ID: 1096629229

View in Genome Browser
Species Human (GRCh38)
Location 12:52915016-52915038
Sequence CTCCACAGGGTCTTGTTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096629229_1096629237 11 Left 1096629229 12:52915016-52915038 CCACATAACAAGACCCTGTGGAG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1096629237 12:52915050-52915072 CCCACCCAACCTATAGAGAAAGG 0: 1
1: 0
2: 0
3: 4
4: 100
1096629229_1096629239 12 Left 1096629229 12:52915016-52915038 CCACATAACAAGACCCTGTGGAG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1096629239 12:52915051-52915073 CCACCCAACCTATAGAGAAAGGG 0: 1
1: 0
2: 0
3: 3
4: 125
1096629229_1096629240 13 Left 1096629229 12:52915016-52915038 CCACATAACAAGACCCTGTGGAG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1096629240 12:52915052-52915074 CACCCAACCTATAGAGAAAGGGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096629229 Original CRISPR CTCCACAGGGTCTTGTTATG TGG (reversed) Intronic
900490147 1:2943988-2944010 CTCCACAGGGTCCTTCTAGGGGG + Intergenic
900756884 1:4441852-4441874 CTGCACAGCTTCTGGTTATGAGG - Intergenic
900920087 1:5664484-5664506 ATCCTCAGGGGCTGGTTATGTGG + Intergenic
902270301 1:15299593-15299615 TTCCACACGGTCTTGGTAGGAGG - Intronic
902625266 1:17672818-17672840 CCCCATAGGGCCTTCTTATGTGG + Intronic
903755182 1:25655757-25655779 TTCCTCAGGGACTTGTTCTGGGG + Intronic
903969386 1:27109065-27109087 CTCCACCGGGTCTGGAAATGGGG - Intronic
906171374 1:43728557-43728579 GGCAACAGGGTCTTGCTATGTGG - Intronic
906635116 1:47404390-47404412 CTCCACAGTGTTTTGTCAAGGGG + Intergenic
908751956 1:67431989-67432011 TTCCACAGGCTCTGGTTCTGTGG + Intergenic
914946569 1:152072244-152072266 CTCCACATGGTTTTCTTCTGTGG + Intergenic
915191927 1:154158051-154158073 TTCAAGAGGGTATTGTTATGTGG - Intronic
915741082 1:158118840-158118862 TTCCACAGGGTTTTATTGTGTGG - Intergenic
915936206 1:160091675-160091697 ATCCACAGGGCCCTGTTAAGGGG - Intronic
916579991 1:166098042-166098064 CTACACAGAGTCCTGTGATGTGG - Intronic
922741609 1:228017209-228017231 CCCCACGGGCTCTAGTTATGTGG - Intronic
923219876 1:231883428-231883450 TTGCACAGGGACTTGTGATGAGG + Intronic
924362070 1:243252991-243253013 CATCATAGGTTCTTGTTATGCGG + Intronic
1063635840 10:7781731-7781753 TTTGACAGGGTCTTGTTTTGTGG - Intronic
1068438545 10:57021098-57021120 CACCACAGGGTCATGTTACAAGG + Intergenic
1079403635 11:20126472-20126494 CTTCACATTGTCTTCTTATGAGG - Intergenic
1079481157 11:20881514-20881536 CACCTGAGGGTGTTGTTATGAGG + Intronic
1084656328 11:70521786-70521808 CTCCAGGGGGTGTTGTTACGTGG - Intronic
1085592555 11:77777797-77777819 TGAGACAGGGTCTTGTTATGTGG - Intronic
1087926181 11:103921204-103921226 CTCCACAAGTTCTAGCTATGAGG + Intronic
1090409280 11:126496590-126496612 ATCCACAGGGTCTTGGGAGGTGG + Intronic
1096239157 12:49950432-49950454 CCCCACAGGGTCTTGTGAATGGG - Intergenic
1096629229 12:52915016-52915038 CTCCACAGGGTCTTGTTATGTGG - Intronic
1101080106 12:101173134-101173156 CTCAACAGGGTCTTGAAATAAGG + Intronic
1101407574 12:104442087-104442109 CTCTCCAAGGTCCTGTTATGTGG - Intergenic
1104824587 12:131699876-131699898 CTACCCAGGGTACTGTTATGAGG + Intergenic
1106183053 13:27384532-27384554 CCTCCCAGGATCTTGTTATGAGG + Intergenic
1107818327 13:44264172-44264194 CTGCACAGGGCCTCGTTAAGTGG - Intergenic
1111862941 13:93731055-93731077 GTCCACAGGGCTTTGTCATGAGG + Intronic
1113083638 13:106544731-106544753 CTCCACTGGGGCTTTTTGTGTGG + Intronic
1113140162 13:107138650-107138672 CTCCAGATGGTGTTCTTATGTGG + Intergenic
1113891443 13:113737617-113737639 CTCCACATCGTCTGGTTTTGTGG + Exonic
1116493377 14:45532784-45532806 CTCTACAAGGTTTTGTTATCAGG + Intergenic
1116691156 14:48107602-48107624 CTCCACAGGGTCTTCTTCAGAGG + Intergenic
1116799008 14:49423287-49423309 CTCCCCATGGTATTGTTTTGAGG + Intergenic
1117220246 14:53597001-53597023 GTCCACAGTTTCTTGTCATGTGG - Intergenic
1117658421 14:57980123-57980145 TTCCTTAGGGTGTTGTTATGAGG + Intronic
1121336973 14:93083562-93083584 TGCCAAAGGGTCTTGTTATTTGG - Intronic
1129968358 15:79756645-79756667 CTCCACAGGATCATGGTTTGGGG + Intergenic
1132792780 16:1702024-1702046 TTACACAGGGTCTTGCTCTGTGG - Exonic
1133429527 16:5724571-5724593 ATCCTCATGGTCTTGTCATGAGG + Intergenic
1134186333 16:12087966-12087988 CTGCACAGGGTCTAGCCATGAGG - Exonic
1137749574 16:50849545-50849567 CTGCACTGGGTCTTGTCAGGTGG + Intergenic
1138635089 16:58331911-58331933 GTACACAGGGTCTTATTTTGGGG - Intronic
1139641857 16:68297379-68297401 GCCCACAGAGTCTTGTTATCAGG - Exonic
1140092910 16:71852005-71852027 CCCCAGAGGGTGTTGTGATGGGG + Exonic
1141121931 16:81365861-81365883 GAGAACAGGGTCTTGTTATGTGG - Intronic
1141301021 16:82815668-82815690 CTCCACAGGGCTCTGTTATTTGG + Intronic
1141961721 16:87413430-87413452 CTTCACAGGGCATTGTTCTGGGG - Intronic
1142616409 17:1138662-1138684 AGACACAGGGTCTTGCTATGTGG + Intronic
1143736280 17:8914009-8914031 CTCCAGAGGGTCTTGTGGTCGGG - Intronic
1144229524 17:13187157-13187179 CTTCACAGGATCGTGTGATGTGG + Intergenic
1155943488 18:31823003-31823025 TAAGACAGGGTCTTGTTATGTGG - Intergenic
1157804385 18:50647312-50647334 CTACACAGTGTCTTGTGGTGTGG + Intronic
1160267532 18:77353384-77353406 CTGCACAGAGTCCTGTGATGTGG + Intergenic
1160347144 18:78141565-78141587 CTCCACTGGTTCTTCTTAAGGGG + Intergenic
1161688696 19:5718129-5718151 CCCCACAAGGTCTTGCTCTGGGG + Intronic
1162953666 19:14086433-14086455 ATAGACAGGGTCTTGCTATGTGG - Intergenic
1165821013 19:38676079-38676101 CTTTATAGGGTCTTGTTCTGTGG + Intronic
1166228416 19:41411472-41411494 ATCCAGAGGGTCCTGTTTTGGGG + Intronic
1168506472 19:56939392-56939414 AGAGACAGGGTCTTGTTATGTGG - Intergenic
925150621 2:1612339-1612361 CTCAACAGGGTCCTGATTTGGGG + Intergenic
925222989 2:2157910-2157932 CTCCACAGAGTCTGGCTCTGTGG - Intronic
925863618 2:8203699-8203721 CCCCACAGGGTACTGTTCTGTGG + Intergenic
926720468 2:15956661-15956683 CTCCACAGTGTCTTCATTTGAGG + Intergenic
926752138 2:16206322-16206344 CTTCACATGGCCTTCTTATGAGG - Intergenic
927841709 2:26449167-26449189 CTTCTCAGGGGCTTGTTTTGGGG + Intronic
927849538 2:26490163-26490185 CACCTCAGAGTCTTGTTATGAGG + Intronic
931713483 2:65009866-65009888 ATCCACAGAGTTTTGTTGTGAGG - Intronic
933186881 2:79288613-79288635 CTCCACATGGTCTTTCCATGTGG + Intronic
938138113 2:128775533-128775555 GTCCCCTGGGTCTTTTTATGAGG - Intergenic
938298340 2:130192551-130192573 ATCCACAGTGGCTTGTTTTGTGG - Intronic
938458426 2:131482106-131482128 ATCCACAGTGGCTTGTTCTGTGG + Intronic
939872949 2:147545316-147545338 CTCCACAGGGCCTTTTCTTGTGG - Intergenic
939968982 2:148639385-148639407 TTCCACAGTGACTTGTTAGGAGG - Intergenic
940102188 2:150054145-150054167 CTCCACAGGGTCGAGTGATGAGG + Intergenic
940407716 2:153324957-153324979 CTCCACCAGGTTTTGTTATAAGG + Intergenic
940654862 2:156476017-156476039 CTACACAGTGTCTTATTATTGGG + Intronic
941910863 2:170763431-170763453 ATCAACAGGGTCTTGCTCTGTGG - Intergenic
945975744 2:216269289-216269311 CTCCACTGGGTCAAGTTATTAGG - Intronic
947396593 2:229693517-229693539 CTCCCTAGGGACTTGTTAAGTGG + Intronic
948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG + Intronic
1171066880 20:22026293-22026315 CTGCACAGAGTCCTGTGATGTGG + Intergenic
1174361992 20:50034738-50034760 CTCCCCAGGGTCTGGCCATGAGG - Intergenic
1183827331 22:40398591-40398613 CTCAACTGGGACATGTTATGTGG + Intronic
1185180050 22:49354683-49354705 CTCCAGAGTGTCCTGTTCTGGGG - Intergenic
952723822 3:36560993-36561015 GTACACAGCGTCTTGTTAAGGGG + Intergenic
954778663 3:53043878-53043900 CTCAAAAGGGTCCTGTTTTGAGG + Intronic
955134727 3:56205473-56205495 TTACAGAGGGTCTTGTTACGGGG - Intronic
955980366 3:64519148-64519170 CTCCACACAGTTTTGTTGTGAGG + Intronic
958832297 3:99104239-99104261 TTCCATAGGGTGATGTTATGGGG + Intergenic
959112902 3:102143228-102143250 CTCCTCATAGTGTTGTTATGAGG - Intronic
962253400 3:133853435-133853457 CTCCACAGGCCCTTGGGATGGGG + Intronic
962301232 3:134244892-134244914 CTCCCCTGGGTCTTTTTATAAGG - Intronic
963239151 3:142985616-142985638 ATGCAGAGGGCCTTGTTATGAGG + Intronic
963485904 3:145934167-145934189 CTTCACATGGTCTTCTTATAAGG + Intergenic
963649717 3:147963232-147963254 CTCCACAGTGTATTGATTTGGGG + Intergenic
967837559 3:193977607-193977629 CTCCAAAGGGTCCTGGTTTGGGG - Intergenic
968665997 4:1822690-1822712 CTCCTCAGGGACTTGCTGTGAGG - Intronic
969042647 4:4312743-4312765 CTCCACAGGGTGCTGTTAAGAGG + Intronic
970315749 4:14827007-14827029 CTCCTCAGAGTGTTGTTATGAGG - Intergenic
970810067 4:20082016-20082038 CTCTACAGGGTTTTGGTATGAGG - Intergenic
974785013 4:66609050-66609072 CTGCATAGGGCCTTGTGATGCGG + Intergenic
976492908 4:85693004-85693026 CTGCACAGGGTCTTTATTTGTGG + Intronic
978493001 4:109328920-109328942 CTCCACGTGGTCTTTTTCTGTGG + Intergenic
978972195 4:114821929-114821951 CTCCACGTGTACTTGTTATGAGG - Intergenic
981051618 4:140314875-140314897 CTCCACAAGGTGTGGTTGTGTGG + Intronic
983429316 4:167628331-167628353 CTCCACAGGGTTTTGTGTGGAGG - Intergenic
984628741 4:182038410-182038432 CTTCTCAGGGGTTTGTTATGTGG - Intergenic
985875874 5:2593690-2593712 CTACTCAGGGTCTTTTTTTGTGG - Intergenic
988466312 5:31495895-31495917 CTGGACAGGGTCTTGTCCTGTGG + Intronic
989697026 5:44213303-44213325 CTCCACCTGGTCTTTCTATGAGG - Intergenic
992413030 5:76526037-76526059 ATCCACAAGCTCTTGTTTTGGGG - Intronic
997201843 5:132014673-132014695 CTCCAGAGGGTGTGGATATGGGG + Intergenic
999299030 5:150479061-150479083 TTTAACAGGGTCTTGTTCTGTGG - Intergenic
999389121 5:151177423-151177445 CTCCTCAGGGTCTGGGAATGTGG - Intergenic
999483413 5:151969834-151969856 CTCCATAAGGTATTGTTATTTGG + Intergenic
999921333 5:156324599-156324621 CTCCCCAAAGACTTGTTATGTGG - Intronic
1001401737 5:171450286-171450308 CTCCCCAGCCTCTTGGTATGGGG - Intronic
1006818834 6:36874517-36874539 CTCCGCGGGGTCTTGTGCTGAGG - Intronic
1009486557 6:64231016-64231038 TACTACAGGGTCATGTTATGTGG - Intronic
1009583120 6:65562572-65562594 ATCTCCAGGGTCTTGCTATGTGG - Intronic
1009716943 6:67409912-67409934 CTTCCCTGGGTCTTGTTATTTGG + Intergenic
1012099797 6:95018174-95018196 CTCCACAGGAGATTGTTATTTGG + Intergenic
1013460433 6:110370040-110370062 CTGAACAGGATCTAGTTATGAGG + Intergenic
1013950890 6:115780649-115780671 CTCCTCAGGTCCTTGTAATGAGG + Intergenic
1014872280 6:126611475-126611497 CTCCACCAGGTTTTGTTATCAGG + Intergenic
1016429648 6:143969349-143969371 CTCAAAAGGGTCTTGTGATGTGG - Intronic
1017666855 6:156727939-156727961 GTCCACAATGTCTTGTAATGAGG + Intergenic
1020805454 7:12784879-12784901 TTTCACAGGGTCTTCTTGTGGGG - Intergenic
1022248541 7:28584420-28584442 CTCCACATGGCCTTCTTATAAGG - Intronic
1023009870 7:35917022-35917044 CTCCACAGGTTCTAATAATGAGG + Intergenic
1024080964 7:45854586-45854608 CTCCACAGGTTCTAATAATGAGG - Intergenic
1024975789 7:55112570-55112592 CTCCACAGGGCCTTCTGAGGGGG - Intronic
1025123531 7:56327213-56327235 CTCCACAGGTTCTAATAATGAGG + Intergenic
1025873372 7:65456247-65456269 CTCCACACGGACTTGTTTTAAGG + Intergenic
1026575416 7:71567436-71567458 CTCTACAGGGTATTGTTGTGTGG - Intronic
1026594611 7:71723947-71723969 ATCCACAGGGTGTTGCTCTGGGG - Intergenic
1027843696 7:83345285-83345307 CTCCACCAGGTTTTGATATGAGG - Intergenic
1029574882 7:101396854-101396876 CTCCACTGGGTCTTGCTCTAGGG - Intronic
1029982300 7:104890407-104890429 CTCCACGGGGCGTTGTAATGCGG - Intronic
1030029105 7:105352571-105352593 CTTCACAGTAACTTGTTATGTGG + Intronic
1035136623 7:156709521-156709543 CTGCAAAGAGTCTTGTGATGTGG - Intronic
1035258295 7:157646138-157646160 CTCCGCATGGCCTTGTGATGTGG + Intronic
1035407483 7:158609038-158609060 ATGGACAGGGTCTTGTTGTGTGG - Intergenic
1035872542 8:3151502-3151524 CTCCACAGGTTGCTGTTAAGTGG + Exonic
1037910345 8:22740463-22740485 CGCCTCAGGTTCTTGTTAAGAGG - Intronic
1039400846 8:37267752-37267774 CTCCACATGGTCTCTTCATGCGG + Intergenic
1041568698 8:59311078-59311100 CACCACAGGATGTTGTTTTGTGG + Intergenic
1043492049 8:80759584-80759606 CTCCTCAGTCTCTTGTTATGTGG - Intronic
1047582054 8:126226517-126226539 CACCTCAGGGTCTTGATATCTGG - Intergenic
1048527249 8:135214395-135214417 CTTCACAGGGTCTTCTCATTAGG - Intergenic
1048532795 8:135265579-135265601 CTCCACCTGGTCTTGACATGTGG - Intergenic
1049519873 8:143082631-143082653 CTCCTCAGGGCCCTGTTGTGAGG + Exonic
1052032822 9:23647511-23647533 TTCCACAGTTTCTTGTTATAGGG + Intergenic
1052189697 9:25645369-25645391 CACCATGGGGTCTTGCTATGAGG - Intergenic
1052504833 9:29340635-29340657 CCCCACAGTGTCTTGCTCTGTGG + Intergenic
1053365667 9:37520949-37520971 CCCCACTGGCACTTGTTATGAGG - Intronic
1055483407 9:76732571-76732593 CTCCACAGTGTCTGGTTAGCAGG + Intronic
1056545791 9:87612358-87612380 CTCCACAGGGCCTTCTTATAAGG - Intronic
1056789532 9:89616596-89616618 GTCCACACGGTCTTGTCACGGGG + Intergenic
1057232458 9:93332067-93332089 CTCCAGAGGGCCTGGTGATGTGG - Intronic
1057782026 9:98057569-98057591 TTCCACATGGAGTTGTTATGGGG + Intronic
1058079174 9:100683931-100683953 CTCAACAGGTTTTGGTTATGTGG + Intergenic
1058165215 9:101611349-101611371 CTCCACAGGGTCTCCTTATAAGG + Intronic
1058715699 9:107720305-107720327 CTTTACAGGGTGTTGTCATGGGG - Intergenic
1059447618 9:114348688-114348710 ATCTTCAGGGTCTTGTTTTGTGG + Intronic
1061784499 9:133018407-133018429 TTTCACAGGGTCTTGCTCTGTGG - Intergenic
1186247793 X:7632302-7632324 CTGCACAGGGTCTTTATTTGTGG - Intergenic
1188017795 X:25123977-25123999 CTACACATGGTCTTTTTATGTGG + Intergenic
1192557200 X:72100078-72100100 CTTCTCAGGGTCTTGGTTTGTGG + Intergenic
1194397144 X:93400795-93400817 CTGCTTAGGGTCTTGTTAAGTGG + Intergenic
1194652413 X:96532027-96532049 CTCATCAGGGTCTTGTTGTCAGG - Intergenic
1198486476 X:137092477-137092499 CTCTAAGGAGTCTTGTTATGAGG + Intergenic
1202601441 Y:26597435-26597457 AGACACAGGGTCTTGCTATGTGG + Intergenic