ID: 1096648760

View in Genome Browser
Species Human (GRCh38)
Location 12:53051841-53051863
Sequence TTTCCTAGGCTGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096648760_1096648765 -2 Left 1096648760 12:53051841-53051863 CCCTCCACCTTCAGCCTAGGAAA 0: 1
1: 0
2: 2
3: 26
4: 328
Right 1096648765 12:53051862-53051884 AAGCTGAGCCTCATAGCTTCCGG 0: 1
1: 0
2: 2
3: 12
4: 154
1096648760_1096648767 5 Left 1096648760 12:53051841-53051863 CCCTCCACCTTCAGCCTAGGAAA 0: 1
1: 0
2: 2
3: 26
4: 328
Right 1096648767 12:53051869-53051891 GCCTCATAGCTTCCGGGAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 68
1096648760_1096648769 13 Left 1096648760 12:53051841-53051863 CCCTCCACCTTCAGCCTAGGAAA 0: 1
1: 0
2: 2
3: 26
4: 328
Right 1096648769 12:53051877-53051899 GCTTCCGGGAGAAGGTTTTCCGG 0: 1
1: 0
2: 0
3: 6
4: 118
1096648760_1096648766 -1 Left 1096648760 12:53051841-53051863 CCCTCCACCTTCAGCCTAGGAAA 0: 1
1: 0
2: 2
3: 26
4: 328
Right 1096648766 12:53051863-53051885 AGCTGAGCCTCATAGCTTCCGGG 0: 1
1: 0
2: 0
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096648760 Original CRISPR TTTCCTAGGCTGAAGGTGGA GGG (reversed) Exonic
900960271 1:5914764-5914786 CTTCCTAGGCTGAAGGGAGCAGG + Intronic
901301002 1:8200181-8200203 TTTGCTAGGCGGAAAATGGAAGG + Intergenic
902229888 1:15021350-15021372 TTCCCTAGGTTGAAGCGGGAGGG - Intronic
903322910 1:22553315-22553337 TTTCCTAGGCTGCTGGTGACAGG - Intergenic
904224275 1:29001928-29001950 TTGCCTGGGCTGAATGTGGTAGG + Intronic
904805431 1:33128119-33128141 TTTGGGAGGCCGAAGGTGGAAGG + Intergenic
905503985 1:38462050-38462072 CTTACTAGGCAGAAGATGGAAGG - Intergenic
905546940 1:38807557-38807579 TCTCCTAGGCTGGAGGTTGGTGG - Intergenic
905976736 1:42180991-42181013 TGTCCTTTGCTGAAGGGGGAAGG - Intronic
907644817 1:56231747-56231769 TTACCTAGCCTGAGGGTGGAAGG + Intergenic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
910721142 1:90287412-90287434 TCTTCCAGGCTGAAAGTGGAAGG - Intergenic
911530284 1:99036221-99036243 TTTTACAGGCTCAAGGTGGAAGG - Intergenic
911728203 1:101264693-101264715 TTTTCTAGGCTCAAAATGGATGG - Intergenic
913142394 1:115954487-115954509 GTTACTTAGCTGAAGGTGGAGGG - Intergenic
914213942 1:145607816-145607838 TTTCTGAGGCTGAAGGAGGTAGG - Intergenic
914465887 1:147928219-147928241 TTTCTGAGGCTGAAGGAGGTAGG - Intergenic
914504878 1:148280599-148280621 TTTCCAAGCCCGAAGGTGGGTGG - Intergenic
915836757 1:159183002-159183024 TTTTCCAGGCTGAATGAGGAGGG - Intronic
917773297 1:178304279-178304301 TTTGGGAGGCTGAAGCTGGAGGG + Intronic
918199081 1:182249941-182249963 TTTCCTAGGTTGGAGAGGGATGG + Intergenic
919270182 1:195331533-195331555 TTCCCTTGGGAGAAGGTGGAAGG - Intergenic
920334445 1:205235189-205235211 TTACCTAGGCTGGAGGGGGTGGG - Intronic
920666766 1:207968617-207968639 TTTGGGAGGCTGAAGCTGGAGGG + Intergenic
921664050 1:217845367-217845389 CTTTCTAGGCTCCAGGTGGAAGG + Intronic
921919325 1:220648596-220648618 TTTCAAAGGCTGATGGTGAATGG - Intronic
922399720 1:225239406-225239428 TTCCCTTGGCTGGGGGTGGAAGG + Intronic
922421652 1:225464531-225464553 TTGCCTAGGCTGAAGTGGAATGG - Intergenic
922564357 1:226591838-226591860 TTTCCTAGGCTGAAAGAGTGAGG + Intronic
923853228 1:237819574-237819596 TTTGGGAGGCTGAAGGGGGATGG + Intronic
1062863728 10:831533-831555 TTTCCCAGGCTGAAGATGTGGGG - Intronic
1063589451 10:7381841-7381863 TTTCCAAGGGTGAAGATGAAGGG + Exonic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1068938344 10:62657549-62657571 TTTCCTAGCCTGCAGGGGCAAGG - Intronic
1068994819 10:63190692-63190714 TTTCCAAGGTGAAAGGTGGAGGG - Intronic
1069403170 10:68070942-68070964 TGTCCTAGGCTCAAAGTGCATGG + Intronic
1069485640 10:68821113-68821135 TTTCCTAGGCTGGAGCTGTCTGG + Intergenic
1069639377 10:69945019-69945041 TGTCCGAGGGTGAGGGTGGAGGG + Intronic
1069769941 10:70891801-70891823 TTTCCTAGGCAGATGGGGGTGGG - Intergenic
1069775433 10:70924468-70924490 CTGCCTGGGTTGAAGGTGGATGG - Intergenic
1069858766 10:71457138-71457160 TTTGATAGGCTGAAGCTGGAGGG + Intronic
1070939808 10:80334590-80334612 ATCCCATGGCTGAAGGTGGAAGG + Intergenic
1071939036 10:90567156-90567178 TTTCATAGACTGAAAGTGAAGGG - Intergenic
1072276700 10:93830244-93830266 TTCCCCAGGCTAAAGGTGCATGG + Intergenic
1074319376 10:112387503-112387525 TTTCCTAGGTTGAGGGTGGCAGG + Intronic
1074462506 10:113651248-113651270 TTTCCTTGCTTGGAGGTGGAGGG - Intronic
1075058550 10:119238249-119238271 TTTCCTGGGTGGAGGGTGGACGG + Intronic
1076662885 10:132067261-132067283 TCTCCAAGGCTGAGGGTGGGGGG + Intergenic
1076990771 11:272418-272440 TCTCCAAGGCCGCAGGTGGAAGG - Intergenic
1078200105 11:9173595-9173617 TTTGGTAAGCTGAAGGGGGAGGG - Intronic
1079074652 11:17376703-17376725 TTTCCTAGCCTGAGGGTGTGAGG - Exonic
1081828839 11:46087998-46088020 TTTGGGAGGCTGAAGGTGGATGG - Intronic
1082108084 11:48242538-48242560 TTTCCAAGCCTGAGGGTGCAGGG + Intergenic
1082690159 11:56292367-56292389 TTTCCAAGGATAAAGGTGCAAGG + Intergenic
1082959241 11:58903160-58903182 ATTCCTAGGCTCAAGGAGCAGGG + Intronic
1082965883 11:58965828-58965850 ATTCCTAGGCTCAAGGAGCAGGG + Intronic
1083504995 11:63148399-63148421 TTTCCACTGCAGAAGGTGGAGGG + Intronic
1084133075 11:67152372-67152394 TTTGCGAGGCTGAGGTTGGAGGG + Intronic
1087477310 11:98652257-98652279 TTTTCTAGGATTAAAGTGGAAGG + Intergenic
1089100093 11:115955720-115955742 TTTCTTAGGGAGAAGGAGGAGGG - Intergenic
1089107901 11:116029947-116029969 ATTCCATGGCAGAAGGTGGAAGG - Intergenic
1089142166 11:116294232-116294254 TTACCTAGGCAGAAGATAGATGG + Intergenic
1090220260 11:125015184-125015206 TTTCCCAAGCTTAAGATGGAAGG - Intronic
1090263431 11:125339109-125339131 TTTCCAAGGCTGGAGGTTGAAGG + Intronic
1090364169 11:126192429-126192451 TTTCCTAGGCTGGAGAAGTAGGG + Intergenic
1090365437 11:126201425-126201447 TTTACTAGGCTGAAGGTATCTGG - Intergenic
1090581933 11:128170186-128170208 TTTACTAGGCAGAAAATGGAGGG + Intergenic
1091893864 12:4084571-4084593 TGTCCCAGCCTGGAGGTGGAAGG - Intergenic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1093517531 12:20007188-20007210 TTTCCAGGGCTGCAGGTTGAAGG - Intergenic
1095727474 12:45469373-45469395 ATTCCTAGGCGGAAGGGGGAAGG + Intergenic
1095976929 12:47946424-47946446 TCTCCCAAGGTGAAGGTGGAGGG + Intergenic
1096059501 12:48684734-48684756 TTGCCCAGGCTGGAGGTAGATGG + Intergenic
1096237930 12:49942494-49942516 ATGCCCAGGCTGAGGGTGGAGGG - Intergenic
1096355541 12:50938071-50938093 TTTCCTAGGCTGGAAGGGGCAGG - Intergenic
1096648760 12:53051841-53051863 TTTCCTAGGCTGAAGGTGGAGGG - Exonic
1096732265 12:53623696-53623718 TTTCCTAGGCTACAGTGGGAGGG - Intronic
1097237312 12:57549370-57549392 TGTCCTAGGCTGAGGATGGGAGG - Intergenic
1099513775 12:83570393-83570415 TTTCCATGGCAGAAAGTGGAAGG + Intergenic
1099846516 12:88034695-88034717 GTTCCTAGCCTGAAGTTGTAGGG - Intronic
1102705991 12:114880980-114881002 TTTCCTGGGATGAAGCTGGATGG - Intergenic
1102752734 12:115309785-115309807 TATCAGAGGCTGCAGGTGGATGG - Intergenic
1103013803 12:117478540-117478562 CTTCATAGGCTGAAGATGGGAGG - Intronic
1103116236 12:118335142-118335164 TTGCCCAGGCTGAAGTGGGATGG - Intronic
1103763187 12:123265810-123265832 TTTCCCAGGATGCAGATGGATGG + Intronic
1104423722 12:128657841-128657863 TTTCCTGGGATGAAGTTGGATGG + Intronic
1105742730 13:23345369-23345391 ACTGCTAGGCTGGAGGTGGAGGG - Intronic
1105821375 13:24084013-24084035 TTGCCTATTCTGAAAGTGGAAGG + Intronic
1106883930 13:34162178-34162200 CTTCCTAGTTTGAAGGAGGAGGG - Intergenic
1109361279 13:61298404-61298426 TTCCCTTGGCTGGGGGTGGATGG - Intergenic
1109571088 13:64191317-64191339 TTTGGGAGGCTGAGGGTGGAGGG + Intergenic
1110917233 13:81036661-81036683 TTTCCATAGCTGAAAGTGGAGGG - Intergenic
1110928139 13:81181797-81181819 TCTCCTTGGTTGAAGGGGGAAGG + Intergenic
1111751382 13:92335419-92335441 TTTCCTAGGACTATGGTGGAAGG + Intronic
1114271344 14:21102171-21102193 CTTCCTAGGCTGAGGGTTGTAGG - Intronic
1114807054 14:25849712-25849734 TTTCTTACTTTGAAGGTGGATGG + Intergenic
1115513424 14:34160594-34160616 TGTCCTAGGATCAAGGAGGAGGG + Intronic
1116402577 14:44526641-44526663 ATCCCTAGGCTGAAAGGGGAAGG - Intergenic
1117661630 14:58012136-58012158 TTTCCTAGTGAGAAGCTGGATGG - Exonic
1118825029 14:69372175-69372197 TTGTCTAGGCAGAAGGTGGCTGG + Intergenic
1119611494 14:76066887-76066909 TCTCCAAGGCTGGTGGTGGAAGG - Intronic
1119696762 14:76719573-76719595 TTTCCTGGGCTGGTGTTGGAGGG + Intergenic
1119883082 14:78116931-78116953 TTCTCTTGGCTGAAGGTGGGTGG + Intergenic
1120502768 14:85317563-85317585 ATTCCATGGCTAAAGGTGGAAGG + Intergenic
1121420984 14:93814069-93814091 ATTCCATGGCAGAAGGTGGAAGG + Intergenic
1121743164 14:96268022-96268044 TTTCCTAGACTGTATGTGAAGGG - Intronic
1122371128 14:101229617-101229639 TGTCCTTGCCTCAAGGTGGAGGG - Intergenic
1123519624 15:21059974-21059996 TTTCCCAGGCTGAAGGTCAGTGG + Intergenic
1124373606 15:29116929-29116951 TCTCCTAGAGTGAAGGAGGAAGG - Intronic
1125546889 15:40512461-40512483 GATCCTGGGCTGATGGTGGATGG - Intergenic
1126188444 15:45853790-45853812 TTTCTTAGGTTGGAGGTGGTAGG + Intergenic
1126546740 15:49882139-49882161 TTTCCTGGGCTGAAGGGAGAAGG - Intronic
1126815092 15:52446628-52446650 TTTTCTAGGCTGAAGGTGCAAGG - Intronic
1126897209 15:53271872-53271894 TTTGCTAGGTTGATGGTAGAGGG + Intergenic
1127502124 15:59563607-59563629 TCTCCTAGGCTGGACGTGGTGGG - Intergenic
1129758451 15:78112663-78112685 TGTCCTAGGCTGCTGGTGAATGG + Intronic
1131076013 15:89495448-89495470 TTTCATTGGCTGATGGCGGATGG + Intronic
1131900050 15:97077918-97077940 TTTCCTGGGCAGAAGGTGGGTGG - Intergenic
1133401816 16:5493499-5493521 TTTGCTAGGCTGATGGAGGCAGG - Intergenic
1133845339 16:9448263-9448285 GATCCTAGGGTGAAGCTGGAGGG + Intergenic
1135572134 16:23557545-23557567 TTTCCCAAGCTGAAGGGGGCGGG - Exonic
1138481343 16:57305385-57305407 TTTTCTTGGCTGAGGGTGGAGGG + Intergenic
1139308750 16:66010577-66010599 TTATCTAGGAGGAAGGTGGAGGG - Intergenic
1139838522 16:69859723-69859745 TTTCCTGGCTCGAAGGTGGAGGG - Intronic
1141775013 16:86117289-86117311 TTTCCTGGGAGGAGGGTGGAAGG + Intergenic
1145743954 17:27299266-27299288 TTTGGGAGGCTGAAGGTGGGAGG + Intronic
1145768080 17:27472949-27472971 TTTCCTAGGCTGGAGTTCCATGG + Intronic
1146464780 17:33077746-33077768 TTTTCAAGCCTGAAGGAGGAGGG + Intronic
1146516813 17:33495884-33495906 TTTGCTTGGCTGAAGGCAGATGG + Intronic
1148810503 17:50287628-50287650 TTTCGGAGGCTGAAGCAGGAGGG + Intergenic
1149340672 17:55682940-55682962 AACCCTAGGCTGAAGGTGTAGGG + Intergenic
1149515242 17:57276129-57276151 TTTCTAAGGCTGAAGGAGGAGGG + Intronic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1150918092 17:69456717-69456739 TTAACTAGGATGAAGGAGGAAGG - Intronic
1151526240 17:74670899-74670921 TTTCCTAGGGAGAAGGTCCAGGG - Intronic
1152891508 17:82884224-82884246 TTTCCTTTCCTGAAGGTGGGGGG + Intronic
1153938510 18:9954045-9954067 TTTTCTAGGATGAAGGTTTAAGG + Exonic
1154396523 18:13995674-13995696 TTTCCTCAGCTGAATCTGGAGGG + Intergenic
1155988759 18:32257579-32257601 TCTCCTAGGCAGATGGAGGAAGG - Intronic
1156033157 18:32736774-32736796 TTACCTAGGCAAAAGGTAGATGG - Intronic
1156465735 18:37347010-37347032 ATGCCAAGGCTGAAGGGGGAGGG + Intronic
1157950799 18:52034876-52034898 TTTCCTAGGTTTGATGTGGAAGG - Intergenic
1158439502 18:57462034-57462056 TCTCCTAGGCTGCTGGTGGGAGG - Intronic
1160033976 18:75284730-75284752 TTTCCAAGCCTGAGTGTGGACGG + Intronic
1160145493 18:76360360-76360382 TTTTCTTGGCTGAAAGTGAATGG - Exonic
1160841499 19:1148697-1148719 TTTTCTGGGGTGAAGGAGGATGG - Intronic
1163004396 19:14388568-14388590 TTCCCTGGGCTGAAGGGGGCTGG - Intronic
1163063067 19:14774166-14774188 TTCCCTGGGCTGAAGGGGGCTGG + Intronic
1164693081 19:30225536-30225558 TTTCCGGGGCTGAGGGGGGACGG - Intergenic
1164993365 19:32700670-32700692 TTTGGGAGGCTGAAGCTGGACGG - Intronic
1165402994 19:35613650-35613672 ATTCCTAGGGTGATGGTGGTAGG - Intronic
1165738530 19:38192588-38192610 TATCCTGGGCTGGAGGAGGAGGG - Intronic
1165985523 19:39765598-39765620 TTTCCAAGGCTGGAAATGGATGG + Intergenic
1166603943 19:44123501-44123523 TTTCCTAGGATGAATTAGGAAGG + Intronic
1168107232 19:54172575-54172597 TTTCCTGGTCTGAGGGAGGAGGG - Intronic
1168545105 19:57243783-57243805 TGTACCAGGCTGAAGGAGGAAGG - Intronic
927458992 2:23281421-23281443 TCTCCTAGCCTGAAGGAAGAGGG - Intergenic
928017827 2:27674945-27674967 TTTGGGAGGCTGAAGGGGGATGG - Intronic
928361999 2:30671069-30671091 TTTCCCTGGCTGAAGGTAAAAGG - Intergenic
928908090 2:36389691-36389713 TCTGCCAGCCTGAAGGTGGAAGG - Intronic
930317596 2:49816561-49816583 TTTCCATGGATGAAGGTGGTGGG + Intergenic
930480685 2:51944430-51944452 TTTTGCAGGCTGTAGGTGGAAGG + Intergenic
931541259 2:63331680-63331702 TTTCAAAGCCTGAAGGTGGGTGG - Intronic
931544494 2:63366786-63366808 TTTCATAGTATGAAGGTGAAAGG + Intronic
931860245 2:66346838-66346860 TTTTCTACACTGAAGATGGAAGG + Intergenic
932595354 2:73089793-73089815 TTTCCTGGGCTCACGGTGGCTGG - Intronic
935128388 2:100243262-100243284 TGTCCAAGGCTGAAGGTGTGAGG - Intergenic
935482549 2:103611277-103611299 TTTCCTGGGCTTGAGATGGAGGG + Intergenic
936116041 2:109704020-109704042 CTACCTAGGCTGAGGGTGGTGGG + Intergenic
936850617 2:116893519-116893541 TTTCCTAGGCTAAACCTGGGAGG + Intergenic
936971010 2:118176121-118176143 TTGCCTAGTCTGAAAGGGGAAGG - Intergenic
937332305 2:121039091-121039113 CTTCCCAGGCTGTAGGAGGAAGG - Intergenic
938011255 2:127830854-127830876 TTGCCCAGGCTGAGGCTGGAGGG + Intergenic
938952767 2:136270861-136270883 ATACATAGGCTGAAAGTGGAGGG + Intergenic
939063523 2:137453768-137453790 TATCCGAGGCTGGAAGTGGAGGG - Intronic
939385210 2:141487117-141487139 TTTCCCAGGCAAAAGGTGGAGGG - Intronic
939570278 2:143832479-143832501 TTTGCTGGGGTGAAGGAGGAGGG + Intergenic
939629105 2:144513586-144513608 TTTCAGAGGCTGATGCTGGAAGG + Intronic
942758184 2:179366232-179366254 TTTCCTACACTGAAAGTGGTTGG + Intergenic
944636809 2:201682577-201682599 TTCCCGTGGCTGAAGGAGGAAGG + Intronic
947250174 2:228093919-228093941 TTGCCTAGGCCTAAGGAGGATGG + Intronic
948564164 2:238873022-238873044 TCTCCTTGGCTGGATGTGGATGG - Intronic
948748027 2:240109960-240109982 TTTCGTAGGCTGTAGATGAAGGG - Intergenic
949032897 2:241805327-241805349 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949032994 2:241805557-241805579 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033010 2:241805596-241805618 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033041 2:241805670-241805692 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033057 2:241805709-241805731 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033087 2:241805783-241805805 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033103 2:241805822-241805844 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033119 2:241805861-241805883 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033135 2:241805900-241805922 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033177 2:241806003-241806025 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033255 2:241806190-241806212 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033269 2:241806225-241806247 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033301 2:241806303-241806325 TTCCCTGGGCTGAGGGGGGAGGG - Intergenic
949033396 2:241806533-241806555 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033442 2:241806646-241806668 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033458 2:241806685-241806707 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033488 2:241806759-241806781 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033552 2:241806915-241806937 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033582 2:241806989-241807011 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033596 2:241807024-241807046 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033612 2:241807063-241807085 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033628 2:241807102-241807124 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033659 2:241807180-241807202 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033675 2:241807219-241807241 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033690 2:241807258-241807280 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949033719 2:241807336-241807358 GTTCCTGGGCTGAGGGGGGAGGG - Intergenic
949034029 2:241808100-241808122 TTTCCTGGGCTGAGGGGGGAGGG - Intergenic
1169377176 20:5075479-5075501 TTTGGGAGGCTGAGGGTGGATGG + Intronic
1169846226 20:9994905-9994927 ATTCCTTGGCAGAAGGTAGAAGG + Intronic
1170552255 20:17488181-17488203 TTTCCCAACATGAAGGTGGAAGG + Intergenic
1170759036 20:19233347-19233369 TTTCCTTGGCTCAAGATGCAAGG - Intronic
1171954334 20:31448749-31448771 TTGCCTAGGCTGAAGTGCGATGG + Intronic
1172534648 20:35664177-35664199 CTTCGTGGCCTGAAGGTGGAGGG - Intronic
1173660999 20:44733647-44733669 TTTCCTAGGCAGAAAGTCGAGGG - Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175869305 20:62200601-62200623 TCTCCCAGGCTCGAGGTGGAAGG + Intronic
1176214870 20:63943220-63943242 TTTCCCTGGTTGCAGGTGGAGGG - Intronic
1176728532 21:10465763-10465785 TTTTCTAGGGAGGAGGTGGAGGG + Intergenic
1180711014 22:17839604-17839626 TTGCCTAGGCTGGAGTTTGATGG + Intronic
1181471526 22:23143181-23143203 TTTGGGAGGCTGAAGGGGGAGGG + Intronic
1181964161 22:26645123-26645145 TTCCTCAGGCTGCAGGTGGAGGG - Intergenic
1182269092 22:29142241-29142263 CTTCCTAGTCTGTAGGAGGAGGG - Intronic
1184298407 22:43540708-43540730 TTCCCTGGGATGAAGGTGGGTGG - Intronic
1184456941 22:44616225-44616247 TGTCCGAGACTGGAGGTGGAGGG - Intergenic
1184943450 22:47784749-47784771 TTTCCCAAGCAGATGGTGGAAGG + Intergenic
951699880 3:25485545-25485567 TTTCCAAGTCTGAAGGTAGTGGG - Intronic
952032035 3:29154908-29154930 TTTCCTAGGGAGAATGTGGTTGG + Intergenic
953079421 3:39601700-39601722 TTTCCTGGGCTCATGGTGGCAGG - Intergenic
953213775 3:40898689-40898711 GGTCTCAGGCTGAAGGTGGAAGG + Intergenic
954292891 3:49659029-49659051 TTTCCTGGGCAGAATGTGGGAGG + Intronic
954398168 3:50303784-50303806 TTACCTAGGCTGGAGGAGGTGGG + Intronic
955611705 3:60764395-60764417 TTTCCTCAGCTGTAGGTGGATGG + Intronic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956591305 3:70917999-70918021 TTTCCTAATCTTAATGTGGAGGG - Intergenic
958636214 3:96750427-96750449 ATTCCTGGGCAGAAGGGGGAGGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
963316691 3:143766538-143766560 TTTTCTTAGCTGTAGGTGGAGGG + Intronic
963706432 3:148694038-148694060 TTGCCTAGGCTGAGAGTGGAGGG - Intergenic
964086689 3:152827447-152827469 TTTCCTTAGCCGAAGGTGTAAGG - Intergenic
964791837 3:160460317-160460339 ATTCCTGGGCTGAAGGGGGCGGG - Intronic
965253304 3:166369580-166369602 ATTCCTCAGCTGAAGGTGCAGGG + Intergenic
967946330 3:194807062-194807084 TTTCCTCGGCTGAAAGATGAGGG - Intergenic
968191068 3:196667768-196667790 GTTGCTTGGCTGAAGGAGGAAGG - Intronic
969026159 4:4174367-4174389 TTTCTCAGGCTGTAGATGGAGGG + Intergenic
969037566 4:4267062-4267084 TCTCTTTGGCTGAAGGTAGATGG + Intergenic
969241939 4:5904712-5904734 TTTCCTAGGGAGAAGGAGCATGG - Intronic
969329868 4:6468196-6468218 TTTCCTGGGCAGAAAGTAGATGG + Intronic
970905425 4:21210721-21210743 CTTCATGGGCTGAAGGTGGAAGG - Intronic
973800700 4:54474933-54474955 TTGGCTATGCTGAGGGTGGATGG + Intergenic
974883607 4:67788866-67788888 TTTGAAAGGCTGAAGTTGGAGGG - Intergenic
975587416 4:75964313-75964335 ATTCCTAAACTGAAGGTGGAAGG - Intronic
977175356 4:93813755-93813777 TTTCCAAGGCTAAGGATGGATGG - Intergenic
977972643 4:103229494-103229516 TTTCCTTTTCTGAAAGTGGATGG - Intergenic
982239161 4:153281208-153281230 TTTCATATGCTGTGGGTGGAAGG + Intronic
982660852 4:158205036-158205058 TTTGGGAGGCTGAAGGAGGAAGG + Intronic
985014430 4:185618945-185618967 CTTCCTAGGATAAATGTGGAGGG + Intronic
986788240 5:11135160-11135182 TGCCCTGGGCTGATGGTGGAGGG - Intronic
988832568 5:35002348-35002370 TTTCCTTGAGTGAAGGTGGAGGG + Intronic
988933288 5:36058348-36058370 TATCAGGGGCTGAAGGTGGAGGG + Intronic
989157606 5:38359075-38359097 ATTCTTAGGCAGAAGGGGGAAGG - Intronic
989160598 5:38387106-38387128 TTTTCTGGGCTGAGTGTGGAGGG + Intronic
990020750 5:51124427-51124449 ATTTCTAGCTTGAAGGTGGATGG + Intergenic
990370998 5:55118077-55118099 TTGCCTAGGCTGAAGCTCAATGG - Intronic
992444554 5:76821821-76821843 TTTGGGAGGCTGAAGGTGGGTGG - Intronic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
994570617 5:101508554-101508576 TTGAGTAGGCTGAAGGTGGGGGG - Intergenic
995456975 5:112362210-112362232 GTTGCCAGGCTTAAGGTGGAAGG - Intronic
996151744 5:120045493-120045515 TTTCCTAGGATGAAGAGAGATGG + Intergenic
997173176 5:131745914-131745936 TTTTCTAGGAGTAAGGTGGAGGG + Intronic
997366409 5:133328035-133328057 TTTTCTAGGTTGAAGGTACAAGG + Intronic
997897609 5:137733956-137733978 TTTCCTCTGCTGAAGGCAGATGG - Intronic
1000075496 5:157781224-157781246 ATTCGCAGGCTAAAGGTGGATGG - Intergenic
1000667137 5:164012616-164012638 TTTCCTGGTCTGATGGTGGTGGG - Intergenic
1001411103 5:171512640-171512662 CTTCCTTGTCTGTAGGTGGAAGG + Intergenic
1001805546 5:174582640-174582662 TTTCCTAGGCTGGAGGGCAATGG - Intergenic
1002428139 5:179187677-179187699 TTTCCCAGGTTGCAGGGGGAGGG + Intronic
1002824538 6:761146-761168 TTCCCTAGGCTGCAGGGGGCAGG + Intergenic
1003547173 6:7069279-7069301 TTTTCTAGGGTATAGGTGGAAGG + Intergenic
1004180754 6:13378774-13378796 GTTCCTAGGCTGCAGGAGGTGGG - Intronic
1007636671 6:43303865-43303887 TCTCCTGGCCTGAAGGTGGGTGG + Intronic
1010744567 6:79546456-79546478 TTTCCTAGGGTGATGGTTGCTGG - Intergenic
1010864767 6:80961745-80961767 TGTGCTATGCTAAAGGTGGAGGG + Intergenic
1011079356 6:83472501-83472523 TTTCCTTGGCTGAAACAGGATGG + Intergenic
1012676514 6:102119799-102119821 TTTCCTAGGCAGACGGGGCAGGG - Intergenic
1012742409 6:103034931-103034953 TTCCCATGGCTGAAGGTGGAAGG + Intergenic
1013365410 6:109433937-109433959 TAACCTAGGCTGAAAGGGGAGGG + Intronic
1014698187 6:124650948-124650970 TTTCATAGGCTCAAGCTAGAGGG - Intronic
1015087642 6:129314646-129314668 TTTCCTCAGGTGAATGTGGAAGG + Exonic
1015634676 6:135263750-135263772 ATCCCTTGGCTGAAGGTGGAGGG + Intergenic
1015705151 6:136079915-136079937 TTTCCCAGGCTGACGTAGGATGG - Intronic
1015900739 6:138063156-138063178 ATTCCTAGGATGATGGTGAAAGG + Intergenic
1017106529 6:150893621-150893643 TTTCCAAAGCTGAGGGTGAAAGG + Intronic
1018998089 6:168725360-168725382 TGTCCTCGGGTGAAGCTGGAAGG + Intergenic
1022682433 7:32562193-32562215 TTTTCTAAGCTGAAGGTTTATGG - Intronic
1022907557 7:34871568-34871590 TTTTACAGGCTGATGGTGGAAGG - Intronic
1022961013 7:35426567-35426589 TTGCCTAGGATCAATGTGGATGG - Intergenic
1023963033 7:44943644-44943666 TTTCCAAGGCTGAGGCTGGAAGG + Intergenic
1024412692 7:49064092-49064114 TTTCCCAGGCTAAAGGTCCAAGG + Intergenic
1024489814 7:49967584-49967606 TTGCCTAGGCTGAAGGGCAATGG + Intronic
1026104001 7:67406819-67406841 TCTCCTATCCTCAAGGTGGATGG - Intergenic
1026347111 7:69483629-69483651 ATTCCTAGCCTAAAGGTGGAAGG + Intergenic
1027513674 7:79114450-79114472 TTTCAGAGGCTGAAATTGGAAGG + Intronic
1028747613 7:94345959-94345981 CTTCATAGGCTGGAGGTGGGTGG - Intergenic
1029991047 7:104962774-104962796 TTCTCTAGGCTGAGGGAGGAGGG - Intergenic
1030815935 7:114037645-114037667 TTACCCAGGCTGGAGCTGGAGGG + Intronic
1032123699 7:129175458-129175480 TTTGGGAGGCTGAAGTTGGAGGG + Intergenic
1032440421 7:131938594-131938616 TTTCCTAGGGTGAAACTGGGTGG + Intergenic
1032761716 7:134949668-134949690 TCTCCTAGGATGTAGGTAGAAGG + Intronic
1033847573 7:145453170-145453192 TTTCCTAGGCTGAACTAGGCTGG + Intergenic
1035023572 7:155812636-155812658 TTTCCTAAGATAAAGGTGGGCGG + Intergenic
1035159928 7:156943086-156943108 TTTCAGAGGCTGAAGGGTGACGG - Intergenic
1035478181 7:159158558-159158580 TTTTCTAGGGTGAAGCTTGATGG + Intergenic
1036634201 8:10537837-10537859 TTGCCTTGTGTGAAGGTGGACGG + Intronic
1038041019 8:23724306-23724328 TTTGCAAGGCTGAAGCAGGAGGG - Intergenic
1039011166 8:33094745-33094767 TTTCCTATTATGAAGGTGTAAGG - Intergenic
1042004906 8:64169382-64169404 TTTCCTGGGCAGAAGGGGGCAGG + Intergenic
1042029481 8:64459989-64460011 TTTCCTAGCCTGGAGGTCGCTGG - Intergenic
1042191967 8:66196186-66196208 TTTCCTAGGCTGGAGATGAGAGG - Intergenic
1042643099 8:70956542-70956564 GTTCCTGGGCAGAAGGGGGAAGG - Intergenic
1045189475 8:99868779-99868801 TTTCCTATGATAAATGTGGAAGG + Intronic
1046632293 8:116632981-116633003 TTGCCTAGGCTGAAGTGTGATGG - Intergenic
1046871972 8:119213776-119213798 TTTCCCAGGCTGGAGGGTGATGG - Intronic
1048325012 8:133432319-133432341 GATCCTTGGCTAAAGGTGGAAGG + Intergenic
1051791912 9:20814598-20814620 TCTGGGAGGCTGAAGGTGGATGG - Intronic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055366409 9:75549107-75549129 TTTGGGAGGCCGAAGGTGGAAGG - Intergenic
1055395096 9:75865722-75865744 TTTTCCAGGCTGAGGGTGGTTGG - Intergenic
1055717337 9:79132288-79132310 TTTCTTTTGCTGAAGGTGGAAGG - Intergenic
1056361692 9:85864038-85864060 TTTCTAAGGCTGAAGATGCAGGG + Intergenic
1056717124 9:89041117-89041139 TTTTATAGGCTGAAGAGGGAGGG - Intronic
1058435808 9:104962093-104962115 ATGCCTTGGCTGAAGGTGGTAGG - Intergenic
1058459935 9:105173312-105173334 TTTCCTGGGCTGGACCTGGAGGG - Intergenic
1059023446 9:110599758-110599780 TTCCCTTGGCTGGGGGTGGAGGG + Intergenic
1060636008 9:125200412-125200434 CTTCCTGGGCTGGCGGTGGAGGG - Intergenic
1061306618 9:129736245-129736267 CTTCCCAAGCTCAAGGTGGAGGG + Intergenic
1061373468 9:130210944-130210966 TTTGGGAGGCTGAAGGAGGAGGG - Intronic
1187537111 X:20151924-20151946 TTTCCTGGGCTGAAGGTGCAGGG + Exonic
1187818794 X:23262678-23262700 GTTCCTGGGGTGAAGCTGGAGGG - Intergenic
1188196693 X:27243200-27243222 TTATCTAGGCTGAGGGTGGGTGG - Intergenic
1191155762 X:57271044-57271066 TTTCCTGGGCTCCATGTGGATGG - Intergenic
1192277580 X:69648982-69649004 TTCCCTTGGCTGGGGGTGGAGGG + Intronic
1192790617 X:74378904-74378926 TTTCCTAGGCTGGAGGGACAGGG + Intergenic
1195291863 X:103437508-103437530 TTGGCTAGGCTGAAGTTGGCAGG + Intergenic
1195555098 X:106212629-106212651 TCTGCTAGGCTGAGGGTTGAGGG - Intergenic
1195724089 X:107896101-107896123 TTTAGGAGGCCGAAGGTGGATGG + Intronic
1195800903 X:108708758-108708780 TTTTCAAGGTGGAAGGTGGAAGG + Intergenic
1195877400 X:109556282-109556304 TTTCCTAGGCTGCTGCTGAAGGG - Intergenic
1195907058 X:109854499-109854521 ATTCCCAGGATGAAGGTGAAAGG + Intergenic
1196129732 X:112142402-112142424 CTTCCTATCCTGATGGTGGAAGG + Intergenic
1196459813 X:115918385-115918407 TTTCCCTTTCTGAAGGTGGACGG + Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1199607021 X:149585841-149585863 TTCCCGAGGCTGAATGAGGAGGG + Intronic
1199632101 X:149783527-149783549 TTCCCGAGGCTGAATGAGGAGGG - Intronic