ID: 1096656628

View in Genome Browser
Species Human (GRCh38)
Location 12:53096580-53096602
Sequence TGGGGAAGGCGGGTGGGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2289
Summary {0: 1, 1: 1, 2: 31, 3: 212, 4: 2044}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096656612_1096656628 14 Left 1096656612 12:53096543-53096565 CCTGGCTAGGAGTGCCTGGGATG 0: 1
1: 0
2: 1
3: 21
4: 204
Right 1096656628 12:53096580-53096602 TGGGGAAGGCGGGTGGGGAGCGG 0: 1
1: 1
2: 31
3: 212
4: 2044
1096656617_1096656628 0 Left 1096656617 12:53096557-53096579 CCTGGGATGGGCGGGACACTGCC 0: 1
1: 0
2: 2
3: 13
4: 178
Right 1096656628 12:53096580-53096602 TGGGGAAGGCGGGTGGGGAGCGG 0: 1
1: 1
2: 31
3: 212
4: 2044
1096656608_1096656628 30 Left 1096656608 12:53096527-53096549 CCTCTCTCTTGTGAGGCCTGGCT 0: 1
1: 1
2: 2
3: 18
4: 199
Right 1096656628 12:53096580-53096602 TGGGGAAGGCGGGTGGGGAGCGG 0: 1
1: 1
2: 31
3: 212
4: 2044

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096656628 Original CRISPR TGGGGAAGGCGGGTGGGGAG CGG Intergenic
Too many off-targets to display for this crispr