ID: 1096646147

View in Genome Browser
Species Human (GRCh38)
Location 12:53037397-53037419
Sequence CTGGCTTCACAGATGCACGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096646145_1096646147 0 Left 1096646145 12:53037374-53037396 CCTGATAATTTGATATTTTCACT 0: 1
1: 0
2: 5
3: 105
4: 2259
Right 1096646147 12:53037397-53037419 CTGGCTTCACAGATGCACGAAGG 0: 1
1: 0
2: 2
3: 20
4: 186
1096646144_1096646147 26 Left 1096646144 12:53037348-53037370 CCTGGTAGATGCGTGAGCATCTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1096646147 12:53037397-53037419 CTGGCTTCACAGATGCACGAAGG 0: 1
1: 0
2: 2
3: 20
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096646147 Original CRISPR CTGGCTTCACAGATGCACGA AGG Exonic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900822033 1:4897200-4897222 CTGGCTTCACAGAAGCAGGAGGG + Intergenic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
900890964 1:5449393-5449415 CTGGCTTTGCAGATGCAGGAAGG + Intergenic
902789207 1:18753991-18754013 CTGGCTTCACAAAAGGAGGAAGG - Intergenic
903367621 1:22814850-22814872 TTTGCTTCACAAATGCACGCCGG + Intronic
903703469 1:25267849-25267871 CTGGGTTCACAGCTGGACGTCGG - Intronic
903712736 1:25338178-25338200 CTGGGTTCACAGCTGGACGTCGG - Exonic
904442915 1:30543306-30543328 CTGGCTTCAGACCTGCACTAAGG + Intergenic
909137597 1:71820958-71820980 CTGGCATGACAGATGCAAAAAGG - Intronic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
912432984 1:109639285-109639307 CTGGGTGGACAGATGCAAGATGG + Intergenic
912554872 1:110508583-110508605 CTCGCTTCTCAGATGGACGTTGG + Intergenic
915774077 1:158463352-158463374 CTGCCTTCTCAGATGCACCATGG + Intergenic
919770931 1:201158111-201158133 CTGGCTTCAAAGATGCAGGCAGG + Intronic
920167799 1:204048028-204048050 CTGGCTGCAATGATGCAGGAGGG - Intergenic
921749230 1:218773803-218773825 CTGGCTTTAAAGATGGAAGAAGG - Intergenic
922403104 1:225281282-225281304 CTGGCTTTACAGATGGATAAAGG - Intronic
923629240 1:235639030-235639052 CTGGCTTTAAAAATGCAGGAGGG - Intronic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1068149617 10:53115407-53115429 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1068663415 10:59647286-59647308 CTTGGTTCACAGAGGCTCGAGGG + Intergenic
1068665493 10:59671065-59671087 CTGCCTTCACAGATGAGGGAGGG + Intronic
1068785147 10:60964060-60964082 CTGCCTTAACACATGCACCAAGG - Intronic
1072524288 10:96257860-96257882 CTGGCTTCACATAGGCCAGAAGG - Intronic
1073313829 10:102564070-102564092 CTGTCTTCTCAGATCCAAGAGGG + Intronic
1073673368 10:105617320-105617342 TTGGCTTCAAAGATGGAGGAAGG + Intergenic
1074156997 10:110808012-110808034 CTGCCTTCACACAGGCACCAGGG - Intronic
1075515653 10:123106044-123106066 CTGGCTTTGAAGATGCAGGATGG + Intergenic
1075787803 10:125061732-125061754 CTGGGTTCTCAGATGCACCTCGG + Intronic
1076228037 10:128796647-128796669 GTGGCTGCCCAGAGGCACGATGG - Intergenic
1076429679 10:130393028-130393050 CTGGCTACACAGATGTACTTGGG - Intergenic
1076940867 10:133607116-133607138 CTGGCTTCACATCTGCTCAATGG + Intergenic
1077242090 11:1515901-1515923 CAGCCTTCACAGAGGCACGAGGG + Intergenic
1078899252 11:15626227-15626249 CTGGCTTCAAAGTTGGAGGAAGG - Intergenic
1082229528 11:49746093-49746115 ATGGATTCACAGTTGCACGTGGG + Intergenic
1084187853 11:67484430-67484452 CTGACTTCAGAGATGCAGCATGG + Intronic
1084735781 11:71104368-71104390 TGGGCTTCAGAGATGCAGGATGG - Intronic
1085278096 11:75312778-75312800 CTGGCTTCAAAGCTGGAGGATGG + Intronic
1089167056 11:116485446-116485468 CTGGCTTCACTGATGCTACAAGG - Intergenic
1090519167 11:127460349-127460371 CTGGCTTCACAGTTGCTTCAAGG - Intergenic
1093097940 12:14993670-14993692 CTGGCTTGAGAGATGCCAGATGG + Intergenic
1093669574 12:21857713-21857735 CTGGCTTCAAAGGTGGAGGAAGG + Intronic
1093766326 12:22967397-22967419 CTGGCTTCAGAGAAGAACTAGGG + Intergenic
1094844135 12:34354047-34354069 CGGGCTTCACACATGCTCGGTGG + Intergenic
1096252341 12:50041171-50041193 AAGGCTTCACAGAGGCAGGAGGG - Intergenic
1096646147 12:53037397-53037419 CTGGCTTCACAGATGCACGAAGG + Exonic
1096995610 12:55836135-55836157 CTGGTTTCCCAGATGCATAAAGG + Intronic
1099885760 12:88528199-88528221 CTGGCTTCAAAGATGGAAGAGGG - Intronic
1101053164 12:100885044-100885066 CTGGCTTCAAACATGAAAGAGGG - Intronic
1103731688 12:123032087-123032109 CTGGCTGCACAGCTGCAGGAAGG + Intronic
1104074783 12:125379365-125379387 CTGGCTTTGAAGATGCAGGAAGG + Intronic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1109266057 13:60201615-60201637 CTGGCTTTAGAGATGGAGGAAGG - Intergenic
1111313034 13:86514772-86514794 CTGGCTTCACAGATTCTTTACGG + Intergenic
1112267588 13:97939314-97939336 CTGCATGCACAGATGCACCAGGG - Intergenic
1112959753 13:105108948-105108970 CTGTCTTGACAGATGCATAATGG + Intergenic
1113314513 13:109164081-109164103 CTGACTTCACAGGTGCACCTGGG - Intronic
1115174227 14:30544175-30544197 CTGGCTTTAAAGATGAAAGAAGG + Intergenic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1119263188 14:73250269-73250291 CAGGCATCACAGATGCCCTATGG + Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1120252087 14:82070175-82070197 CTGGCTTCGAAGATGGAGGAAGG + Intergenic
1121704654 14:95982384-95982406 CTGCCTTCACGGATTCACGGTGG - Intergenic
1122048734 14:99041161-99041183 CGGCCTCCACAGATGCATGAAGG - Intergenic
1122239616 14:100353924-100353946 CTGTGTTTTCAGATGCACGATGG - Intronic
1123690232 15:22832648-22832670 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
1128128097 15:65207596-65207618 CTGGCTTCAGAGATCCACTTCGG + Intronic
1128321893 15:66700632-66700654 CGTGCTTCACAGAACCACGAAGG - Intergenic
1128349881 15:66881617-66881639 CTGGCCTCTCAGATGCCCCAAGG - Intergenic
1129740519 15:77987517-77987539 ATGGCTTCCCAGAGGCACCAGGG - Intronic
1130135656 15:81179694-81179716 CTGACTTTAAAGATGCAGGAAGG - Intronic
1131621649 15:94074156-94074178 CTGGTTTGACAGAGGCATGAGGG + Intergenic
1133573783 16:7067983-7068005 CTGGCTTTAAAGATGAAGGAAGG - Intronic
1134012227 16:10863384-10863406 CTGGCTTCAGAGATGAAGGAAGG - Intergenic
1134600514 16:15530072-15530094 CTGGCTTCGGAGATGGAGGAGGG - Intronic
1138840146 16:60491751-60491773 CTGGCTTCTCTGATGCAGAAGGG + Intergenic
1140809037 16:78559274-78559296 CTGGCTTCAGGGAAGAACGATGG + Intronic
1141235656 16:82213565-82213587 CTGGCTTCAAAGATGGAGGAGGG + Intergenic
1144515519 17:15915193-15915215 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
1146257635 17:31400792-31400814 CTGGCTCCACAGCTGCACTCAGG - Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1148027784 17:44600335-44600357 CTGGCTTCCCAGAGGCTGGAGGG + Intergenic
1150640233 17:66944703-66944725 CTGACTTCACAGCTTCCCGAAGG - Intergenic
1151892716 17:76960161-76960183 CTGGCTCTAAAGATGCAGGAAGG - Intergenic
1152172582 17:78762757-78762779 CTGGCTTTGAAGATGCAGGAAGG + Intronic
1152517514 17:80834474-80834496 CTGGTTTCACTGATGCACAGAGG - Intronic
1153167349 18:2277797-2277819 CTGGCTTCAAAGCTGAAAGAAGG - Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1153668094 18:7384268-7384290 CTGCCCTCATAGTTGCACGATGG - Intergenic
1156495301 18:37521627-37521649 ATGTCATCACAGATGCACCACGG + Intronic
1159840668 18:73394949-73394971 CTGGCTTTACAGATGGATGAAGG - Intergenic
1161157281 19:2739218-2739240 CTGGCTGAACACATGGACGAGGG + Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1163037911 19:14582112-14582134 CTGGCTTTGAAGATGCAAGAAGG - Intergenic
1165529094 19:36381373-36381395 CTGACTTCACTGAGGTACGATGG + Intergenic
1167289388 19:48615998-48616020 CTGGCCTCCCAGATCCAGGAGGG + Intronic
1168360118 19:55732484-55732506 TTGGATACACAGATGCATGAAGG + Exonic
1168613778 19:57821465-57821487 CTGGCTTCAGAGATTCTCCAGGG - Intronic
1168617765 19:57852170-57852192 CTGGCTTCAGAGATTCTCCAGGG - Intronic
933079844 2:77972259-77972281 ATGGCTTCACAGATGAAAAATGG - Intergenic
934034079 2:88074338-88074360 CTGGCTTTAAAGATTCAGGAAGG - Intronic
934609627 2:95725224-95725246 CTGGATTCAAAGAAGCAAGAAGG + Intergenic
935679612 2:105624653-105624675 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
935689967 2:105722174-105722196 CTGACTTCAAAGACGAACGAAGG - Intergenic
936411672 2:112263795-112263817 CTGTCTTCACAGCTGCAACAAGG + Intergenic
936542943 2:113366790-113366812 CTGGATTCAAAGAAGCAAGAAGG + Intergenic
942087234 2:172454836-172454858 CTGGCTTTACAGATGAAAGAAGG + Intronic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
946502405 2:220263507-220263529 CTGGCTTCCCAGCTGCCAGATGG + Intergenic
947076748 2:226353302-226353324 CTGGGCTCACAAATGCACAAGGG - Intergenic
947479025 2:230480601-230480623 CTGGCTTCACAGATGAGGTAGGG + Intronic
947950351 2:234141790-234141812 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
1169112355 20:3042403-3042425 CTTTCTTCAAAGATGCACCAAGG - Intergenic
1169133421 20:3180425-3180447 CTGGCTTTGCAGATGGAAGAAGG + Intergenic
1169140827 20:3226722-3226744 CTGGCTTGACACATGCCCCATGG - Intergenic
1174433538 20:50488983-50489005 CTGGCTTTAAAGATGAAGGATGG - Intergenic
1175774228 20:61642820-61642842 CTGGCTTCAGAGATGGGGGAAGG - Intronic
1176185358 20:63775491-63775513 CTGGCCTCTCAGGTGCACGGGGG - Intronic
1176447275 21:6831171-6831193 TTGGCTTCTCAGCTGCAGGAGGG - Intergenic
1176825443 21:13696197-13696219 TTGGCTTCTCAGCTGCAGGAGGG - Intergenic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1179169462 21:38961804-38961826 CTGCCTTTAAAGATGGACGAAGG - Intergenic
1179240090 21:39582197-39582219 CTGGCTTTGAAGATGCAGGAGGG + Intronic
1180172471 21:46066982-46067004 CTGGCTTCTCACTTCCACGAAGG - Intergenic
1181000471 22:19985703-19985725 CGGACTTCACAGATGCACCACGG + Intronic
1182109814 22:27715195-27715217 CTGCCTTCCCAGCTGGACGAGGG - Intergenic
1184118609 22:42436364-42436386 CTGGCTTCACTGAGGCAAAAAGG + Intergenic
950838335 3:15942116-15942138 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
957874324 3:86125787-86125809 GTGGATTCACAGATACACAAAGG + Intergenic
960743981 3:120865957-120865979 CTGGCTTTGAAGATGCAAGAAGG + Intergenic
961372367 3:126439543-126439565 CTGGCTTCACAGCTGCAGGCTGG - Intronic
962392152 3:134981660-134981682 GTGGGTGCACAGATGCACGCAGG - Intronic
965106663 3:164364278-164364300 CTGTCATCTCACATGCACGAAGG - Intergenic
966482058 3:180421408-180421430 CTGGCTTCAAAGATGGAGTAAGG + Intergenic
967000231 3:185327177-185327199 CTGGCTTCGAAGATGGAGGAAGG - Intronic
968444983 4:647698-647720 AGGGCTTCACAGATGCATGGGGG + Intronic
969938822 4:10709898-10709920 CTGACATCACTGATGCAGGAGGG + Intergenic
970420494 4:15901509-15901531 CTGGCTTTAAAGATGGAAGATGG - Intergenic
970527934 4:16951248-16951270 CTGGCTTTGAAGATGCAGGAAGG + Intergenic
970554560 4:17218122-17218144 CTGGCTTTAAAGATGAAGGATGG - Intergenic
970573029 4:17401241-17401263 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
972464576 4:39342861-39342883 CTGGCTTTGAAGATGCAGGAAGG - Intronic
972761902 4:42114707-42114729 CTGGCTACACAGAGGCCCAATGG + Exonic
974093292 4:57335002-57335024 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
980100911 4:128540359-128540381 CTGGCTTTAAAGATGCAGGAAGG - Intergenic
980424248 4:132605960-132605982 CTGGCTTTACAAATGAAAGAAGG + Intergenic
985525921 5:401581-401603 CTGGCTTCACAGCTTCACCCTGG - Intronic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
989121015 5:38004413-38004435 CTGGGATCACAGATCCCCGAAGG - Intergenic
989514263 5:42323366-42323388 CTGGCTTTGAAGATGCACAAAGG + Intergenic
993433494 5:87861922-87861944 CTGGCTTCAAAAATGGAGGAAGG - Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
1000418028 5:161005020-161005042 GTAGCTTCACAGATGTACGGTGG + Intergenic
1000976899 5:167774879-167774901 CTGTCTTAACAGATGCACTGGGG - Intronic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1006411315 6:33875546-33875568 CTGGCTTCCCAGAGGGCCGAGGG + Intergenic
1007655787 6:43450302-43450324 CTGGCGTTCCAGATGCAAGAGGG - Exonic
1009443912 6:63716737-63716759 CTGGCTTCAAATATGGAGGAAGG - Intronic
1009493180 6:64316999-64317021 CTGGCTGCCCATATGCAGGAAGG + Intronic
1011155379 6:84324338-84324360 CTGGCTTCACATATTCTGGATGG + Intergenic
1011690848 6:89867124-89867146 CTGGCTTCAAAGTTGCATGCTGG - Exonic
1012992088 6:105936266-105936288 ATTTCTTCACAGATGCATGAAGG + Intergenic
1013943419 6:115693255-115693277 ATGGCTTCAAAGATGGAGGAAGG - Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1019865496 7:3706272-3706294 CTGGCTTCACAGATGAGTTAGGG + Intronic
1021301734 7:18981597-18981619 CTGGCTTTAAAGATGGAAGAAGG - Intronic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1022488115 7:30795804-30795826 CTGGCTTCAAAGGTGAAGGAAGG - Intronic
1026423168 7:70261336-70261358 CTGGCTACAGAGTTGCATGAGGG + Intronic
1027746874 7:82086452-82086474 CTAGTATCTCAGATGCACGATGG - Intronic
1028032657 7:85935549-85935571 CTGACTTCAAAGATGGAAGAAGG - Intergenic
1028481505 7:91311318-91311340 CTGGCTTTAAAGATGCATGATGG + Intergenic
1028843658 7:95455383-95455405 CTGGCTTTGAAGATGGACGAAGG - Intergenic
1029610707 7:101625207-101625229 CTGACATCACAGAGGCAGGAAGG - Intronic
1030507553 7:110443918-110443940 CTGGATTCAAAGATGCAGGAGGG - Intergenic
1032072811 7:128819282-128819304 CTGGCTGCACAGGTGCATGTTGG - Intronic
1032695037 7:134328181-134328203 TTGCCTTCACAGAGGCACGCTGG - Intergenic
1033619296 7:143048131-143048153 CTGGCTTTGAAGATGGACGAGGG + Intergenic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1039234670 8:35488777-35488799 CTGGTTTCACAGATTGGCGATGG + Intronic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040110227 8:43563965-43563987 CTGGCTCCACGGGTGCACGTTGG - Intergenic
1040565794 8:48565573-48565595 GTGGCCGCACAGATGCAGGAGGG + Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1047902274 8:129436321-129436343 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1049334373 8:142075016-142075038 CTGGGTTCCCAGCTGCACGTGGG - Intergenic
1050810187 9:9735731-9735753 CTGGCTTCAAAGATGTAAAACGG + Intronic
1051157037 9:14159564-14159586 CTGCCTGCAGAGATGCATGAAGG - Intronic
1051741747 9:20259084-20259106 CTGGCTTCCAAGATGGAGGAAGG + Intergenic
1053598280 9:39585442-39585464 CTGGCTTCTGAGATGCCCCAGGG - Intergenic
1058091654 9:100812739-100812761 CTGGCTTCAAAGATGAAGGGAGG + Intergenic
1059466486 9:114471924-114471946 ATTGCTTCACAGCTGCAAGATGG - Intronic
1061615943 9:131779007-131779029 CTGGCTTCAGAGATGGAAGAAGG + Intergenic
1203521915 Un_GL000213v1:53360-53382 TTGGCTTCTCAGCTGCAGGAGGG + Intergenic
1185540167 X:897020-897042 CTGGCTTCGAAGATGGAGGAAGG - Intergenic
1186169813 X:6864724-6864746 CTGGCTTCAAAGATGGAAGGAGG - Intergenic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1188401222 X:29747253-29747275 CTGGCTTCAGAAATTCACAATGG - Intronic
1192791324 X:74384224-74384246 CAGGCTCCACATATGCAGGAAGG + Intergenic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1198057336 X:133008057-133008079 CTGGCTTCAAATATGGAGGATGG - Intergenic
1199696985 X:150349553-150349575 CTGGCATCAGAGATGCCCAAGGG + Intergenic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1200291330 X:154877406-154877428 CTGGCTTCGAAGATGGAGGAAGG + Intronic
1201560159 Y:15307294-15307316 CTGGCTTCAAAGATAGAAGAAGG - Intergenic