ID: 1096668160

View in Genome Browser
Species Human (GRCh38)
Location 12:53180798-53180820
Sequence CCGCGCGGCCAGGGAGCCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096668147_1096668160 23 Left 1096668147 12:53180752-53180774 CCGCGGCGGTGGGGTTGGCAGGG 0: 1
1: 0
2: 1
3: 24
4: 395
Right 1096668160 12:53180798-53180820 CCGCGCGGCCAGGGAGCCAGCGG 0: 1
1: 0
2: 1
3: 15
4: 208
1096668156_1096668160 -10 Left 1096668156 12:53180785-53180807 CCTGGAGGAGGCGCCGCGCGGCC 0: 1
1: 0
2: 7
3: 31
4: 300
Right 1096668160 12:53180798-53180820 CCGCGCGGCCAGGGAGCCAGCGG 0: 1
1: 0
2: 1
3: 15
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096668160 Original CRISPR CCGCGCGGCCAGGGAGCCAG CGG Exonic
900435511 1:2628955-2628977 CTGCGCGGCCAGGCAGGGAGGGG + Intronic
900464862 1:2820678-2820700 CCAGGGGGCCAGGGGGCCAGGGG + Intergenic
900559057 1:3294661-3294683 CCGCGAGGCCTGGGGGACAGAGG - Intronic
901490082 1:9592292-9592314 CTCAGGGGCCAGGGAGCCAGAGG - Intronic
902502946 1:16922602-16922624 CCACGAGGCCAGGGAGCCCCGGG + Intronic
902515974 1:16989855-16989877 CAGGGCGGCCAGGGAGCTGGGGG + Intronic
902586169 1:17439726-17439748 CCGCGCGGCAAGCGAGCGCGCGG + Intergenic
903126983 1:21254960-21254982 CAGCGGGCCCTGGGAGCCAGGGG - Intronic
905960110 1:42035969-42035991 CCGCGCGGCCAGGAAGGGGGCGG - Intergenic
906481639 1:46203313-46203335 CCGCGCGGGCGGGGACCCACCGG + Exonic
907489617 1:54800705-54800727 CTGCTCGGCCAGGCAGCGAGCGG + Exonic
909475225 1:76074647-76074669 CCGCGCGGGCCGCGGGCCAGTGG + Intergenic
910374410 1:86553022-86553044 CCGCGCGGCGTGGGAGCAGGAGG - Intronic
911618187 1:100037974-100037996 CCGCGCGGCCAGGGTAACCGCGG - Intergenic
912633593 1:111270795-111270817 GGGGGCGGCCAGGCAGCCAGGGG - Intergenic
915290090 1:154877732-154877754 CCGGGCTCACAGGGAGCCAGTGG + Intergenic
916322699 1:163522542-163522564 CCTGGAGGACAGGGAGCCAGGGG - Intergenic
917854015 1:179087331-179087353 CGGCCCAGCCAGGGTGCCAGTGG + Intronic
918140211 1:181713713-181713735 CCCATAGGCCAGGGAGCCAGAGG - Intronic
918260289 1:182789694-182789716 CCGCCACGCCAGGGAGCCTGGGG - Intronic
919772486 1:201171321-201171343 CCGCGGCGCCTGGGACCCAGCGG - Intronic
919786676 1:201262486-201262508 CCCCAGGGCCAGGGACCCAGAGG + Intergenic
923630804 1:235648792-235648814 CCGCGGGGCCGGGGAGACGGTGG + Intronic
1064231017 10:13529139-13529161 CCGCGCGGCCAGGCCGGCGGCGG - Intergenic
1065727197 10:28677661-28677683 GAGCGGGGCAAGGGAGCCAGTGG + Exonic
1065993259 10:31032501-31032523 CCGCGGGAGCCGGGAGCCAGGGG - Intergenic
1069457074 10:68561477-68561499 CAGCGCGTCCAGCGACCCAGTGG - Intronic
1069641898 10:69961716-69961738 CTGCCTGCCCAGGGAGCCAGAGG + Intronic
1072283710 10:93893839-93893861 CAGCCCGACCAGGGAGGCAGCGG + Intergenic
1072637126 10:97185439-97185461 CCTCGGAGCCAGGGAGCCAGGGG + Intronic
1074855055 10:117467267-117467289 CAGCGAGGCCAGGGAGAAAGTGG - Intergenic
1075129543 10:119726233-119726255 CCGCGCGCCCAGGGAGGCGGCGG - Exonic
1075785701 10:125048633-125048655 CCCCGACCCCAGGGAGCCAGGGG + Intronic
1076119217 10:127922418-127922440 CCGTGGGGCAAGGGGGCCAGGGG + Intronic
1076384020 10:130044476-130044498 CAGGGCTGCCAGGGAGCCAGGGG + Intergenic
1076792316 10:132784140-132784162 ACGCGGGGTCAGGGAGCCGGAGG - Intergenic
1076868913 10:133183152-133183174 GCGGGCGGCGAGGGTGCCAGCGG + Intronic
1077216862 11:1398623-1398645 CAGCCAGGCCAGGGGGCCAGAGG + Intronic
1077390963 11:2300465-2300487 CAGCGGGGGCAGGGAGCCGGTGG - Intronic
1077540107 11:3142702-3142724 CCCCGCGGACACGGAGACAGAGG - Intronic
1083163134 11:60867780-60867802 GCCCGTGGCCAGGGAGGCAGGGG - Intronic
1086091358 11:83008154-83008176 CAGCCTGGCCAGGGAGCCAGAGG + Intronic
1088259191 11:107928534-107928556 TGGGGCGGCCCGGGAGCCAGCGG + Exonic
1088753277 11:112864137-112864159 ACGCACGGACAGGCAGCCAGTGG - Intergenic
1088813593 11:113407272-113407294 CCAGGAGGGCAGGGAGCCAGTGG + Intergenic
1088815163 11:113415628-113415650 CCGGGCAGGCAGGGAGTCAGCGG + Intronic
1089065433 11:115659105-115659127 GCGCTCCGCAAGGGAGCCAGGGG + Intergenic
1089533791 11:119148982-119149004 CCGCGCCGCCCGGCAGCCCGCGG - Intergenic
1090403469 11:126463477-126463499 TAGCCAGGCCAGGGAGCCAGGGG - Intronic
1092900989 12:13059170-13059192 CCCGGCGGGGAGGGAGCCAGGGG - Intronic
1096022490 12:48333800-48333822 GAGCGCCGCCAGGGAGGCAGCGG - Intergenic
1096668160 12:53180798-53180820 CCGCGCGGCCAGGGAGCCAGCGG + Exonic
1096670919 12:53197803-53197825 CCGCTCAGCCAGGGCGCCCGCGG - Exonic
1097794080 12:63844072-63844094 CACCGCGGCCAGGGAGGCAGAGG + Intergenic
1101335877 12:103796440-103796462 CCGGGAGGCCCGGGAGGCAGAGG + Intronic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1102180462 12:110908947-110908969 CTGCGTGGGCAGGGACCCAGGGG - Intergenic
1102583955 12:113910242-113910264 CCGCCTGGGCAGGGAGGCAGGGG + Intronic
1103136707 12:118513746-118513768 CAGCCGGGCCAGGGAGCAAGGGG + Intergenic
1103400545 12:120640571-120640593 CTGGGCCGCCAGGGAGCCGGGGG + Exonic
1103954017 12:124566851-124566873 CAGCCAGGCCAGGGAGCTAGGGG + Intronic
1104390575 12:128388001-128388023 CCTGCCGGCCAAGGAGCCAGTGG - Intronic
1104602347 12:130162307-130162329 CCGCGGGGCCCGGGAGCCCGCGG + Intergenic
1104661351 12:130613283-130613305 CCGCCCCGCCAGAGGGCCAGTGG + Intronic
1105015824 12:132786401-132786423 CCTCGCGGCCAAGGAGGCTGCGG - Exonic
1105750535 13:23419148-23419170 CAGCTCCGCCAGGGAACCAGGGG + Intronic
1105943559 13:25171231-25171253 CCGCGCGGCGGGGGCGACAGCGG - Exonic
1107612404 13:42129193-42129215 CAGCTCTGCCAGGGAGGCAGAGG - Intronic
1113852590 13:113426319-113426341 CCGCGGTGCCAGGGAGCAGGAGG - Intronic
1113946870 13:114049201-114049223 CCACGCAGCCAGGAAGCCAGTGG + Intronic
1119438476 14:74612657-74612679 CCCAGCGGCCAGGGCGCAAGCGG - Intergenic
1122143360 14:99675211-99675233 CCCAGCAGCCAGGGAGCCGGAGG + Exonic
1122162232 14:99793147-99793169 CCGGGCGGCCTGGGAGCCGCAGG - Intronic
1122341917 14:101034053-101034075 CCCCGCTGCCAGGGAGGCTGGGG + Intergenic
1122697464 14:103562969-103562991 CCGTGCGCCGCGGGAGCCAGGGG + Exonic
1123070592 14:105640833-105640855 CTGCGAGGCCAGAGAGCCATGGG + Intergenic
1126109466 15:45167117-45167139 CCGCGCGGCCAGCGGGCCTCGGG + Intergenic
1128802116 15:70503602-70503624 GCCCCAGGCCAGGGAGCCAGGGG - Intergenic
1131108694 15:89751046-89751068 CCGCGCGGCCAGGCACCCTCCGG - Exonic
1131972248 15:97904315-97904337 CCGCACAGCCAGGAAGCCCGAGG + Intergenic
1132853525 16:2035026-2035048 CTGTGGGGCCAGGGAGCCACAGG + Intronic
1132933729 16:2471116-2471138 CTGGGAGGCCCGGGAGCCAGGGG - Intergenic
1135572323 16:23558161-23558183 CGGCGCGGGCAGGGAGCTGGTGG + Exonic
1136590400 16:31214855-31214877 CCGCGTGGCCGGGGAGCCGGCGG + Exonic
1137606274 16:49788743-49788765 CCTGCCGGACAGGGAGCCAGGGG + Intronic
1137619698 16:49868237-49868259 CCACGGTGCCAGGGAGGCAGGGG + Intergenic
1137683285 16:50369023-50369045 CCGCGCGCACAGGGTGCCGGCGG + Intergenic
1139581024 16:67873604-67873626 CCTCGGGGCCAGGAAACCAGAGG - Intronic
1139659677 16:68412066-68412088 GCACGGGGCCAGGGAGGCAGAGG + Intronic
1140462169 16:75148669-75148691 CCGCGCGGCCTGGGGCCGAGGGG + Intronic
1144608660 17:16689803-16689825 CCGCGCTGCCAGGACGCAAGCGG - Intergenic
1145128434 17:20320718-20320740 CCGCGCTGCCAGGACGCAAGCGG - Intergenic
1146370966 17:32265677-32265699 CGGCGCGGCCCGGGAGCGGGAGG - Intergenic
1147402803 17:40191275-40191297 AGGGGCGGCCAGGGCGCCAGGGG - Intronic
1147599109 17:41734754-41734776 CCGCGCGGGAGGGGAGCTAGTGG + Intergenic
1148029443 17:44609329-44609351 CCGCTTGGCCAGGGAGACACAGG - Intergenic
1149654492 17:58303025-58303047 CCGGGAGGCCAAGGACCCAGAGG + Intronic
1152553958 17:81043814-81043836 ACGCGCGGCTGGAGAGCCAGAGG - Intronic
1152628883 17:81400743-81400765 CCTCTCGGGCAGGGAGTCAGAGG - Intronic
1152691678 17:81720922-81720944 CCCAGCGACCAGGGAGGCAGAGG - Exonic
1154409832 18:14132462-14132484 GCGCGCAGCCAGGGAGGAAGGGG - Intronic
1155654561 18:28177956-28177978 CCGCGCAGCCAGGCAGCGCGTGG - Intergenic
1157613898 18:48975853-48975875 ACGCGAGGCCGGGGAGGCAGGGG + Intergenic
1161241111 19:3224558-3224580 CCGCGCGGCGCGGCCGCCAGGGG + Intergenic
1161333807 19:3700378-3700400 GCGCGCGGCCATGGAGCTGGAGG - Exonic
1161475087 19:4480317-4480339 CTGGGGGGCCAGGGAGTCAGGGG - Intronic
1162561150 19:11418834-11418856 CCGAGCGGCCAAGGAGGCTGAGG - Intronic
1162931715 19:13960886-13960908 CCGCAGGGCCAGGCAGGCAGGGG + Intronic
1162954305 19:14089983-14090005 CGGCGCGGCCCGTGAGCCTGCGG - Exonic
1164609820 19:29624336-29624358 CAGCGTGGCCAAGGAGGCAGGGG + Intergenic
1165791891 19:38497433-38497455 CCACACAGCCAGGGAGCGAGGGG - Intronic
1166371278 19:42302578-42302600 GTGCGCGGCCTGGGAGTCAGCGG - Exonic
1166960490 19:46493606-46493628 GCGCGCGGCCTTGGATCCAGTGG + Exonic
1166984044 19:46649249-46649271 CGGCGCGGCCAGGGAGGCCTCGG + Exonic
1168096529 19:54118686-54118708 ACAAGCAGCCAGGGAGCCAGGGG - Intronic
1168301443 19:55407390-55407412 CCTCGCCGCCAGGGAGACTGCGG + Intronic
927714012 2:25341357-25341379 GCCCGCGGCCAGGGCGCCGGAGG - Intronic
930029633 2:47050159-47050181 CCGAGCTGGCAAGGAGCCAGTGG - Intronic
931321484 2:61177701-61177723 CCGCGGGGCCAGGGGGTCAGGGG + Exonic
932231286 2:70086567-70086589 CCGCGCGGCCTGGGCTCCCGCGG - Intergenic
934991873 2:98927267-98927289 CAGCGTGGCCAGGGAGTCATTGG - Intronic
936545979 2:113393780-113393802 GAGCGCCGCCAGGGAGGCAGCGG + Intergenic
937454298 2:122027965-122027987 GCGAGTGGCCAGGGAGGCAGCGG + Intergenic
938319842 2:130355666-130355688 CCGCGCGGCCTGGCTCCCAGGGG + Intergenic
941112110 2:161427159-161427181 GCGCAGGGCCGGGGAGCCAGGGG + Intronic
941951575 2:171161120-171161142 CCGCGCGGCGCGGGAGCCCGGGG + Intronic
946185638 2:217979009-217979031 ACCCGCGGCCGGGGAGGCAGGGG + Intronic
946219832 2:218217106-218217128 CCGCGCGTCCAGGCGGCGAGCGG + Intronic
946308814 2:218871636-218871658 CCGCGGGGCCAGGGGGTCCGGGG - Exonic
947119116 2:226798621-226798643 GCGCGCGGCCAGCGAGGCTGGGG - Exonic
947172478 2:227325367-227325389 TCGAGCGCCCCGGGAGCCAGAGG + Exonic
947729704 2:232421054-232421076 CCGCGCTGCCAGGTAGCCAGAGG - Intergenic
948115970 2:235494468-235494490 ACGCGCGGCCGGCGAGCGAGCGG - Exonic
948953824 2:241272389-241272411 CCGTGCGGCCACGGCACCAGGGG + Intronic
1173248215 20:41350419-41350441 GAGCGAGGCCAGGGAGGCAGTGG - Intronic
1173663602 20:44750664-44750686 CCGGGCGGCGGGGCAGCCAGAGG - Exonic
1174317474 20:49713790-49713812 CCGCGAGGCCCGGGAGGCGGTGG - Exonic
1176863390 21:14027388-14027410 GCGCGCAGCCAGGGAGGAAGGGG + Intergenic
1179176293 21:39010539-39010561 CTGCGAGGTCAGGGAGCCAATGG - Intergenic
1180172461 21:46066927-46066949 GCGTGCGGGCTGGGAGCCAGAGG + Intergenic
1180974973 22:19843339-19843361 CCAGGCGGGCAGGGAGGCAGCGG + Intronic
1181003556 22:19999091-19999113 CCCCACAGCCAGGGAGGCAGAGG + Intronic
1181696469 22:24595166-24595188 CCTCTCGGCCAGGGACACAGAGG - Intronic
1182426490 22:30275961-30275983 CGGCGCAGCCAGGGAGGCTGAGG + Intergenic
1183947594 22:41335489-41335511 CTGCGTGGCCTGGGAGCCATGGG + Intronic
1184479134 22:44736972-44736994 CCGCCCGGCCAGGGCCCCACCGG + Exonic
1184783164 22:46659121-46659143 GCGGGAGGCCTGGGAGCCAGAGG - Intronic
1185044690 22:48523080-48523102 GGGGGCGGCCAGGGAGCCACTGG + Intronic
949105400 3:196849-196871 TCCCGCGGCCAGAGAGCCAGCGG + Exonic
950683942 3:14603078-14603100 CCGCGGGCCCAGGGAGCCGCGGG + Intergenic
956658987 3:71581648-71581670 GCGCGCGGCGAGCGAGCGAGCGG - Intronic
960638935 3:119809491-119809513 CTGGGCGGCCAGGGAGGAAGGGG - Intronic
961162405 3:124740159-124740181 CCCAGTGGCCAGGGAGCCGGTGG - Exonic
961346484 3:126266756-126266778 CCTCCAGCCCAGGGAGCCAGGGG + Intergenic
961626130 3:128264918-128264940 GGGCGGGGCCAGGCAGCCAGAGG - Intronic
965429495 3:168568755-168568777 CCAGGGGGCCAGGGGGCCAGGGG - Intergenic
965429500 3:168568763-168568785 CCAGGGGGCCAGGGGGCCAGGGG - Intergenic
968478896 4:825467-825489 CCCCGCGCCGCGGGAGCCAGGGG - Intronic
969829249 4:9781820-9781842 CACCACGGCCATGGAGCCAGAGG + Exonic
973759652 4:54104246-54104268 CCGCAGGGCCTGGGAGCCGGGGG - Intronic
983410451 4:167389687-167389709 CCGCACAGCCTGGGAGACAGGGG - Intergenic
985952139 5:3230338-3230360 CTGAGTGGCCAGGGAGACAGAGG - Intergenic
988997800 5:36730986-36731008 CCTCGCTCCCAGGGCGCCAGTGG - Intergenic
999733235 5:154492151-154492173 CCTGGAGGCCAGGCAGCCAGGGG + Intergenic
1002100330 5:176854526-176854548 CAGAGGGGTCAGGGAGCCAGGGG - Intronic
1002457043 5:179351175-179351197 CCCTGCAGCCAGGGACCCAGGGG + Intergenic
1002821973 6:734411-734433 CAGCGCAGCCAGGAAGCCAGGGG + Intergenic
1004216892 6:13711635-13711657 CCGCGCGCCCAGGGAGACCGCGG + Intergenic
1006644485 6:35506351-35506373 CCGGGCTGCCAGGGAGCATGAGG - Intronic
1007631428 6:43275421-43275443 CCCCGGGGCCAGGGACCCAAAGG - Intronic
1007781563 6:44257495-44257517 AGGAGCGGCCAGCGAGCCAGCGG + Exonic
1008511968 6:52284523-52284545 CGGCCCGGCCGGGAAGCCAGAGG - Intronic
1012465735 6:99515113-99515135 CCGCGCGCCCAGGTCACCAGGGG + Exonic
1014741747 6:125154564-125154586 CCGCGCGCCACGGGAGGCAGAGG - Intronic
1015625896 6:135181073-135181095 GCGCGCGGGCAGGGAGCCCGGGG - Intergenic
1016589995 6:145734763-145734785 GCGCGCGGCCGGGCAGCCAAGGG + Intronic
1017422629 6:154288545-154288567 CCGAGCTACCAGGGAGCCTGAGG + Intronic
1017492966 6:154960145-154960167 CAGCGAGCCCAGGGACCCAGAGG + Intronic
1017738125 6:157381643-157381665 AGGCGCGGCCGGGGAGCCGGGGG + Exonic
1020074477 7:5248693-5248715 CCGCGTGGCCAGAGGGGCAGGGG - Intergenic
1022396121 7:29989467-29989489 CCGGGCGGGCTGGGAGCCTGGGG - Intronic
1022629384 7:32070924-32070946 AGGCGCGGCCAGGGAGTGAGCGG - Intronic
1024098718 7:46007086-46007108 CAGCATGCCCAGGGAGCCAGGGG - Intergenic
1025204624 7:56985114-56985136 CCGCGTGGCCAGAGGGGCAGGGG + Intergenic
1025667313 7:63591821-63591843 CCGCGTGGCCAGAGGGGCAGGGG - Intergenic
1026470980 7:70694146-70694168 CCGTCCAGCCAGGGAGCCCGCGG + Intronic
1029112200 7:98218097-98218119 CCGTGCGGCCCGGCAGCCGGTGG + Intronic
1029494556 7:100889964-100889986 GTGCGCGACTAGGGAGCCAGGGG - Intergenic
1034188299 7:149195766-149195788 CAGCGCGGCCATGGCGCCGGCGG - Intronic
1037262919 8:17027582-17027604 GAGCGCGGCCACGGAGCCCGAGG + Exonic
1037726019 8:21483137-21483159 CTTGGAGGCCAGGGAGCCAGAGG - Intergenic
1037811489 8:22089442-22089464 GGGCGCGGCCGGGGAGGCAGAGG - Intronic
1039484439 8:37899693-37899715 TGGCGCGGCCAGGCAGGCAGGGG + Intergenic
1040555837 8:48476887-48476909 CTGCATGGCCAGGGAGGCAGAGG - Intergenic
1042728199 8:71902158-71902180 CCACGTGGCCGGGGAGCCATCGG + Intronic
1045510075 8:102806897-102806919 CCGCGCGGCCCGGGGGGCGGGGG + Intergenic
1046924088 8:119767939-119767961 CCTCGAGGCCAGGGAGAGAGGGG + Intronic
1048345624 8:133572367-133572389 CCGGGAGGCCCGGGAGCCACTGG + Intergenic
1049166393 8:141128608-141128630 CCGCGCCGCCTGGGGGCCGGGGG - Exonic
1049546597 8:143234594-143234616 CCCTGGGTCCAGGGAGCCAGCGG - Intergenic
1049655536 8:143795373-143795395 CCCCAGGGCCAGGGAGCCCGAGG - Intronic
1050438001 9:5629481-5629503 CCGGGAGGCCGGGGAGGCAGCGG - Intronic
1053381249 9:37651054-37651076 CCGCGCGGACAAGGACCTAGCGG - Intronic
1053586511 9:39464373-39464395 CCGCGCGGCCCAGGAACCTGGGG - Intergenic
1053803736 9:41779867-41779889 CCACGCACACAGGGAGCCAGAGG - Intergenic
1054141534 9:61535256-61535278 CCACGCACACAGGGAGCCAGAGG + Intergenic
1054192036 9:61991259-61991281 CCACGCACACAGGGAGCCAGAGG - Intergenic
1054461231 9:65465973-65465995 CCACGCACACAGGGAGCCAGAGG + Intergenic
1054579795 9:66900860-66900882 CCGCGCGGCCCAGGAACCTGGGG + Intronic
1054646343 9:67596531-67596553 CCACGCACACAGGGAGCCAGAGG + Intergenic
1054835647 9:69672537-69672559 GCGCGCGGCCCGCGAGCCCGCGG + Intergenic
1056710824 9:88991128-88991150 CCGGGCGCCCAGAGACCCAGCGG - Exonic
1056992371 9:91423797-91423819 CCGCGCGGCCACGGCGCCCGCGG - Exonic
1057546093 9:96021383-96021405 CCTCCCGGGCAGGGAGCGAGGGG + Intergenic
1059115624 9:111598426-111598448 CCGCATTGCGAGGGAGCCAGGGG + Intronic
1060700734 9:125747319-125747341 CCGCGCGGGCGGGGAGCGCGCGG + Intergenic
1061504664 9:131025154-131025176 CCGGGCGGAGAGGGAGCCTGGGG - Intronic
1061540849 9:131277309-131277331 CCCTGCGCCCAGGGAGCCGGAGG - Intergenic
1061665992 9:132161458-132161480 CCTCCCGGCCCGGGGGCCAGCGG - Intergenic
1062218380 9:135401398-135401420 CTGTGCGGCCAATGAGCCAGTGG + Intergenic
1187648458 X:21374784-21374806 CCGCCCGCCCAGGGAGGCTGCGG + Intronic
1187648551 X:21375161-21375183 CGGAGCGGCCAGAGAGCTAGAGG + Intronic
1193708969 X:84856856-84856878 CTGCGCGGCCAGGCAGTGAGGGG - Intergenic
1199881152 X:151974895-151974917 CGGCGCTGCCAGACAGCCAGGGG + Intergenic
1199991462 X:152989842-152989864 CCACGTGGCCTGGGTGCCAGTGG + Exonic