ID: 1096634197

View in Genome Browser
Species Human (GRCh38)
Location 12:52948383-52948405
Sequence ACTTGTGGAGGGGATCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096634197_1096634208 -4 Left 1096634197 12:52948383-52948405 CCCCCAAGATCCCCTCCACAAGT 0: 1
1: 0
2: 0
3: 18
4: 169
Right 1096634208 12:52948402-52948424 AAGTGGATAATTTGGGCTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 157
1096634197_1096634212 23 Left 1096634197 12:52948383-52948405 CCCCCAAGATCCCCTCCACAAGT 0: 1
1: 0
2: 0
3: 18
4: 169
Right 1096634212 12:52948429-52948451 GGACAGCTAGAGGGACTCACAGG 0: 1
1: 0
2: 0
3: 11
4: 172
1096634197_1096634210 13 Left 1096634197 12:52948383-52948405 CCCCCAAGATCCCCTCCACAAGT 0: 1
1: 0
2: 0
3: 18
4: 169
Right 1096634210 12:52948419-52948441 TGCAGGTTAAGGACAGCTAGAGG 0: 1
1: 0
2: 0
3: 11
4: 118
1096634197_1096634211 14 Left 1096634197 12:52948383-52948405 CCCCCAAGATCCCCTCCACAAGT 0: 1
1: 0
2: 0
3: 18
4: 169
Right 1096634211 12:52948420-52948442 GCAGGTTAAGGACAGCTAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 119
1096634197_1096634209 2 Left 1096634197 12:52948383-52948405 CCCCCAAGATCCCCTCCACAAGT 0: 1
1: 0
2: 0
3: 18
4: 169
Right 1096634209 12:52948408-52948430 ATAATTTGGGCTGCAGGTTAAGG 0: 1
1: 0
2: 1
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096634197 Original CRISPR ACTTGTGGAGGGGATCTTGG GGG (reversed) Intronic
900500280 1:3001163-3001185 GCCTGTGAAGGGGATCTTGAGGG + Intergenic
907356885 1:53882912-53882934 ACTTGTGGAGGGGAACACTGGGG - Intronic
907838697 1:58135758-58135780 ACTTTTGGAAGATATCTTGGGGG + Intronic
909727519 1:78853312-78853334 ACTTTAGGTGGGGATCTTGGGGG + Intergenic
911092156 1:94026138-94026160 AGTAGTTGAGGGGATTTTGGTGG + Intronic
912505756 1:110154756-110154778 ACTTGCTGATGGGAGCTTGGTGG + Intronic
912777963 1:112518156-112518178 ATTTGTGGTGGGATTCTTGGAGG + Intronic
914877703 1:151524694-151524716 ACTTCTGGAAGAGGTCTTGGAGG + Exonic
916382838 1:164232448-164232470 ACATGTGGATGGAATCTTGAAGG + Intergenic
917620731 1:176793212-176793234 AGTCCTGGAGGGGATCTTGGAGG + Intronic
918198153 1:182242114-182242136 ACTTTGGAAGGGGATTTTGGTGG + Intergenic
918951545 1:191146348-191146370 GGTTGTGGAGGTGATTTTGGTGG - Intergenic
921483440 1:215689670-215689692 CCCTGTGGAGGGGAACTAGGTGG + Intronic
922934190 1:229411163-229411185 ACTGGTGGAGGGGAATCTGGTGG - Intergenic
923233615 1:232011326-232011348 ATTGGTGGAGAGGATCTGGGAGG - Intronic
1062925137 10:1310674-1310696 ACCTCTGGAGGGGATCTCTGTGG + Intronic
1065073787 10:22055325-22055347 AATAGTGGGTGGGATCTTGGAGG + Intergenic
1066746335 10:38605868-38605890 ACTAGGGGAGGGGATCATGCTGG + Intergenic
1067510827 10:46893648-46893670 ACTTGTCCAGGGGGACTTGGTGG - Intergenic
1067651427 10:48158214-48158236 ACTTGTCCAGGGGGACTTGGTGG + Intronic
1068778067 10:60888943-60888965 ACCGGTGGAGGGGCTTTTGGAGG + Exonic
1070599841 10:77857834-77857856 ATTTGTGGATGGGATCTGGCAGG + Intronic
1071481371 10:86067604-86067626 GGTGGTGGAGGGGATCTGGGTGG - Intronic
1072252046 10:93589375-93589397 ACATGGGGATGGGACCTTGGAGG + Exonic
1072429196 10:95356107-95356129 ACTTGTTGAGGCGATGTTTGGGG + Intronic
1073318694 10:102600615-102600637 AGTTAGGGAGGGCATCTTGGAGG + Intronic
1074060985 10:109965433-109965455 ACTTTTGGAGGGGATCCTCAAGG - Intergenic
1074240288 10:111632103-111632125 CCTTGTGGAGGGGAACTCTGAGG - Intergenic
1076694907 10:132242728-132242750 ACGTGTGCAGGGCATCGTGGGGG - Intronic
1077363877 11:2153686-2153708 GCGTGTGGAAGGGACCTTGGAGG - Intronic
1079405137 11:20138451-20138473 CCTTGTGGAGGGGATATGGGAGG - Intergenic
1081073544 11:38641285-38641307 ACTTGTAGAGGTGGTCTTGGTGG + Intergenic
1089099134 11:115946176-115946198 ACTAGAGGAGGGGATAATGGAGG + Intergenic
1089794938 11:120972722-120972744 ACTTGTGCAGGGGCTGTGGGTGG + Intronic
1096255331 12:50058744-50058766 CCTTGTTGAGGGGATCCTGGGGG - Exonic
1096634197 12:52948383-52948405 ACTTGTGGAGGGGATCTTGGGGG - Intronic
1096686815 12:53293399-53293421 ACTTGAGTCGGGGAGCTTGGCGG - Exonic
1097571989 12:61345348-61345370 ACTTGTGGGGGGGGGCTTGTGGG - Intergenic
1098275166 12:68805310-68805332 ACCTGTGGAGGGGGTCCCGGGGG + Intergenic
1100074725 12:90766267-90766289 AAATGTGGGGGGGATCTTGGGGG - Intergenic
1101405712 12:104426755-104426777 ACTTTTGAAGGGGATCGGGGTGG + Intergenic
1101518404 12:105459155-105459177 ATCACTGGAGGGGATCTTGGGGG + Intergenic
1105411283 13:20173882-20173904 AACTGTGGAGGGGAGCTCGGGGG - Intergenic
1107173570 13:37373808-37373830 ATTTGGGGAGGGGATTTGGGAGG - Intergenic
1107996328 13:45864749-45864771 CCTTCTGGAGGGGATCCTGTTGG - Intergenic
1113660944 13:112105856-112105878 CCTTAAGGAGGGGATCCTGGGGG - Intergenic
1116108850 14:40549641-40549663 ACTATTGGAGGCCATCTTGGAGG - Intergenic
1117066310 14:52015663-52015685 ACTTGTGCAGGTGATCCTTGGGG + Intronic
1117166721 14:53041884-53041906 ATGTGTGGAGGGGAGGTTGGGGG + Intronic
1118015280 14:61654168-61654190 ATTTGGGGTGGGGAGCTTGGTGG + Exonic
1119034406 14:71217493-71217515 ACTGGGTGAGGGAATCTTGGGGG + Intergenic
1119712519 14:76832616-76832638 AGTTTTTAAGGGGATCTTGGAGG + Intronic
1121837741 14:97107042-97107064 ACTTGGGGAGGGCTTCCTGGAGG + Intergenic
1121913330 14:97812747-97812769 ACTTCTGAATGGGATCTTAGTGG + Intergenic
1122263293 14:100535211-100535233 AGGTGTGGAGGCCATCTTGGGGG + Intergenic
1122796984 14:104210879-104210901 CCTTGTGGCGTGGGTCTTGGGGG + Intergenic
1123944368 15:25231876-25231898 ACTTGGAGAGGGCACCTTGGTGG + Intergenic
1130834944 15:87640854-87640876 GCTCCTGGAGGGGATCCTGGAGG - Intergenic
1132630618 16:915546-915568 ACATGTGGAGGGGCACCTGGCGG + Intronic
1133966873 16:10538025-10538047 AATGGTGGAGAGGATCATGGTGG + Exonic
1136147072 16:28321988-28322010 ACGTGAGGATGGGGTCTTGGAGG - Exonic
1136523297 16:30811580-30811602 ACTTCTGGAAGTGATTTTGGAGG - Intergenic
1138554152 16:57762407-57762429 GCTGGTGGAGGGCATTTTGGGGG - Intronic
1145846496 17:28042607-28042629 ACTTGTGGCAGGAATCCTGGGGG + Exonic
1147582147 17:41633342-41633364 ATGTGTGGAGGGGGTGTTGGGGG + Intergenic
1148161823 17:45454506-45454528 GCGTGTGGAGGGGATCTTTTGGG - Intronic
1150115938 17:62549648-62549670 TCTTGCGGTGGGGGTCTTGGGGG - Intronic
1153669488 18:7397224-7397246 ACTAGCGTAGGGGATCTTTGTGG - Intergenic
1153675890 18:7455283-7455305 ACTCTGGGAGGGGACCTTGGCGG + Intergenic
1155400268 18:25431052-25431074 ACTTGTGGGAGGGAACTTAGAGG - Intergenic
1158710251 18:59831136-59831158 ATTTTTGGAGGGGAGCTGGGAGG - Intergenic
1159955661 18:74516712-74516734 CCTTGTGGAGGGGACTCTGGTGG + Intronic
1160791245 19:924832-924854 ACTTGTGGAGGGTCTCTGGCGGG - Intergenic
1160858225 19:1226880-1226902 ACGTGTGGCGGGGCTCTGGGGGG + Intronic
1160885820 19:1347265-1347287 GCTTGTGCAGGGAAACTTGGAGG + Intergenic
1162158651 19:8696508-8696530 ACTTGTGGGGGGCATCCTAGGGG + Intergenic
1163182557 19:15614852-15614874 ACATTTGGAGGGGAACTTGGGGG + Intergenic
1164502043 19:28828344-28828366 ACATGAGAAGGGGATCTTGGTGG + Intergenic
1165210971 19:34235455-34235477 ACTACTGGAAGGGAGCTTGGTGG - Intergenic
1165752783 19:38270970-38270992 ACTTGTGAGGAGGATCTTGCAGG - Intronic
1166646900 19:44538916-44538938 AATTGTGGTGGGCATGTTGGAGG - Intergenic
1166747077 19:45146549-45146571 ACTTGGGGAGGAGAGATTGGGGG - Exonic
1167503812 19:49861222-49861244 TATTGTGGAGGGGAGCTGGGCGG + Exonic
925287884 2:2727645-2727667 CCTTGGGGAGTGGATCTAGGGGG - Intergenic
925458689 2:4041860-4041882 ACTTGTTGAGGAGAGCATGGAGG + Intergenic
927087100 2:19683014-19683036 GCTTCTGGAGGGGATCTGGAGGG + Intergenic
933247206 2:79989152-79989174 ACTTGTTAAGGGTTTCTTGGAGG - Intronic
934187872 2:89762891-89762913 ACTAGGGGAGGGGATCATGCTGG - Intergenic
936241699 2:110793385-110793407 ATTTGTTGGGGGGATCTGGGAGG + Intronic
939313398 2:140514290-140514312 AATTTTGGAGGGTAACTTGGTGG + Intronic
941290504 2:163668021-163668043 ACTTGTGGAGGGTTTTTTGGGGG - Intronic
942623123 2:177869673-177869695 ACAAGTGGTGAGGATCTTGGGGG + Intronic
944317321 2:198296898-198296920 ACTTCTGGAGGCTCTCTTGGGGG + Intronic
947890095 2:233609981-233610003 ACTAATGAAGGGCATCTTGGAGG - Intergenic
948256839 2:236574542-236574564 ACATGTGGAAGGGAGTTTGGAGG + Intronic
948326350 2:237124940-237124962 ACGGGTGGAGTGGATCTTGGAGG + Intergenic
949007585 2:241658412-241658434 ACCTGTGGAGGGGAGCTGGGTGG - Intronic
1169724638 20:8715678-8715700 ACTTGGGGAGGGGGTCCTGGAGG - Intronic
1170136377 20:13078773-13078795 ACTTGTGGAGGGGCTGTTCTTGG + Intronic
1170371169 20:15649722-15649744 TTTTGAGGAGGGGATCTTTGGGG + Intronic
1170546365 20:17438614-17438636 CCTGGTAAAGGGGATCTTGGTGG - Intronic
1172653950 20:36525650-36525672 CCTAGTGGTGGGGATCTTTGGGG - Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1176937451 21:14883435-14883457 ACTTGGTGAGGGGGTCTTTGAGG - Intergenic
1177918488 21:27122414-27122436 GCCTGTGAAGGGGATCTAGGTGG - Intergenic
1180000290 21:44992509-44992531 ACATGAGGAGGGGCTTTTGGGGG - Intergenic
1180535825 22:16392143-16392165 ACTAGGGGAGGGGATCATGCTGG + Intergenic
1181062150 22:20286651-20286673 ACCTGGGGAGGGGATGTGGGAGG + Intergenic
1182170579 22:28224666-28224688 GCTGGTGGAGGGGGTCATGGGGG + Intronic
1182806539 22:33075615-33075637 AATTGTTGAAAGGATCTTGGAGG + Intergenic
1183940323 22:41290970-41290992 ACCAGTGGAGGGGACCCTGGGGG - Intergenic
1185037438 22:48486840-48486862 ACTTTGGGAGGGTATATTGGAGG - Intergenic
949930021 3:9071294-9071316 AATAGTGGAGGGGAATTTGGGGG - Intronic
950334680 3:12183875-12183897 ACTGGTGGAGGGAAAGTTGGAGG - Intronic
955124252 3:56094495-56094517 ACCTGGGGATGGGACCTTGGGGG + Intronic
956557155 3:70536629-70536651 ACTTGTTGAGGGTTTCTTGGGGG - Intergenic
958103993 3:89049433-89049455 ACCAGGGGAGGGGATCTTTGAGG + Intergenic
961648564 3:128405869-128405891 ACATGGGGAGGGGATCCTGGTGG + Intronic
962966925 3:140364240-140364262 CCTTCTGGAGGGGACCCTGGAGG + Intronic
964231437 3:154474528-154474550 ACTTGTGGAAGGGACCTGGTGGG + Intergenic
965097091 3:164244241-164244263 GATTGTGGAGGTGATCATGGAGG + Intergenic
967693647 3:192506209-192506231 ACTTGTGGAAGAGAAGTTGGGGG + Intronic
969532057 4:7735575-7735597 ACTTCTGGTGGGGATCCTGAAGG + Intronic
970500465 4:16671786-16671808 GCTTGTGGAGGAGCTCTCGGTGG - Intronic
971365501 4:25973811-25973833 ACTTCTAGAGGGCATCTTGCAGG - Intergenic
973550648 4:52032301-52032323 TGTTGGGGAGGGGATGTTGGTGG - Intronic
974273203 4:59679604-59679626 ACTGCTGGAGTGGATCTTAGAGG + Intergenic
975058473 4:69966310-69966332 ACTTGAAGAGGGAATCTGGGTGG + Intergenic
975139337 4:70903378-70903400 ACGAGTGGAGGGGAACGTGGAGG + Intronic
976771916 4:88662288-88662310 AAGGGTGGAGGGGATCTGGGCGG + Intronic
976856100 4:89607375-89607397 ACTACTGTAGGTGATCTTGGAGG + Intergenic
977017750 4:91714481-91714503 ACTTGTGTAAGGGAACTGGGCGG + Intergenic
977627233 4:99200603-99200625 ACTTGTGGAGGGCTGCTTGGTGG + Intergenic
982207943 4:153011176-153011198 CCTTGTAGAGGGCATCTTTGGGG + Intergenic
982637214 4:157912119-157912141 ACTTGTCAAGGGTATCGTGGAGG + Intergenic
985483858 5:137869-137891 ACCTGTGGAGGGGATGGAGGTGG + Intergenic
986885907 5:12235607-12235629 ATGTGTGGAGGGGGTCCTGGTGG + Intergenic
986948160 5:13049141-13049163 TCTTGTGGGGGGGATCTGGTGGG - Intergenic
988702454 5:33688947-33688969 ACTTGAGAAGGTCATCTTGGGGG - Intronic
998221143 5:140281095-140281117 ACTTGTGTAGTGGATTGTGGTGG - Intronic
998952595 5:147406946-147406968 GCATGTGGATGGGACCTTGGAGG + Intronic
999143929 5:149380494-149380516 ACTTGTGGCCTGAATCTTGGAGG - Intronic
1002089978 5:176798656-176798678 ACTTCAGGGTGGGATCTTGGAGG - Intergenic
1003126852 6:3362653-3362675 ATTTGTAGATGGCATCTTGGGGG - Intronic
1003142542 6:3483339-3483361 ACTTGTGCAGGGGAGTGTGGAGG - Intergenic
1004775412 6:18838835-18838857 ACCTATGGAGGGGATTTTTGTGG - Intergenic
1005023595 6:21441339-21441361 AATTTTGCAGGGGATGTTGGGGG - Intergenic
1016374497 6:143406512-143406534 ATGTGTGTAGGGGATGTTGGGGG + Intergenic
1017295510 6:152789419-152789441 ACTGGTGAAGGTGATCTGGGTGG - Intergenic
1017975436 6:159353059-159353081 ACTTGCTGAGAGGCTCTTGGGGG - Intergenic
1018801725 6:167227862-167227884 ATATGTGGAGGGGATCTCAGAGG + Intergenic
1021389727 7:20077001-20077023 ACTTGTGCTGGGGATGGTGGGGG - Intergenic
1022064595 7:26838281-26838303 AGGAGTGGAGGGGGTCTTGGAGG - Intronic
1022533014 7:31078836-31078858 ACTTGTGGACGTGGGCTTGGAGG + Intronic
1023022576 7:36023539-36023561 ACTTGTGTTAGGGATTTTGGGGG + Intergenic
1023205013 7:37739641-37739663 AATTGTGGAGCGGATCTTTCAGG + Intronic
1023216202 7:37865877-37865899 ACTGATGCAGGGGCTCTTGGAGG - Intronic
1025998760 7:66545056-66545078 ACTTGGGGAGGTGATCCTGCAGG + Intergenic
1028208247 7:88041242-88041264 CCTTGGGGTGGGAATCTTGGGGG + Intronic
1029135383 7:98366780-98366802 TCTTGTAGAGAGGATCGTGGGGG - Intronic
1029978738 7:104858524-104858546 ACTTCTGGAAGGGATGTGGGAGG - Intronic
1030344878 7:108422083-108422105 ACTCGTGAAGTGGCTCTTGGAGG - Intronic
1031039029 7:116819355-116819377 ACTTGAGGAAGGGCTGTTGGTGG - Intronic
1032001464 7:128268104-128268126 ACATGTGGAGGTGATCTTTGGGG + Intergenic
1034277314 7:149829545-149829567 ACAGGTGGAGGGGATGATGGAGG - Intergenic
1034277464 7:149830030-149830052 ACAGGTGGAGGGGATGATGGAGG - Intergenic
1036589047 8:10151118-10151140 ACTTGTGGAGGGTATCAAGAAGG + Intronic
1037899414 8:22678713-22678735 ACCTGTGGTGGTGATCTGGGAGG + Intergenic
1039438999 8:37581662-37581684 ACTTGTGGCGGGGATGGGGGAGG + Intergenic
1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG + Intergenic
1040455809 8:47596106-47596128 CCTTGTGGTGGGGTTTTTGGAGG - Intronic
1040530067 8:48259989-48260011 ACCTCAGGAGAGGATCTTGGAGG + Intergenic
1040579495 8:48685673-48685695 ACTTGGGGAGGTCATCCTGGTGG + Intergenic
1040789236 8:51205770-51205792 ATTGGTGGGGGGCATCTTGGAGG + Intergenic
1042220993 8:66473963-66473985 ACCCTTGGAAGGGATCTTGGTGG - Intronic
1049291496 8:141805337-141805359 GATAGGGGAGGGGATCTTGGAGG - Intergenic
1054823958 9:69552220-69552242 ACTTGTGAAGATCATCTTGGAGG - Intronic
1056055017 9:82812785-82812807 ACTTGTGGATGGAAGCTGGGAGG + Intergenic
1057454582 9:95196755-95196777 ACTTGAGGTTGGGATCTTGAAGG - Intronic
1057781451 9:98054221-98054243 ATATGTGGAGGGGATCTCTGAGG - Intergenic
1058978595 9:110148118-110148140 ATTTGAAGAGAGGATCTTGGTGG + Intronic
1060590930 9:124816310-124816332 AATTGGGGAGGGGACCTTGGAGG + Intergenic
1186124921 X:6402735-6402757 ACTTGTGGGAGGGAACTTGTGGG - Intergenic
1192553996 X:72075873-72075895 GGATGTGGAGGGGGTCTTGGGGG + Intergenic
1195469805 X:105219229-105219251 GCTTGTGGAGGGGATATAGTGGG + Exonic
1196547811 X:116984478-116984500 AGTTGGGGAGGGGTTATTGGAGG + Intergenic
1197559610 X:128001458-128001480 TCTAGTGGAGGGGATCTTCTAGG + Intergenic
1200111983 X:153745021-153745043 ACTAGGGGAGGGGATCATGCTGG + Intergenic