGCCGGCCTTGG + Intronic
1203787221 EBV:134722-134744 CTCGCCCATGCTTGCGGCGCGGG + Intergenic
1203468116 Un_GL000220v1:105330-105352 ACCGACCACGCCGCCGGCCCAGG - Intergenic
1203475937 Un_GL000220v1:149302-149324 ACCGACCACGCCGCCGGCCCAGG - Intergenic
1189002896 X:36964018-36964040 CCCACCCACGCGGCCGGATCGGG - Intergenic
1189534515 X:41923176-41923198 CCCGGCCCCGCCGCCCGCGCCGG - Intronic
1190108602 X:47575160-47575182 CCCGCTGTCGCTGCCGGGGCAGG + Exonic
1190888251 X:54547840-54547862 CCCACCCTCCCTGCCTGCGCAGG - Intronic
1195724739 X:107902933-107902955 CCCGCCCACCCAGCCAGCCCAGG + Intronic
1196707342 X:118727688-118727710 CCCGCCCCCGCCCCCGCCGCCGG - Exonic
1196765323 X:119236919-119236941 CCGGCCCGCGCTGACAGCGCTGG + Intronic
1198177707 X:134172544-134172566 CCCGCCCACCCGGCCCGCACAGG + Intergenic
1199500389 X:148500732-148500754 CCCGCCGCCGCTGCCGCCGCCGG + Exonic
1199736866 X:150693540-150693562 CCCGCCGCCGCCGCCGCCGCCGG - Exonic