ID: 1096651525

View in Genome Browser
Species Human (GRCh38)
Location 12:53064206-53064228
Sequence CAGCTGGGTGGAACTGGCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 327}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096651525_1096651542 12 Left 1096651525 12:53064206-53064228 CCCCTGCCAGTTCCACCCAGCTG 0: 1
1: 0
2: 3
3: 35
4: 327
Right 1096651542 12:53064241-53064263 CGGCAGGGATGGGAGAGGGGTGG 0: 1
1: 0
2: 7
3: 138
4: 1449
1096651525_1096651535 -3 Left 1096651525 12:53064206-53064228 CCCCTGCCAGTTCCACCCAGCTG 0: 1
1: 0
2: 3
3: 35
4: 327
Right 1096651535 12:53064226-53064248 CTGCAGGTGCCAGCACGGCAGGG 0: 1
1: 1
2: 2
3: 24
4: 243
1096651525_1096651539 7 Left 1096651525 12:53064206-53064228 CCCCTGCCAGTTCCACCCAGCTG 0: 1
1: 0
2: 3
3: 35
4: 327
Right 1096651539 12:53064236-53064258 CAGCACGGCAGGGATGGGAGAGG 0: 1
1: 0
2: 5
3: 45
4: 499
1096651525_1096651544 14 Left 1096651525 12:53064206-53064228 CCCCTGCCAGTTCCACCCAGCTG 0: 1
1: 0
2: 3
3: 35
4: 327
Right 1096651544 12:53064243-53064265 GCAGGGATGGGAGAGGGGTGGGG 0: 1
1: 2
2: 38
3: 307
4: 2361
1096651525_1096651537 2 Left 1096651525 12:53064206-53064228 CCCCTGCCAGTTCCACCCAGCTG 0: 1
1: 0
2: 3
3: 35
4: 327
Right 1096651537 12:53064231-53064253 GGTGCCAGCACGGCAGGGATGGG 0: 1
1: 0
2: 1
3: 22
4: 204
1096651525_1096651540 8 Left 1096651525 12:53064206-53064228 CCCCTGCCAGTTCCACCCAGCTG 0: 1
1: 0
2: 3
3: 35
4: 327
Right 1096651540 12:53064237-53064259 AGCACGGCAGGGATGGGAGAGGG 0: 1
1: 0
2: 3
3: 42
4: 522
1096651525_1096651534 -4 Left 1096651525 12:53064206-53064228 CCCCTGCCAGTTCCACCCAGCTG 0: 1
1: 0
2: 3
3: 35
4: 327
Right 1096651534 12:53064225-53064247 GCTGCAGGTGCCAGCACGGCAGG 0: 1
1: 0
2: 3
3: 46
4: 388
1096651525_1096651532 -8 Left 1096651525 12:53064206-53064228 CCCCTGCCAGTTCCACCCAGCTG 0: 1
1: 0
2: 3
3: 35
4: 327
Right 1096651532 12:53064221-53064243 CCCAGCTGCAGGTGCCAGCACGG 0: 1
1: 1
2: 12
3: 113
4: 673
1096651525_1096651541 9 Left 1096651525 12:53064206-53064228 CCCCTGCCAGTTCCACCCAGCTG 0: 1
1: 0
2: 3
3: 35
4: 327
Right 1096651541 12:53064238-53064260 GCACGGCAGGGATGGGAGAGGGG 0: 1
1: 0
2: 3
3: 67
4: 569
1096651525_1096651536 1 Left 1096651525 12:53064206-53064228 CCCCTGCCAGTTCCACCCAGCTG 0: 1
1: 0
2: 3
3: 35
4: 327
Right 1096651536 12:53064230-53064252 AGGTGCCAGCACGGCAGGGATGG 0: 1
1: 0
2: 4
3: 36
4: 300
1096651525_1096651543 13 Left 1096651525 12:53064206-53064228 CCCCTGCCAGTTCCACCCAGCTG 0: 1
1: 0
2: 3
3: 35
4: 327
Right 1096651543 12:53064242-53064264 GGCAGGGATGGGAGAGGGGTGGG 0: 1
1: 2
2: 13
3: 259
4: 2009

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096651525 Original CRISPR CAGCTGGGTGGAACTGGCAG GGG (reversed) Exonic
900105289 1:978479-978501 CAGTTTGGGGGAACTGCCAGTGG + Intronic
900183494 1:1322635-1322657 CAGCAGGGAGGGACAGGCAGGGG + Intronic
900403172 1:2481147-2481169 GAGCTGGCAGGAGCTGGCAGGGG - Intronic
901215007 1:7550414-7550436 TGGCTGGGTGGCACAGGCAGTGG - Intronic
901565289 1:10109179-10109201 CTGCTGTGAGGAAGTGGCAGGGG + Intronic
901860040 1:12068497-12068519 CCCCTGGGTGGACCTGGGAGGGG - Intronic
902635161 1:17730036-17730058 CAGGTGGGAGCCACTGGCAGCGG - Intergenic
902637656 1:17745092-17745114 CAGCGGTGTGGAGCTGGGAGGGG + Intergenic
902649846 1:17829897-17829919 GGGCTGGGTGGGGCTGGCAGAGG + Intergenic
903019083 1:20381092-20381114 CAGCTGGGTGGGCCTGGGGGAGG - Intergenic
903767539 1:25744306-25744328 CAGCTGGGATGAACCGGCAAAGG + Intronic
904621002 1:31775306-31775328 CAGCTGGGTAGGATTGGGAGGGG - Intergenic
905516920 1:38568851-38568873 CTGCAGCCTGGAACTGGCAGAGG - Intergenic
906704483 1:47885007-47885029 CAGCTGGGTGGCAGGGGAAGGGG - Intronic
908085252 1:60625408-60625430 CAGAGTGGCGGAACTGGCAGTGG - Intergenic
908108756 1:60874156-60874178 CAGCTAAGTGGAAGAGGCAGTGG + Intronic
910453142 1:87367520-87367542 GAGCTGGGTGGTGCAGGCAGTGG - Intergenic
910643642 1:89490327-89490349 TAGCTGCCTGGAACTGGGAGAGG - Intergenic
912950601 1:114117974-114117996 CAGCAGGATGGAACAGGAAGGGG - Intronic
913532855 1:119744999-119745021 CAGCTGCTTGGCACTGGCAGGGG + Intergenic
913973015 1:143430409-143430431 TAGCATGGAGGAACTGGCAGCGG + Intergenic
914067399 1:144256016-144256038 TAGCATGGAGGAACTGGCAGCGG + Intergenic
914111754 1:144710338-144710360 TAGCATGGAGGAACTGGCAGCGG - Intergenic
914227548 1:145733704-145733726 CAGGTGGGTAGAACAGCCAGGGG - Intronic
915900133 1:159840811-159840833 CAGCTGGCTGGAGCTGGCTGAGG - Exonic
916123159 1:161547251-161547273 CAGTTGAGTGGTACTGTCAGAGG + Intronic
916263785 1:162869329-162869351 GTACTGGGGGGAACTGGCAGTGG - Intergenic
916320305 1:163498331-163498353 CAGACGGGTGGGCCTGGCAGAGG + Intergenic
917256613 1:173123086-173123108 CTAGTGGGTGGAACTGTCAGAGG - Intergenic
918046231 1:180942607-180942629 AAGCTGGGGGGAATCGGCAGCGG + Intronic
918300909 1:183203226-183203248 CATGTGGCTGCAACTGGCAGGGG + Intronic
919920267 1:202163104-202163126 GAGCTGGGAGGAGCTGGCTGGGG + Intergenic
920297541 1:204968131-204968153 CAGCTGGGAGGATCCGGCAGGGG + Intronic
920311737 1:205052658-205052680 CAGCTGAGGGGAAGGGGCAGGGG + Intronic
920414997 1:205793220-205793242 CAGCTGGGAGGAGGTGGCAAAGG + Intronic
922609125 1:226911404-226911426 AAGCTGAGTGGCACTGCCAGTGG - Intronic
923245716 1:232130264-232130286 CAGGTGGGTTGACCTGGCACAGG - Intergenic
923519560 1:234725327-234725349 CAGCGGGGGGAAGCTGGCAGTGG - Intergenic
923973013 1:239226593-239226615 AAGCTGGGTGGAACTGGACCAGG + Intergenic
1066670888 10:37837614-37837636 CACCTGGGTGGCACTGGCTTGGG + Exonic
1067087196 10:43249250-43249272 CAGCAGGTGGGAGCTGGCAGTGG - Intronic
1069659777 10:70116135-70116157 TAGCTGGCTGGAGGTGGCAGAGG - Intronic
1069777388 10:70934963-70934985 AAGCTGGGTGGGAGTGACAGAGG - Intergenic
1069822127 10:71234755-71234777 CAGCAGCCTGGAACTGGCTGGGG - Intronic
1069831822 10:71286496-71286518 CAGCTGGGTGGTCTTGGGAGGGG - Intronic
1070681082 10:78449549-78449571 CATCTGGCTGGAGGTGGCAGTGG - Intergenic
1070896343 10:79985761-79985783 TAGCTGGGTGGTTCTGGCTGAGG + Intergenic
1072397215 10:95056923-95056945 CAGCTTTGTTGAACAGGCAGTGG + Intronic
1073862856 10:107767297-107767319 CAGCTGTCTGGAACAGGTAGGGG + Intergenic
1073986712 10:109217807-109217829 CAGGTGGATGGAAATGCCAGTGG + Intergenic
1074377912 10:112953317-112953339 CAGCCTGGTGGAACTGGCCCTGG - Intronic
1076810052 10:132881745-132881767 CAGCAGGGTGGACCTCGCACTGG + Intronic
1077289181 11:1781002-1781024 CTGCTGGAAGGATCTGGCAGCGG + Intergenic
1077892587 11:6430197-6430219 CAGCTGGGTTGTAAAGGCAGTGG + Intergenic
1078052363 11:7977436-7977458 CATCTGGAAGGAACTTGCAGAGG + Intronic
1078090755 11:8263147-8263169 CAGCCGGGCGGAACTTGCGGGGG - Intronic
1079494622 11:21027867-21027889 TTGCTGGGTGGGCCTGGCAGTGG + Intronic
1082816486 11:57513243-57513265 GAGCTGGGTGGAAATGGAATTGG - Intronic
1083133454 11:60648624-60648646 CAGCTGGGTTGGACTGGCTTTGG + Intergenic
1083154145 11:60812206-60812228 ACGTTGGGTGGAACTGGCAATGG + Intergenic
1083234927 11:61345290-61345312 CAGCTGGGCAGGGCTGGCAGGGG - Exonic
1083618613 11:64038131-64038153 CAGCTGGGCGGACCTCCCAGGGG - Intronic
1084905431 11:72342603-72342625 CAGCTAGGAGCAACTGTCAGTGG + Intronic
1086001561 11:81990910-81990932 CGGCTGGGGGGAAGGGGCAGGGG + Intergenic
1088849685 11:113694814-113694836 CAGCTGGATGGGGCAGGCAGGGG - Intronic
1089008437 11:115112892-115112914 CAGCTGCGTGGAAGGGGCTGTGG + Intergenic
1089631566 11:119787572-119787594 GAGCTGGCAGGGACTGGCAGGGG - Intergenic
1090359992 11:126165569-126165591 CAGCTGGCTGGAGCTGGCGTGGG + Intergenic
1090654946 11:128835969-128835991 CAGCTGGGTGCATCTGGCTGGGG + Intergenic
1092156052 12:6282176-6282198 CAGCCGGGAGGGAGTGGCAGAGG - Intergenic
1094038943 12:26102747-26102769 CAGCTGTCTGCAACTGGAAGAGG + Intergenic
1095550641 12:43434868-43434890 GAGCTGGGTGGGACTGGAATAGG - Intronic
1096651525 12:53064206-53064228 CAGCTGGGTGGAACTGGCAGGGG - Exonic
1101897925 12:108769818-108769840 CTCCTGGGTGGACCAGGCAGGGG - Intergenic
1102240727 12:111322979-111323001 CAGCTGGGTGGCACTGCCCAAGG - Intronic
1102682050 12:114697438-114697460 CAGTTGGGTGGAAGTGGGGGTGG - Intergenic
1103276861 12:119719026-119719048 CAGCCGGCTGGAACGGGCTGTGG - Intronic
1105542652 13:21328196-21328218 CAGGTGGGTGCAGATGGCAGTGG + Intergenic
1106230469 13:27817320-27817342 CAGCTGGGTGGAGAGGGCCGGGG + Intergenic
1107247010 13:38308755-38308777 AAGTTGGGTAGAACTGGCAGTGG + Intergenic
1107966757 13:45604293-45604315 AAGCTGGGAGGAACTGGAAACGG - Intronic
1113371341 13:109728205-109728227 CAGCTGAGTGGACCGCGCAGAGG + Intergenic
1113885198 13:113655192-113655214 CAGCTGGGTGCAACTGCCTCGGG - Intronic
1114613280 14:24055613-24055635 CGGCTGGTAGGAACTGGGAGGGG + Exonic
1115763707 14:36601108-36601130 GAGCCGGGTGGAACTGGTGGGGG + Intergenic
1117451163 14:55851516-55851538 CAGCAGGAAGGAACTGACAGAGG - Intergenic
1117819149 14:59630477-59630499 CATCTTGGTGGAATCGGCAGTGG + Intronic
1119231831 14:72986024-72986046 CAGCTGGGTTGAATTCACAGAGG + Intronic
1119463375 14:74831350-74831372 AGGCTGGGTGCAAATGGCAGTGG - Intronic
1121253395 14:92515081-92515103 CAGCTGGGAGGGACTGGGAGGGG + Intronic
1121421472 14:93818716-93818738 CATCTGGGTGTCACTGGCATAGG - Intergenic
1122159116 14:99769948-99769970 CAGGTGGCTGGAACTTGCAGGGG - Intronic
1122837482 14:104437273-104437295 CAGCTGGGTGGGGCCGGCAGAGG - Intergenic
1122915374 14:104855923-104855945 CAGCTGGGATGAACTGGATGTGG + Intergenic
1122969179 14:105145538-105145560 GTGCTGGGTGGAGGTGGCAGAGG - Intronic
1124861759 15:33448855-33448877 CAGCTGATTGGAAGTGGCTGCGG + Intronic
1125294959 15:38192517-38192539 TAGCTGGGTGGTTCTGGCTGGGG + Intergenic
1128058542 15:64718641-64718663 GAGCGGGGTGGAGCTGCCAGTGG + Intergenic
1128559974 15:68658340-68658362 CAGCTGGGTGAGCCTGGCTGGGG + Intronic
1128771489 15:70285956-70285978 CAGCTGGGTGGCCTTGGCTGGGG + Intergenic
1129161200 15:73748874-73748896 CAGCTGGGTGCCATTGGCAGCGG + Intronic
1129922159 15:79328753-79328775 CAGCTGTGAGAAACTGGAAGAGG + Intronic
1130086670 15:80783519-80783541 CAGGAGGCTGGAAGTGGCAGTGG + Intronic
1131149336 15:90037091-90037113 CAGCTTGGAGGACCTGGCAGGGG + Intronic
1132522466 16:397828-397850 CAGCTGGGGGGGCCGGGCAGCGG - Intronic
1133730732 16:8576470-8576492 TGGCTGGAGGGAACTGGCAGGGG + Intronic
1133919902 16:10142741-10142763 AAGCTAGGTGGAAATGGGAGAGG - Intronic
1134014980 16:10881829-10881851 GAGCTGGGTGGAAGGGGCAGTGG - Intronic
1134062154 16:11205791-11205813 GAGCTGGGGGAAACTGGGAGAGG + Intergenic
1134413030 16:14019193-14019215 CAACGGGGTGGAAATGGGAGTGG - Intergenic
1134752306 16:16635704-16635726 CAGGTGGGGGGAGCTGGCATGGG - Intergenic
1135057376 16:19241877-19241899 CAGTTGCGGGGAACGGGCAGTGG - Intronic
1138530599 16:57632248-57632270 CAGGTGCGTGGATTTGGCAGTGG - Intronic
1139373961 16:66485368-66485390 CAGCTGAGTGGGAGTGTCAGTGG - Intronic
1142066745 16:88067308-88067330 CACCTGGGTGACACTGGCTGGGG - Intronic
1142111268 16:88332936-88332958 CAGCTCGGTGGCTCTGACAGGGG - Intergenic
1142358958 16:89617275-89617297 GAGCTGGGTGGAGGTGGGAGAGG + Intronic
1142707754 17:1707451-1707473 CAGCTGGAAGAAACTGCCAGTGG - Exonic
1142940809 17:3378597-3378619 GTGCTCGGTGGAGCTGGCAGGGG - Intergenic
1143034355 17:3985944-3985966 CCGCGGGGTGGAGGTGGCAGTGG - Intergenic
1144174716 17:12694080-12694102 GAGGTGGGTAGAACTGGGAGTGG + Intronic
1144356453 17:14451363-14451385 CAGCTGGAGAGCACTGGCAGTGG + Intergenic
1144437453 17:15254518-15254540 CAGAGGGGTTGAATTGGCAGAGG + Intronic
1145217352 17:21061897-21061919 CAGCAGGGAGGTACAGGCAGTGG - Intergenic
1146212630 17:30954239-30954261 CAGCAGGGTGAAGCTGGCAAAGG + Intronic
1147162450 17:38576141-38576163 CAGCTGGGTGGAGCTTCCAGGGG - Intronic
1148330472 17:46811082-46811104 CAGCCGGGAGGAGTTGGCAGGGG - Intronic
1148716452 17:49719483-49719505 CCGCTGGGAGGAACAGACAGGGG - Intronic
1150439732 17:65181514-65181536 CAGCTGGGAGGGACTGGCCAGGG + Intronic
1150871143 17:68911709-68911731 GAGCTGTCTGGAGCTGGCAGAGG - Intronic
1151235656 17:72717963-72717985 CTGCTGGGCGGCACTGGCAAGGG + Intronic
1151649478 17:75457205-75457227 CAGCTGGATGGAGCCGGCCGAGG + Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152354064 17:79798157-79798179 CATCTGGGCGGAGCCGGCAGAGG + Intronic
1152381636 17:79945276-79945298 GATCTGGGAGGAACTGGCAGAGG - Intronic
1152773886 17:82187790-82187812 GGGCTGGGGGGAGCTGGCAGGGG + Intronic
1153756926 18:8293557-8293579 TAGATGGGTGGAAAAGGCAGAGG + Intronic
1156386421 18:36609280-36609302 CTGCAGGGTGGAACTGGGAGGGG + Intronic
1156401660 18:36745210-36745232 CTGCTCGGTGCACCTGGCAGAGG - Intronic
1157498381 18:48172334-48172356 CAGCTTGGTGGAGCAGGCAGGGG + Intronic
1157591274 18:48837597-48837619 CAGGTGGATGGGAGTGGCAGAGG - Intronic
1158556203 18:58476740-58476762 CAACTGGGTGCAGCTGGGAGGGG - Intergenic
1158587076 18:58749452-58749474 CTGGAGGGTGGAAATGGCAGGGG - Exonic
1160679448 19:406097-406119 CAGCTGGGGGGACCTGGCTATGG - Exonic
1160774879 19:850817-850839 CCGCCTGGAGGAACTGGCAGGGG - Intergenic
1160816165 19:1036733-1036755 CAGCCAGGTGGAAATGACAGAGG - Intronic
1161350565 19:3789079-3789101 CAGCTTCGTGGATCTGGCTGTGG + Intronic
1161593737 19:5140890-5140912 CTGCTGGGTGCTACTGGCTGCGG - Intronic
1162040507 19:7968369-7968391 CAGCAGCATGGAGCTGGCAGGGG - Intronic
1162346196 19:10119451-10119473 CAGCTGGGAGGCAGTGGCATGGG + Intronic
1162604261 19:11694738-11694760 GGGCTGGTTGGAACTGGCCGTGG - Intergenic
1163119826 19:15210701-15210723 CAGCTGGGTGTCTCAGGCAGAGG - Intergenic
1163278006 19:16297677-16297699 CCGGTGGGTGGAACTGGGTGGGG - Intergenic
1163632547 19:18424762-18424784 CAGCTGGGTGGATCTCACACAGG + Intronic
1163851892 19:19669005-19669027 GAGCTGGTCGGAACCGGCAGTGG + Intronic
1164509960 19:28888985-28889007 CAGATGGGTGGAAAAGTCAGAGG + Intergenic
1166004314 19:39896636-39896658 CAGCTGTGTGGGACTCCCAGGGG - Intronic
1166098635 19:40557336-40557358 CCGCTGCATGGAACTGGCACTGG - Exonic
1166939337 19:46353378-46353400 CAGCTGGGTGGAGTGGGCAGGGG - Intronic
1167342298 19:48922945-48922967 CAGCTGGGTGCCAGGGGCAGGGG + Exonic
1167484964 19:49757335-49757357 CAGCTGGGTGGGCCTGGCTCAGG - Intronic
924985930 2:269868-269890 CAGCTGTGTAGAAATGGCACTGG - Intronic
925887310 2:8404017-8404039 CAGCAGGGAGGGACTGGCATTGG - Intergenic
926340836 2:11903100-11903122 AAGCTGGGGAGAAATGGCAGAGG - Intergenic
926735853 2:16072852-16072874 CAGCAGGCTGGAACAGGCAATGG + Intergenic
927471920 2:23384031-23384053 CAGCTGGGAGGAGCTGGCCTGGG - Intergenic
928196725 2:29221684-29221706 CCCCTTGGTGGAAGTGGCAGGGG - Intronic
928461421 2:31476730-31476752 CAGCTGGGTGGTGCTGGCTCAGG - Intergenic
929175122 2:38968212-38968234 CAGCTGCGTGGAACTGGAGCTGG + Intronic
929370968 2:41223292-41223314 CAGTTGGGTGGCACAGGGAGTGG - Intergenic
929424041 2:41825982-41826004 CAGCTGAAAGGAAATGGCAGAGG + Intergenic
930116707 2:47724388-47724410 CATCTGAGTGGAACTGTCAGTGG + Intronic
930118975 2:47744321-47744343 CAGCTGCCTGGCACTGGCAAAGG - Intronic
930290770 2:49490743-49490765 CCTCTGGGTGGATGTGGCAGGGG - Intergenic
930411440 2:51030485-51030507 CATCTGGGAGGAACTTGAAGTGG - Intronic
932783331 2:74577819-74577841 CAGCTGTGTTCATCTGGCAGAGG + Intronic
933864642 2:86505118-86505140 CATCTGGGTGCAACTTGCAATGG + Exonic
934177711 2:89591365-89591387 TAGCATGGAGGAACTGGCAGCGG + Intergenic
934288010 2:91665666-91665688 TAGCATGGAGGAACTGGCAGCGG + Intergenic
937329803 2:121019378-121019400 CGGCTGGGTGGAGGGGGCAGGGG - Intergenic
938149904 2:128873392-128873414 CAGCTGGGTGGAGATGACAGAGG + Intergenic
938173281 2:129101888-129101910 CAGAGGGGTGGAACTGGGAAAGG + Intergenic
938924361 2:136025426-136025448 TAGGTGGGTGGAAGTGGCGGAGG + Intergenic
938980986 2:136526915-136526937 CAGCAATGTGGAACTGCCAGAGG + Intergenic
940940082 2:159550070-159550092 GAGGTGGGTGGATCAGGCAGAGG - Intronic
943637356 2:190320516-190320538 CATCTGGGTGGATCTGGAAGCGG - Intronic
944499360 2:200342353-200342375 CAGCTGGGTGGTATTGGAGGAGG + Intronic
945722039 2:213429331-213429353 AAGTTGGGTGGAACTGGAAAGGG - Intronic
947070845 2:226286737-226286759 CAGGCGGAGGGAACTGGCAGGGG - Intergenic
947073465 2:226317084-226317106 CTGCTGGGTGGAAATGGGACTGG - Intergenic
947104955 2:226659625-226659647 CTGGTAGGTGGAGCTGGCAGTGG - Intergenic
947690653 2:232133010-232133032 CAGCTGGGTGGCATTAGCAAGGG + Intronic
948413453 2:237782773-237782795 AAGCAAGGGGGAACTGGCAGGGG - Intronic
1168857350 20:1018073-1018095 TAGCTGGGTGGTTCTGGCTGAGG + Intergenic
1169203767 20:3729013-3729035 CAGCTGGGTGGGGCAGGCAGAGG + Intergenic
1169290177 20:4342979-4343001 CAACTGTGGGGAACTGGAAGAGG - Intergenic
1169402036 20:5290205-5290227 CAGCTAGGTGGTGCTGGTAGTGG + Intergenic
1169411207 20:5371943-5371965 CAGTTGAGTGAAACTTGCAGAGG + Intergenic
1169460480 20:5790153-5790175 GAGCTGGGGGGCACTGGCAGAGG + Intronic
1170008561 20:11695501-11695523 CAGCTGTGTGGTACAGGAAGGGG - Intergenic
1171484933 20:25479633-25479655 CAGCTAGGTGGAGCTGCCTGTGG - Intronic
1172194499 20:33083042-33083064 CTGCTTGGTGGAAGTGGAAGTGG + Intronic
1172775463 20:37404241-37404263 CAGCTGGGCTGAGCGGGCAGCGG - Exonic
1173209600 20:41021903-41021925 CAGTTTGGTGGAACTGACACTGG - Intergenic
1173430570 20:42983737-42983759 CAGTGGGGTGGAAGTGGAAGGGG - Intronic
1173859173 20:46270825-46270847 GAGCTGGGTTGACTTGGCAGTGG + Intronic
1174673876 20:52334519-52334541 CAACTGGTTTGAAATGGCAGAGG + Intergenic
1175381714 20:58568454-58568476 CAGCTGGGAGGAACAGCCAGGGG - Intergenic
1176168763 20:63687820-63687842 CAGCGGGGTGGAAGTGGTGGGGG + Intronic
1176242470 20:64081436-64081458 CAGCTGTGGGCAGCTGGCAGGGG + Intronic
1176254025 20:64141220-64141242 CAGCTGTGTGGAACCGGCCCAGG + Intergenic
1179468876 21:41597399-41597421 CAGCAGGGTGGGCCTGGGAGGGG + Intergenic
1180872397 22:19153816-19153838 GAGCTGGGAGGACCTTGCAGAGG + Intergenic
1182121714 22:27791497-27791519 GAACTGGGTGGAACAAGCAGCGG + Intronic
1183601308 22:38842215-38842237 CACCTGGGTGGAGGTAGCAGAGG + Intronic
1183605612 22:38865563-38865585 ACGGTGGGAGGAACTGGCAGAGG - Exonic
1183671845 22:39277801-39277823 CAGCAGGGTGAGACTGGCTGGGG + Intergenic
1184299125 22:43544569-43544591 CTGCTGGGAGGCAGTGGCAGTGG + Intronic
1184402701 22:44282982-44283004 CAGCTGGGAGGACCTTGGAGTGG + Intronic
1184415749 22:44350893-44350915 CACCTGGGAGGAACTGGCAGGGG - Intergenic
1184444828 22:44540909-44540931 CAGCTAGGTGGGAGTGACAGTGG + Intergenic
1184609120 22:45591131-45591153 GAGCTTGGTGGAAGGGGCAGTGG + Intronic
1184841513 22:47054994-47055016 CAGCTGGGTGGCAGTGGGCGGGG + Intronic
1185142895 22:49113170-49113192 CATCTAGGTGGAGGTGGCAGTGG + Intergenic
1185250881 22:49801042-49801064 CAGGTGCGTGGGACTGGCAGAGG + Intronic
1185341588 22:50293539-50293561 CAGCTCGGTGGCAGTGGCAGAGG + Intronic
950175965 3:10874679-10874701 CAGTTGTGGGGAACTGGGAGGGG - Intronic
950325569 3:12106160-12106182 CAGCCTGGAGGAACTGGGAGTGG - Intronic
952991529 3:38835157-38835179 TAGCTGGGTGGTTCTGGCACAGG + Intergenic
953170713 3:40505021-40505043 TGGCTGGGTGGTACTGGCTGAGG - Intergenic
953514040 3:43572401-43572423 CAGATGGGTGGCACTGGCAAGGG + Intronic
954459372 3:50617605-50617627 CCGCCGGGTGCAACTGGCGGGGG - Exonic
954714822 3:52521770-52521792 AGGGTGGGTGGAACGGGCAGAGG + Intronic
958593431 3:96190146-96190168 CAGCTGCCTGGCGCTGGCAGAGG - Intergenic
960317943 3:116201113-116201135 CAGCGGGGAGGGACTGGGAGCGG - Intronic
960717922 3:120596030-120596052 GAGCTGTGTGGGACTGGCTGTGG - Intergenic
960725500 3:120665881-120665903 CAGCTGGGAAGGACTGTCAGAGG + Intronic
961508575 3:127387744-127387766 CAGGTGGGTGGCACTGGGAGGGG - Intergenic
961512050 3:127409217-127409239 GAGGATGGTGGAACTGGCAGTGG - Intergenic
961536584 3:127574311-127574333 CACCTGGGTGAAGCTGGGAGAGG - Intronic
962814715 3:138987775-138987797 CAGCTGGCTGGTTCTGGAAGTGG - Intergenic
962938520 3:140104219-140104241 CAGGTGGGAGGAACTGTCTGTGG - Intronic
965662878 3:171060675-171060697 GGTCTGGCTGGAACTGGCAGGGG + Intergenic
966276801 3:178182603-178182625 CAGATTGATGGCACTGGCAGTGG + Intergenic
967227435 3:187305491-187305513 CAGCTGGGAGGCTGTGGCAGTGG + Intergenic
968122023 3:196132452-196132474 CTGCTGGATGGAAGTGGCACAGG + Intergenic
969350939 4:6597484-6597506 CAGCTGGATGGATCAGGCTGTGG - Intronic
969605259 4:8199276-8199298 CAGCTGGACGGAGCAGGCAGGGG - Intronic
969718096 4:8877989-8878011 CAGCTCGGTGGCCCTGGCACAGG - Intergenic
970672674 4:18414601-18414623 CAGCTAGTTGGCTCTGGCAGAGG - Intergenic
971298875 4:25425595-25425617 CAGCAGGGTGGGACTGGGATGGG + Intergenic
971665983 4:29485815-29485837 CCGGTGGGTGGAAGTTGCAGTGG - Intergenic
974993272 4:69121133-69121155 CAGCTGTCTGGAAGTGGAAGGGG + Intronic
975161333 4:71128153-71128175 CAGCCAGGTGGAACTGTGAGTGG - Intergenic
976775765 4:88704260-88704282 CAACTGGGAAGAACTGGAAGAGG + Exonic
976872107 4:89807543-89807565 CAGCTGTGTGGAACTCTGAGAGG - Intronic
982110682 4:152050838-152050860 CTCCTGGAAGGAACTGGCAGAGG - Intergenic
982817532 4:159905145-159905167 CTGCTGGGTGGGAGTGTCAGTGG - Intergenic
983216461 4:165007158-165007180 CAGCTGGGTGGCACTTGGAGAGG + Intergenic
983565001 4:169141135-169141157 CAGATGTGGGGAACTGGCTGAGG - Intronic
983757650 4:171361235-171361257 CAGCTGAGTGAAACTAGTAGAGG - Intergenic
984833901 4:184001149-184001171 CACCTGAGTGGAATTGGCTGTGG + Intronic
985508549 5:298929-298951 CAGCTGGGTGGGAGTAGCTGAGG - Intronic
985508559 5:298970-298992 CAGCTGGGTGGGAGTAGCTGGGG - Intronic
985721635 5:1492687-1492709 CACCTGGGTTGATCTGGAAGAGG + Intronic
986986393 5:13505267-13505289 AAGCTTTGTGAAACTGGCAGGGG - Intergenic
991900210 5:71453160-71453182 AAGCTGTGTAGACCTGGCAGTGG + Intergenic
991987781 5:72308006-72308028 CTCCACGGTGGAACTGGCAGCGG + Intronic
992527918 5:77630006-77630028 CAGCTGGGTGGGAAGGGAAGAGG + Exonic
995398934 5:111718918-111718940 CAAGATGGTGGAACTGGCAGGGG - Intronic
998323188 5:141252298-141252320 AAGCTTGGTGGTACTAGCAGAGG + Intergenic
999633545 5:153596897-153596919 CAGCTGAGTGGCACTAGCACCGG - Intronic
999670939 5:153958790-153958812 CAGCGGGGTGACACTGACAGTGG - Intergenic
999757578 5:154676425-154676447 TAGCTGGGTGCTACTGGCACAGG - Intergenic
999950592 5:156645678-156645700 CAACTAGGTGGAAGTGGGAGGGG - Intronic
999959131 5:156735423-156735445 CAGCTGGAGAGCACTGGCAGGGG + Intronic
1000694148 5:164359049-164359071 CAGCTGGAGGGAACTTGCCGTGG + Intergenic
1002165127 5:177339241-177339263 TAGCAGGGTGGATGTGGCAGTGG - Intronic
1002632008 5:180588497-180588519 GAGCTTGGTGGAACTGACGGTGG - Intergenic
1005139961 6:22619417-22619439 CAGCTGGGGGCAGTTGGCAGGGG - Intergenic
1005668525 6:28081290-28081312 CAGCCAGGTGGAACGGGGAGGGG + Exonic
1006379761 6:33690747-33690769 AAGCTGGGTGGGCCTGTCAGGGG - Intronic
1006418589 6:33919649-33919671 GAGCTGGGAGGAACTAGCTGGGG + Intergenic
1007391306 6:41551067-41551089 CGGCTTGGTGGAACTGGCAGTGG - Intronic
1007696024 6:43734687-43734709 CAGCAGGGAGAAACTGGGAGTGG - Intergenic
1009743045 6:67772995-67773017 CAGATGGGTGGAAGTAGCACAGG - Intergenic
1011559413 6:88599723-88599745 CTGCTGGCTGGAAATGGCATCGG - Intergenic
1013720995 6:113028103-113028125 ATGTTGGGTGGAAGTGGCAGAGG + Intergenic
1016305092 6:142675730-142675752 CTGCTGGGTGGCCCTGGGAGAGG - Intergenic
1016346263 6:143117218-143117240 CAGTTAGGGGGAAGTGGCAGTGG + Intronic
1018981310 6:168603759-168603781 CAGCTTGAAGGAAATGGCAGGGG + Intronic
1019597314 7:1864138-1864160 CAGCCCGGTGGGACTTGCAGAGG + Intronic
1019644174 7:2120318-2120340 CAGCTGGGAGGAAGTGGTGGCGG - Intronic
1019888356 7:3924926-3924948 CAGCTGGGGGAAAATGACAGTGG - Intronic
1019987887 7:4671122-4671144 CAGCTGGGTGGGTCTGGCTCAGG - Intergenic
1019989926 7:4683483-4683505 CAGCTGGGTGGAGCTGGGGTGGG - Intronic
1020120816 7:5502201-5502223 CAGCTAAGTGGGACTGGTAGAGG + Intronic
1021913214 7:25406845-25406867 CAGTTGGCTGAAACTGCCAGGGG - Intergenic
1022265256 7:28747526-28747548 CAGCTGTCTGGAACCTGCAGTGG + Intronic
1022359836 7:29647275-29647297 TAGCTGGGTGGTTCTGGCTGAGG - Intergenic
1022368639 7:29749933-29749955 TAGCTGGGTGGTTCTGGCTGAGG - Intergenic
1024096582 7:45987231-45987253 GGGCTGGATGGGACTGGCAGTGG + Intergenic
1025213089 7:57032445-57032467 GATCTTGGTGGACCTGGCAGGGG - Intergenic
1025658863 7:63544379-63544401 GATCTTGGTGGACCTGGCAGGGG + Intergenic
1026277445 7:68892437-68892459 CAACTGGGTGGAACTGAAAATGG - Intergenic
1026880989 7:73906545-73906567 GAGCTGGGTGGAACTGAACGTGG - Intergenic
1029405237 7:100370920-100370942 CAACTGGCTGGCTCTGGCAGGGG + Intronic
1029598587 7:101550694-101550716 CAGCTGGGTGGCGATGTCAGGGG + Intronic
1030145365 7:106348329-106348351 CAGCTGAGTGGAAGTGACAGAGG + Intergenic
1033042823 7:137933796-137933818 CAGCTGGGTGTCCTTGGCAGTGG + Intronic
1033125439 7:138702977-138702999 CATCTGGGAGGATCTGGAAGGGG + Intergenic
1033176264 7:139126685-139126707 CACCTCATTGGAACTGGCAGGGG + Intergenic
1033504967 7:141990853-141990875 TAGCTGGGTGGAAGTGGGAAGGG - Intronic
1034746149 7:153525454-153525476 CAGAAGGATGGAATTGGCAGTGG + Intergenic
1035341841 7:158167159-158167181 CATCTGGCTGGAGCTGGCCGAGG + Exonic
1037358186 8:18045281-18045303 GAGCTGGGTGTAAGTAGCAGAGG - Intergenic
1038514644 8:28176418-28176440 CAGCTGGCTGGAACTGGAGTGGG - Intronic
1040056701 8:43064704-43064726 CTGCGGAGTGGGACTGGCAGTGG - Intronic
1040887839 8:52284565-52284587 CACCAGGGTGGAGCTGGGAGAGG + Intronic
1040892076 8:52327681-52327703 CAACTGGGTGGCACTGGCAGAGG - Intronic
1041091239 8:54302958-54302980 CAGCGGGGTAGAACTGGCTGGGG - Intergenic
1043555295 8:81423326-81423348 CAGCTGGCAGGAAGTGGGAGCGG + Intergenic
1043608704 8:82035015-82035037 CAGCTGGGTGACACTGCAAGTGG - Intergenic
1044890929 8:96834908-96834930 CAGCTGGGTTGAATTGGCACAGG - Intronic
1048686028 8:136906469-136906491 CGGCTGCCTGGCACTGGCAGAGG + Intergenic
1048868047 8:138775271-138775293 GAGCTGGGTGGGAGTTGCAGTGG + Intronic
1049454208 8:142678754-142678776 CAGCTGGGTGGTGGTAGCAGTGG - Intronic
1049454273 8:142679055-142679077 CAGCTGGGAGGTGGTGGCAGTGG - Intronic
1052099635 9:24429560-24429582 AAGCTGGTGGTAACTGGCAGAGG - Intergenic
1053427079 9:38017239-38017261 CAGCCGGGTGGCACTGGCTGAGG - Intronic
1054825711 9:69571281-69571303 CAGCGGTGTAGAACTGGCACAGG - Intronic
1056121657 9:83494132-83494154 CAGCTGGGGGCAACTGGGAAAGG + Intronic
1056728541 9:89143525-89143547 CTCCTGGGTGGAAGTGTCAGAGG - Intronic
1056756604 9:89385743-89385765 CAGCTGGGAGCAACAGGCAGAGG - Intronic
1056799970 9:89684161-89684183 CAGCTGGGTGGCTCTGGCTTAGG - Intergenic
1057280806 9:93710240-93710262 CTGCAGGGTGGAACAGGCAGTGG - Intergenic
1057721341 9:97534525-97534547 CAGCTGGGTGGAAAAGCCAATGG + Intronic
1057904560 9:98974119-98974141 CAGGTGGGTGGGAGTTGCAGGGG + Intronic
1059329045 9:113523674-113523696 CAGCTGGGAGTATCTGTCAGTGG + Intronic
1060038576 9:120280658-120280680 CAGCTGGGTGGCTCTGGCTTTGG + Intergenic
1060157382 9:121329132-121329154 CAGCTGGCTGCAGCTGGCAGGGG - Intronic
1060254613 9:122016161-122016183 CAGCAGCTTGGAAGTGGCAGTGG + Intronic
1060527062 9:124326670-124326692 CTGCTGTGGGGAACTGGAAGTGG - Intronic
1061435180 9:130556711-130556733 TAGCTGGGTGTTTCTGGCAGGGG - Intergenic
1061445177 9:130633491-130633513 CTGGCGGGTGGAACGGGCAGAGG + Intronic
1061806109 9:133138502-133138524 CAGCTGGGTGTGCCAGGCAGTGG + Intronic
1062244210 9:135555626-135555648 CAGCTGGGTGGTTCTGGCTCAGG - Intergenic
1062378704 9:136276475-136276497 CAGGTGGGAGGAACAGACAGAGG - Intergenic
1062686178 9:137814631-137814653 GAGCTGGGTGTGACAGGCAGGGG + Intronic
1186636379 X:11409477-11409499 CACCTTGGAGGAAGTGGCAGGGG - Intronic
1187449613 X:19385155-19385177 TAGCTGGGTGGACCTGGCTCAGG + Intronic
1187486112 X:19706051-19706073 CATGTGAGTGGAAGTGGCAGGGG - Intronic
1189025030 X:37385644-37385666 CAGCTGGGTGGTTTTGGCATAGG + Intronic
1189411768 X:40779185-40779207 GAGCTGCCTGGAACTGGGAGAGG + Intergenic
1190140383 X:47837729-47837751 CAGCAAGGTAGTACTGGCAGAGG - Intronic
1190726185 X:53192484-53192506 CTCCTGGGTGGAACAGTCAGGGG + Exonic
1190994528 X:55593410-55593432 TATCTGGTTGGAGCTGGCAGAGG - Intergenic
1193422652 X:81301938-81301960 AAACTGTGTGGAACTGGCAAAGG - Intergenic
1196463733 X:115952810-115952832 GATCTGGGCGGGACTGGCAGAGG - Intergenic
1196748868 X:119096605-119096627 CAGCTGGGTGCTACTGGTAGAGG + Exonic
1197767639 X:130069500-130069522 TCGCCGGGTGGTACTGGCAGAGG + Exonic
1198278981 X:135123804-135123826 CAGCTGAGTGGAACATGGAGAGG + Intergenic
1198291977 X:135248716-135248738 CAGCTGAGTGGAACATGGAGAGG - Intergenic
1200243944 X:154512852-154512874 CTCCTGGGTGGGCCTGGCAGTGG - Exonic
1200823097 Y:7608455-7608477 GAGCATGGTGGAACTGGCATGGG - Intergenic
1202236958 Y:22722640-22722662 GAGCATGGTGGAACTGGCATGGG + Intergenic