ID: 1096636091

View in Genome Browser
Species Human (GRCh38)
Location 12:52960562-52960584
Sequence TTGGGGATCAGCAGCGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096636083_1096636091 16 Left 1096636083 12:52960523-52960545 CCAAGACTGAAGGAGATGAGGGA No data
Right 1096636091 12:52960562-52960584 TTGGGGATCAGCAGCGAGGATGG No data
1096636088_1096636091 -7 Left 1096636088 12:52960546-52960568 CCTAGCCTGGCATATCTTGGGGA No data
Right 1096636091 12:52960562-52960584 TTGGGGATCAGCAGCGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096636091 Original CRISPR TTGGGGATCAGCAGCGAGGA TGG Intergenic
No off target data available for this crispr