ID: 1096670517

View in Genome Browser
Species Human (GRCh38)
Location 12:53195802-53195824
Sequence GGAACCAAGGTTCCACCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096670505_1096670517 16 Left 1096670505 12:53195763-53195785 CCCCACAACATGCAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 89
1096670504_1096670517 17 Left 1096670504 12:53195762-53195784 CCCCCACAACATGCAAGGTGCCC 0: 1
1: 0
2: 2
3: 21
4: 176
Right 1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 89
1096670500_1096670517 29 Left 1096670500 12:53195750-53195772 CCCCACAGGTTTCCCCCACAACA 0: 1
1: 0
2: 0
3: 48
4: 576
Right 1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 89
1096670512_1096670517 -4 Left 1096670512 12:53195783-53195805 CCTCAGCCCAGGGAATCCAGGAA 0: 1
1: 0
2: 2
3: 44
4: 531
Right 1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 89
1096670511_1096670517 -3 Left 1096670511 12:53195782-53195804 CCCTCAGCCCAGGGAATCCAGGA 0: 1
1: 0
2: 2
3: 38
4: 531
Right 1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 89
1096670507_1096670517 14 Left 1096670507 12:53195765-53195787 CCACAACATGCAAGGTGCCCTCA 0: 1
1: 0
2: 0
3: 13
4: 125
Right 1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 89
1096670501_1096670517 28 Left 1096670501 12:53195751-53195773 CCCACAGGTTTCCCCCACAACAT 0: 1
1: 0
2: 12
3: 187
4: 1155
Right 1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 89
1096670506_1096670517 15 Left 1096670506 12:53195764-53195786 CCCACAACATGCAAGGTGCCCTC 0: 1
1: 0
2: 0
3: 16
4: 124
Right 1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 89
1096670513_1096670517 -10 Left 1096670513 12:53195789-53195811 CCCAGGGAATCCAGGAACCAAGG 0: 1
1: 0
2: 0
3: 29
4: 227
Right 1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 89
1096670502_1096670517 27 Left 1096670502 12:53195752-53195774 CCACAGGTTTCCCCCACAACATG 0: 1
1: 0
2: 3
3: 50
4: 294
Right 1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096670517 Original CRISPR GGAACCAAGGTTCCACCAGC TGG Intronic
904211622 1:28889668-28889690 GCAGCCTAGGTTCCATCAGCTGG - Intronic
905965718 1:42093544-42093566 TGAACCAAGGCTGCTCCAGCTGG + Intergenic
908381938 1:63605088-63605110 GGAACCCTGGTTCCACCCTCAGG + Intronic
908398863 1:63751400-63751422 TGAAACAAGTTTCCACCAACTGG - Intergenic
917390319 1:174529637-174529659 GGAACCAAGGCTTCAACACCTGG - Intronic
919793601 1:201307984-201308006 GAAACCAAGCTTCTGCCAGCAGG - Intronic
920964012 1:210687393-210687415 AGACCCATGGTTCCACCAACAGG - Intronic
921774653 1:219082644-219082666 GGAACCTAGGTTCCAAACGCTGG + Intergenic
1063184011 10:3634120-3634142 TGCACCCACGTTCCACCAGCTGG - Intergenic
1064072973 10:12246528-12246550 GGGACCAAGATTCCTCCAGGTGG - Intronic
1068553298 10:58429832-58429854 GCAACCTAGTTTCCATCAGCAGG - Intergenic
1069687321 10:70326557-70326579 GAACCCAAGGTTCCATCAACAGG + Intronic
1078851199 11:15165628-15165650 GGTACCAGGGTACCACCACCAGG - Intronic
1079479942 11:20869022-20869044 GGAACCAAGGGTCCAGCGGTTGG + Intronic
1084564801 11:69922617-69922639 GGAGCTAGGGTTCCTCCAGCTGG + Intergenic
1085393606 11:76194936-76194958 GTAACCAAGGTGACGCCAGCAGG + Intronic
1085551054 11:77372534-77372556 TGAACCATGCTTCCACCAGTGGG - Intronic
1088919347 11:114250221-114250243 GGAAGCTGGGTTCCTCCAGCTGG - Intronic
1094525362 12:31227517-31227539 GGAACCAAGGGCTTACCAGCTGG - Intergenic
1095310074 12:40688358-40688380 GTAACCAAGGTTCTGCCTGCTGG - Intergenic
1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG + Intronic
1097426121 12:59446565-59446587 GGAACTCAGGTTCCAGCAGCTGG + Intergenic
1099747933 12:86731615-86731637 GGAAACAAAGTGCCACAAGCTGG - Intronic
1106350077 13:28921690-28921712 GAAACTCAGGTTCCACCTGCTGG + Intronic
1110773238 13:79375504-79375526 CAAACCAAAGTTCCACCAGTAGG + Intronic
1111162735 13:84417171-84417193 GGAAGCAAGGTTCCACTAGGGGG + Intergenic
1113082611 13:106534728-106534750 GGAACCGAGGTTCCAGAAACAGG + Intronic
1115642111 14:35341555-35341577 GGGCCCAAGGTTCACCCAGCTGG - Intergenic
1122071420 14:99207893-99207915 GGAACTGAGCTCCCACCAGCTGG + Intronic
1123053954 14:105560550-105560572 GGAACTTCGTTTCCACCAGCAGG + Intergenic
1123078539 14:105680967-105680989 GGAACTTCGTTTCCACCAGCAGG + Intergenic
1123426599 15:20176121-20176143 GGAATGAAGGTTCCCCCACCAGG - Intergenic
1123535830 15:21182648-21182670 GGAATGAAGGTTCCCCCACCAGG - Intergenic
1124343134 15:28902781-28902803 GGAGCCAAGGTCCCACCACCAGG - Intronic
1124621128 15:31274723-31274745 GGAACCAAGGGACACCCAGCAGG - Intergenic
1129071708 15:72956876-72956898 AAAACCAAGGTTCCATCAGTGGG - Intergenic
1129329818 15:74821243-74821265 GCATCCAAGGCTCCACCTGCGGG + Intronic
1129642289 15:77393107-77393129 GGAACTCAGGTTCCAGCTGCTGG - Intronic
1133996104 16:10749729-10749751 AGAGCCAAGCTTCCACCAGATGG - Intronic
1145904930 17:28511080-28511102 GAAACCGAGGTCCCACCAGTGGG - Intronic
1146242663 17:31244474-31244496 GGAACTCAGGTTTCAACAGCTGG + Intronic
1150476289 17:65478370-65478392 GGGACTAAGGATCCACCATCAGG + Intergenic
1153638255 18:7131877-7131899 GAAACGAAGCTTCCATCAGCTGG - Intergenic
1160520317 18:79504619-79504641 GGCACCACGTTTCCAACAGCAGG - Intronic
1162001565 19:7747475-7747497 GGAACCAAGACTGCAGCAGCTGG - Exonic
1162003507 19:7763281-7763303 GGAACCAAGGGTGCAGCAGCTGG + Exonic
1163161707 19:15468816-15468838 TGATCCAGGGTTCCACCACCAGG - Intronic
1163967699 19:20763450-20763472 GGAACAATGTTTTCACCAGCAGG + Intronic
1164769825 19:30799964-30799986 GGAACCAAGGCTCGTGCAGCAGG - Intergenic
1168713372 19:58513971-58513993 GGAACCACGGGTCCCGCAGCGGG + Exonic
925719900 2:6817243-6817265 GCAACCCATGGTCCACCAGCTGG + Intergenic
927645314 2:24873562-24873584 GTATCCAAGGTTACCCCAGCAGG - Intronic
929957407 2:46469051-46469073 GGAAACAAATTTCCACCAGAAGG - Intronic
930878386 2:56245231-56245253 GAAACTCAAGTTCCACCAGCTGG + Intronic
935129825 2:100253332-100253354 AGAAGCAAGGTTTCACCAACCGG - Intergenic
944055799 2:195520747-195520769 TGAAAGAATGTTCCACCAGCGGG - Intergenic
947202473 2:227626915-227626937 GGAACCAAGCCACCACCAGGAGG + Intronic
1170709347 20:18775985-18776007 GGAACTCAGGTTCCAACCGCTGG + Intergenic
1173182475 20:40815469-40815491 GGAGCCCAGCTTCCACCTGCAGG + Intergenic
1173828053 20:46059570-46059592 GGAACCAAAGTTGCACTATCTGG + Intronic
1181878686 22:25960113-25960135 GGAAGCAAAGTTCCACCGGAGGG - Intronic
1182960425 22:34467106-34467128 GTAACAAAGCTTCCACCAGAGGG + Intergenic
950560091 3:13716156-13716178 AGAACCCAGGTTCCCACAGCAGG + Intergenic
963066150 3:141266092-141266114 GAAACCAGGGCTTCACCAGCAGG - Intronic
963469500 3:145722220-145722242 GGAATTAAGGTTCAACTAGCAGG - Intergenic
966919624 3:184603108-184603130 GAAGGCGAGGTTCCACCAGCTGG - Intronic
971047267 4:22818787-22818809 GGAACCAGGGATACAGCAGCCGG + Intergenic
971564075 4:28116746-28116768 AGAACAAAGCTTCCACAAGCTGG + Intergenic
977452226 4:97213238-97213260 GTGAGCAAGGTTTCACCAGCAGG - Intronic
979452258 4:120886369-120886391 TGAACCAAGTTCCCAACAGCAGG + Intronic
981220679 4:142229995-142230017 GAAACCAAGGTACCACTAACTGG + Intronic
988169844 5:27639329-27639351 GGAACCTAGGTTCCAACTGCTGG + Intergenic
995573261 5:113503483-113503505 GGAACTCAGGTTCCAACTGCCGG + Intergenic
1000535496 5:162473100-162473122 GAGACCAAGATTCCACCAGAAGG + Intergenic
1004917572 6:20346137-20346159 GAAACCCAGATTCCACCATCTGG - Intergenic
1006428930 6:33983310-33983332 GGCACCAGGGTTCCATCTGCCGG - Intergenic
1006489940 6:34378709-34378731 GGGACTAAGGCTCCACCAGTTGG - Intronic
1011291252 6:85779574-85779596 GAAACTCAGGTTCCAGCAGCTGG + Intergenic
1015881047 6:137870062-137870084 GGAAAGAAGTTTCCACCAGGAGG - Intronic
1019837911 7:3408771-3408793 GCAAATAAGGTTCCAACAGCAGG - Intronic
1023852545 7:44158467-44158489 GGACCCACAGCTCCACCAGCCGG - Intronic
1024109841 7:46133978-46134000 GGAAACAAGCTCCCACCAGCAGG + Intergenic
1024576004 7:50764612-50764634 AGAACCCAGCCTCCACCAGCTGG + Intronic
1026759269 7:73114245-73114267 GGACCCAAGTGTCCACCAGCAGG - Intergenic
1027088139 7:75279228-75279250 GGACCCAAGTGTCCACCAGCAGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029394247 7:100296386-100296408 GGACCCAAGTGTCCACCAGCAGG + Intergenic
1044013686 8:87025291-87025313 GGGACCCAGGTTGCCCCAGCTGG - Intronic
1044995639 8:97835694-97835716 GGCTCCAAGGCACCACCAGCAGG - Intronic
1045857294 8:106779128-106779150 AGAACCATGGTTCCAGCTGCTGG + Intergenic
1050592563 9:7175108-7175130 GGTACCGAGGTGCCACCTGCTGG - Intergenic
1058806833 9:108600972-108600994 TGAAACAAGGTTCCCACAGCAGG + Intergenic
1059473343 9:114524076-114524098 GGCACCATGGTTCCACCATAGGG + Intergenic
1061586122 9:131569929-131569951 GGACCCAAGGGTACAACAGCTGG - Intergenic
1061754055 9:132800328-132800350 AGAACCCATGTTTCACCAGCAGG - Intronic
1061774753 9:132954276-132954298 AGAAACAAGGTTTTACCAGCAGG + Intronic
1192065339 X:67879405-67879427 GGAAACCAGGTTCCAACTGCTGG - Intergenic
1193090743 X:77491556-77491578 GGGAACAAGTTCCCACCAGCAGG + Intergenic
1197015915 X:121626314-121626336 GGAACTCAGGTTCCAATAGCTGG - Intergenic