ID: 1096633998

View in Genome Browser
Species Human (GRCh38)
Location 12:52947169-52947191
Sequence ATCCCTGCTGAATGAAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096633998_1096634002 -4 Left 1096633998 12:52947169-52947191 CCAACACTTCATTCAGCAGGGAT 0: 1
1: 0
2: 1
3: 5
4: 137
Right 1096634002 12:52947188-52947210 GGATGGTCATTCAGCTTCAGGGG 0: 1
1: 0
2: 1
3: 11
4: 107
1096633998_1096634003 -3 Left 1096633998 12:52947169-52947191 CCAACACTTCATTCAGCAGGGAT 0: 1
1: 0
2: 1
3: 5
4: 137
Right 1096634003 12:52947189-52947211 GATGGTCATTCAGCTTCAGGGGG 0: 1
1: 0
2: 0
3: 11
4: 139
1096633998_1096634004 1 Left 1096633998 12:52947169-52947191 CCAACACTTCATTCAGCAGGGAT 0: 1
1: 0
2: 1
3: 5
4: 137
Right 1096634004 12:52947193-52947215 GTCATTCAGCTTCAGGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 157
1096633998_1096634000 -6 Left 1096633998 12:52947169-52947191 CCAACACTTCATTCAGCAGGGAT 0: 1
1: 0
2: 1
3: 5
4: 137
Right 1096634000 12:52947186-52947208 AGGGATGGTCATTCAGCTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 161
1096633998_1096634001 -5 Left 1096633998 12:52947169-52947191 CCAACACTTCATTCAGCAGGGAT 0: 1
1: 0
2: 1
3: 5
4: 137
Right 1096634001 12:52947187-52947209 GGGATGGTCATTCAGCTTCAGGG 0: 1
1: 0
2: 0
3: 17
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096633998 Original CRISPR ATCCCTGCTGAATGAAGTGT TGG (reversed) Intronic
902444172 1:16451604-16451626 TTCCCTGATGAATGAAGTGGGGG + Intronic
902778187 1:18687878-18687900 ATCCCTGCAGAATAAGGAGTGGG + Intronic
903962978 1:27068672-27068694 TTTCCTGCTGCATGAAATGTAGG + Intergenic
911333439 1:96552338-96552360 ATCACCTCTGAATGAAGTATAGG - Intergenic
911871016 1:103099052-103099074 AACTTTGCTGAATGAAGTGAGGG - Intronic
913489452 1:119365343-119365365 CTCCCTGCTGAATAAACTCTTGG + Intergenic
916913011 1:169372046-169372068 ATCCCTGGTCAAATAAGTGTGGG - Intronic
919474985 1:198021798-198021820 ATGCCTGCTAAATAAAGTTTTGG + Intergenic
919773981 1:201181764-201181786 AGCCCTGATGAATGCAGTGGTGG - Intergenic
920797203 1:209151435-209151457 ATCCCTGCTGAAGGTGGTATAGG + Intergenic
921991334 1:221371146-221371168 ATCTCTTCTGCATGAAGTCTCGG - Intergenic
922159814 1:223071041-223071063 ACTTCTGCTGAATGAAGTCTGGG - Intergenic
1065019456 10:21492370-21492392 ATGCCTACTGAAGGAAGGGTTGG - Intergenic
1065245358 10:23750786-23750808 ATCTTGGCAGAATGAAGTGTTGG + Intronic
1068177122 10:53475731-53475753 GTCCCTGATGAATGAAGGATAGG + Intergenic
1068369968 10:56100560-56100582 ATCCGTGTTGAATGAATTTTAGG + Intergenic
1068590216 10:58845581-58845603 AGCCCTGCTGTAAGATGTGTAGG - Intergenic
1069514843 10:69069443-69069465 CGCCCTGCTGCATGCAGTGTTGG + Intergenic
1070669585 10:78368619-78368641 ATACCTGCTGAGGGACGTGTGGG - Intergenic
1073466467 10:103697121-103697143 ATCCCTGCTGCTTGCAGTGGGGG + Intronic
1073502785 10:103956408-103956430 CACCCTGGTTAATGAAGTGTGGG + Intergenic
1073508751 10:104028116-104028138 ATCTTTCCTGCATGAAGTGTAGG + Exonic
1076696438 10:132249543-132249565 ATCCCTGCTCAAGGACCTGTTGG + Intronic
1076838985 10:133036105-133036127 ATCCCTGCTGTAGGAAGCGAGGG + Intergenic
1080282169 11:30569861-30569883 CTCCCTGTTGACTGAAGTCTAGG + Intronic
1081595902 11:44459348-44459370 ATCCCAGGTGGAAGAAGTGTTGG + Intergenic
1084515114 11:69633810-69633832 ACCACAGCTGAATGATGTGTTGG + Intergenic
1085413521 11:76305858-76305880 ATCCATGCTGAGGGAAGTGGTGG + Intergenic
1086584498 11:88435033-88435055 ATCCCTACTGAAGGAAATATGGG - Intergenic
1089130299 11:116207134-116207156 AACCCTGCTGGATGATGTGTAGG + Intergenic
1089713145 11:120331686-120331708 ATCTGAGATGAATGAAGTGTGGG + Intronic
1090592865 11:128291079-128291101 TTCCCTGCTTCATGCAGTGTGGG - Intergenic
1091863761 12:3811396-3811418 AGCCCTGATGGATGAAGTGTAGG + Exonic
1096633998 12:52947169-52947191 ATCCCTGCTGAATGAAGTGTTGG - Intronic
1102507933 12:113395619-113395641 ATCCCTGCCAAATGGAATGTGGG + Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1107218431 13:37950169-37950191 ATACCTGCTGAATGAAGAAATGG - Intergenic
1110346378 13:74452609-74452631 AAGCCTGTGGAATGAAGTGTAGG - Intergenic
1111260424 13:85732396-85732418 ATTCCTGCTTAATTAAGAGTTGG + Intergenic
1111274085 13:85924960-85924982 ATCACTGCTGACTGAAGCATCGG - Intergenic
1118763671 14:68895887-68895909 CTCCCTTCTGGATGAAGTCTGGG + Intronic
1119262739 14:73247186-73247208 ATCCTTGATAAATGAAGTCTTGG - Intronic
1122186133 14:99997777-99997799 AGCTCTGCTTAATGAAGAGTAGG - Intronic
1122794116 14:104197153-104197175 ATCCCCACTGGATGAAGTGGGGG + Intergenic
1123964505 15:25441429-25441451 CCCCATGCTCAATGAAGTGTTGG - Intergenic
1132070593 15:98773680-98773702 CTCCCTGCTGATTACAGTGTGGG - Intronic
1133510847 16:6455699-6455721 ATTCCTGCTTTGTGAAGTGTAGG - Intronic
1135648474 16:24185161-24185183 AGTCCTGCTGTATGAAATGTTGG + Exonic
1143739840 17:8944591-8944613 TTCCCTGGGGAATGAAGAGTGGG + Intronic
1143962744 17:10734088-10734110 ATTCCATGTGAATGAAGTGTTGG + Intergenic
1144166907 17:12621294-12621316 ATACCTGTTGAATGAAGGGATGG + Intergenic
1144796366 17:17893972-17893994 ATCCCTGGAGAATGGAGTGTGGG - Intronic
1146168776 17:30616176-30616198 ATCGCAGCTGAATGCAGTGAAGG + Intergenic
1146539080 17:33679441-33679463 ATCCCTGCTGAATGAGTGTTTGG - Intronic
1146648412 17:34590871-34590893 ATCAATGCTGAAGCAAGTGTTGG + Intronic
1147999972 17:44381977-44381999 TCACCTGCTGAAGGAAGTGTGGG - Intronic
1148606159 17:48930588-48930610 ACACCTGCTGAAGGAAGGGTTGG - Exonic
1150146842 17:62776308-62776330 ATCCCAGCTCAGTGAATTGTTGG - Intronic
1153981441 18:10314099-10314121 ATTGCTGTTGAATTAAGTGTAGG + Intergenic
1154357340 18:13632085-13632107 GGACCTGCTGAATGAAGTTTGGG - Intronic
1161350604 19:3789313-3789335 TTCCCTGCTGAACGAAGAGAAGG - Exonic
1163935052 19:20434978-20435000 ATTCCTGATGAAGGAAGTGGTGG + Intergenic
1165147912 19:33743619-33743641 ATCCCTGCTTCATTGAGTGTGGG + Intronic
926773384 2:16398031-16398053 CTGCCTGCAGAGTGAAGTGTGGG - Intergenic
928964891 2:36966558-36966580 CTCCCTGCTGACTGGGGTGTGGG - Intergenic
929609064 2:43256444-43256466 TTCCAGGCTGAATGAAGTGCAGG + Intronic
933916670 2:87001610-87001632 ATCCCTCATGTATGCAGTGTTGG - Intronic
934006324 2:87768304-87768326 ATCCCTCATGTATGCAGTGTTGG + Intronic
934067469 2:88353187-88353209 TTACCTTCTGAATGAAGTATTGG - Intergenic
935769976 2:106409219-106409241 ATCCCTCATGTATGCAGTGTTGG + Intronic
935910121 2:107886705-107886727 ATCCCTCATGTATGCAGTGTTGG - Intronic
935968238 2:108503571-108503593 ATCCCTCATGTATGCAGTGTTGG - Intronic
936131907 2:109851864-109851886 ATCCCTCATGTATGCAGTGTTGG - Intronic
936212790 2:110519621-110519643 ATCCCTCATGTATGCAGTGTTGG + Intronic
936421930 2:112374201-112374223 ATCCCTCATGTATGCAGTGTTGG + Intronic
939238503 2:139528838-139528860 ATCCCTGCTGACTGCAGAGAGGG + Intergenic
940358049 2:152767134-152767156 ATCCCTCAGGAATGAAGTTTTGG + Intergenic
943471718 2:188302850-188302872 ATTCTTGCTGAATGAAGGTTAGG - Intronic
943784909 2:191866761-191866783 ATTCCTGCTTCCTGAAGTGTTGG + Intergenic
945485790 2:210394414-210394436 ATGACTACTGAATGCAGTGTGGG - Intergenic
947084116 2:226431751-226431773 ATCCCTGCTGAACCATGTGATGG - Intergenic
1168913994 20:1471714-1471736 AGCCCTGCTGCATGCAGTATTGG - Intronic
1175367396 20:58465484-58465506 ATACATGCTGAATGATGTGAAGG + Intronic
1176701394 21:10055851-10055873 TTCACTGGTGAATGAAATGTAGG - Intergenic
1177895314 21:26850543-26850565 ATCCCTGCTAGTGGAAGTGTAGG - Intergenic
1181286457 22:21755864-21755886 CTCCCTGCTGAGTTATGTGTTGG + Exonic
1181295210 22:21832566-21832588 CTCTCTGCAGAATGAAGTCTGGG - Intronic
1183515895 22:38265909-38265931 AGCCCTGCTGAGTGGAGTGGAGG + Intronic
951249664 3:20380338-20380360 ATCTCTACTGCATGAAGTCTGGG + Intergenic
955482901 3:59407360-59407382 TTCCCTCCTGTATGAAGTTTTGG + Intergenic
956188379 3:66584094-66584116 TTCTCTGTTGATTGAAGTGTGGG + Intergenic
958666095 3:97139418-97139440 ATTCCTGCTGACAGAAGTGCAGG + Intronic
961967115 3:130916649-130916671 TTCCCTGATTAATGAAGTGGAGG + Intronic
964776435 3:160283807-160283829 AGCCCTGCTGAATGAAGTGGGGG - Intronic
968895567 4:3400356-3400378 ATCACTGTTGAATGAATGGTGGG - Intronic
968940295 4:3634171-3634193 AGTCCTGCTGACTGAAATGTTGG - Intergenic
977715275 4:100175134-100175156 ACCCCTCCTGATGGAAGTGTCGG + Intergenic
980373549 4:131912112-131912134 TTCACTGGTGAATGAAATGTAGG - Intergenic
984202375 4:176741270-176741292 ATTCCTGCTGATTTAATTGTTGG + Intronic
988100611 5:26672006-26672028 GTCCCTGCTGAATTAAGTCTAGG + Intergenic
988253459 5:28791687-28791709 TTCACTGCTTAATGAAGTCTAGG + Intergenic
988919611 5:35928203-35928225 ATCCCTCCTGAATGAAATTAAGG - Intronic
988973690 5:36494315-36494337 ATGCCTGCTGAATGAAGAAATGG + Intergenic
997418112 5:133744747-133744769 CTTCCTGCTCACTGAAGTGTCGG + Intergenic
1003697151 6:8420320-8420342 ATCACTATTGAATGAGGTGTGGG - Intronic
1004127174 6:12885153-12885175 ATCCCTGCGGAATGCAGGGAAGG + Intronic
1005295651 6:24424014-24424036 TTTCATGCTGAATGAAGCGTAGG + Exonic
1007125855 6:39425049-39425071 ATCCCTAGTGAATGGTGTGTGGG - Intronic
1007943533 6:45804412-45804434 ATCCCTCTTGAAGGAAGTGAAGG - Intergenic
1011245354 6:85316320-85316342 ACTCCTGTGGAATGAAGTGTGGG - Intergenic
1017079789 6:150656569-150656591 CTCCATGCTTAATGAAGTTTGGG - Intronic
1021113692 7:16724739-16724761 ATCCCTGCTGAATCTAATTTGGG - Intergenic
1024092450 7:45955769-45955791 ATCCCTGCTGATTGAGGGGATGG - Intergenic
1025733548 7:64127439-64127461 CTCCCTACTGAATGAAGGCTGGG - Intronic
1029494924 7:100891335-100891357 ATCCCTGCGGAAGGAAGGGAAGG + Exonic
1031237618 7:119196954-119196976 ATCTCTGCTTCATGAAGGGTGGG - Intergenic
1031830847 7:126623576-126623598 ATCCCCAGTGAATGGAGTGTTGG - Intronic
1037822877 8:22143623-22143645 ATCCCAGCTGAATGAGCTTTGGG - Intergenic
1039670883 8:39596568-39596590 ATACCTACTGAAGGATGTGTTGG + Intronic
1043453521 8:80392088-80392110 CTCCCTGATGATTGGAGTGTGGG + Intergenic
1043764617 8:84114673-84114695 ATCACTGCTGAATAAAATATTGG + Intergenic
1044157340 8:88863779-88863801 GTCCCTACAGAAGGAAGTGTAGG - Intergenic
1044388819 8:91624227-91624249 ATCCTTGTTGAATGAATGGTAGG - Intergenic
1046164899 8:110419799-110419821 CTCCCTGCTAAATGAAATGCAGG - Intergenic
1048115713 8:131519676-131519698 ATGCCTGATGACTGAGGTGTAGG - Intergenic
1049930952 9:456070-456092 ATCTCTGTAGAATGAAGTGGAGG - Intronic
1053638540 9:40042397-40042419 TTCACTGGTGAATGAAATGTAGG - Intergenic
1053767545 9:41422795-41422817 TTCACTGGTGAATGAAATGTAGG + Intergenic
1054319333 9:63638939-63638961 TTCACTGGTGAATGAAATGTAGG - Intergenic
1054450465 9:65401126-65401148 AGTCCTGCTGACTGAAATGTCGG + Intergenic
1054546211 9:66334311-66334333 TTCACTGGTGAATGAAATGTAGG + Intergenic
1061711196 9:132489091-132489113 ATCCCTTGTCAATGAGGTGTTGG - Intronic
1202786410 9_KI270719v1_random:25937-25959 TTCACTGGTGAATGAAATGTAGG - Intergenic
1187467156 X:19537815-19537837 ATCTCTGATGAAGGAAGTCTGGG - Intronic
1187775840 X:22755977-22755999 ATCCCTTATGAAGAAAGTGTAGG + Intergenic
1188503131 X:30850858-30850880 ATCCCTGCTAAATAAAATATTGG - Intronic
1191595224 X:62936211-62936233 ATCCCTGCTGCCTGTTGTGTGGG + Intergenic
1195875015 X:109531236-109531258 ATCCATTCTGAAGGAAGTGAAGG - Intergenic
1197028822 X:121788836-121788858 ATCTTTCCTAAATGAAGTGTAGG + Intergenic
1198196726 X:134370832-134370854 ATGCCTGCTGAATGAATGATTGG + Intergenic
1198373627 X:136015934-136015956 ATACTTGCTGAATGAAGTTAAGG - Intronic
1199513716 X:148652391-148652413 TTCCTTGCTGTAGGAAGTGTTGG - Intronic
1199969161 X:152845935-152845957 ATCCACGCTGACTGAAGCGTGGG + Intronic
1200733220 Y:6765505-6765527 TTACCTGCTGAATGATGTCTTGG + Intergenic