ID: 1096670900

View in Genome Browser
Species Human (GRCh38)
Location 12:53197739-53197761
Sequence CGCTGCGGCCTGGTGAGTTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096670900_1096670905 -4 Left 1096670900 12:53197739-53197761 CCCTAACTCACCAGGCCGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1096670905 12:53197758-53197780 AGCGTGACCCGGACCCGCTGCGG 0: 1
1: 0
2: 0
3: 3
4: 43
1096670900_1096670915 25 Left 1096670900 12:53197739-53197761 CCCTAACTCACCAGGCCGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1096670915 12:53197787-53197809 CTGGGTGGCACCCTCTCCGCGGG 0: 1
1: 0
2: 1
3: 19
4: 168
1096670900_1096670908 6 Left 1096670900 12:53197739-53197761 CCCTAACTCACCAGGCCGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1096670908 12:53197768-53197790 GGACCCGCTGCGGCGCCAGCTGG 0: 1
1: 0
2: 0
3: 26
4: 139
1096670900_1096670914 24 Left 1096670900 12:53197739-53197761 CCCTAACTCACCAGGCCGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1096670914 12:53197786-53197808 GCTGGGTGGCACCCTCTCCGCGG 0: 1
1: 0
2: 0
3: 14
4: 143
1096670900_1096670909 7 Left 1096670900 12:53197739-53197761 CCCTAACTCACCAGGCCGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1096670909 12:53197769-53197791 GACCCGCTGCGGCGCCAGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 87
1096670900_1096670912 10 Left 1096670900 12:53197739-53197761 CCCTAACTCACCAGGCCGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1096670912 12:53197772-53197794 CCGCTGCGGCGCCAGCTGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096670900 Original CRISPR CGCTGCGGCCTGGTGAGTTA GGG (reversed) Exonic
900289712 1:1918795-1918817 GGAGGCGGCCTGGTGAGGTAAGG + Intronic
900795513 1:4705933-4705955 CGCTGTGGCATGGTGACCTACGG + Intronic
903883629 1:26529327-26529349 CTCTAGGGCCTGGTGAGTTGAGG + Intergenic
906525374 1:46490464-46490486 AGATGCGGCCTGGGGAGTTGCGG + Intergenic
913263864 1:117025577-117025599 CGCTGCAGCCTGGAGAGTGTAGG + Exonic
914803113 1:150974608-150974630 CGCTGCCGCCGGGTGAGTCGGGG - Exonic
915153837 1:153858148-153858170 TTCTTCTGCCTGGTGAGTTATGG + Intronic
916666128 1:166969197-166969219 CGCTGCCTCCTGGTGAGGCAAGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
1065189263 10:23195282-23195304 CGCAGCGGCCTGGTGGGCGAAGG + Intergenic
1073207629 10:101776973-101776995 CCCTGCTGCCTGCTGAGGTACGG - Intronic
1075483894 10:122804871-122804893 TGCTGCCGCCTGCTGAGTTCCGG + Intergenic
1075536813 10:123278380-123278402 GGCTGGGGCATGGTGTGTTATGG - Intergenic
1076640141 10:131910112-131910134 CGCTGCCACCTGGCGAGTTATGG - Intronic
1077087705 11:762922-762944 AGCTGAGCCCTGGTGAGTTCTGG + Intronic
1084375659 11:68775332-68775354 CACTGCAGCCTGGTGGGGTACGG + Exonic
1086572530 11:88302022-88302044 CGCTGGGGGCTGGTGAGTGGAGG - Intronic
1091369277 11:135045107-135045129 CTCTGGGGCCTGGTGAGATTTGG + Intergenic
1096670900 12:53197739-53197761 CGCTGCGGCCTGGTGAGTTAGGG - Exonic
1103958164 12:124591065-124591087 CGGGGCTGGCTGGTGAGTTAGGG - Intergenic
1104790735 12:131480612-131480634 CGCTGTGGCCTGTTGAGCTGGGG - Intergenic
1105716023 13:23065740-23065762 CGCAAGTGCCTGGTGAGTTACGG - Intergenic
1107021371 13:35755919-35755941 GGCTGCAGTCTGGAGAGTTAAGG - Intergenic
1112531360 13:100206961-100206983 TGATGAGGACTGGTGAGTTATGG - Intronic
1113536099 13:111067371-111067393 CTCTGCGGCCCGGTGAGATCGGG + Intergenic
1122878710 14:104680376-104680398 CTCTGCTGCCTGCTGAGATAGGG - Intergenic
1125720024 15:41840856-41840878 CTCTGCGGGCTGGGGAGTTCCGG + Exonic
1127827956 15:62722396-62722418 GGCTGCGGCCTGGTCACTCACGG - Exonic
1141730520 16:85819912-85819934 AGCAGCTGCCTGGTGAGTAATGG - Intergenic
1142206335 16:88784890-88784912 CGCTGCTGGCTGGTGAGTGGGGG - Exonic
1151959980 17:77400707-77400729 CTCTGTGGCCTGGTGAGGCAGGG + Intronic
1153926695 18:9841010-9841032 CGCTTGAGCCTGGTGAGTTTGGG - Intronic
1155131860 18:22943353-22943375 CGCTTGGGCCTGGTAAGTCAAGG + Intronic
1156544081 18:37946411-37946433 GGCTGCTACCTGGTGAGTCAGGG + Intergenic
1164460520 19:28443748-28443770 GGCAGCAGCCTGGTGAGTAAGGG + Intergenic
1164537025 19:29093433-29093455 CGGTGCGTCCTGGTCAGTTCAGG - Intergenic
1165419230 19:35714877-35714899 AGCTGCAGCCTGGAGAGCTAAGG + Exonic
931176280 2:59858220-59858242 CACTGCGGGCTGGGGAGTTAAGG - Intergenic
933594424 2:84268329-84268351 CACTGGGGCCTGTTGAGGTAGGG + Intergenic
938932427 2:136098589-136098611 GGCTGAGGCCTGGTGAGCAAGGG - Intergenic
948625480 2:239265640-239265662 CGCTGTGGCCTGGTGAGCATTGG - Intronic
1172174522 20:32964139-32964161 CGCTGGAGCCTGGGGAGTTGAGG - Intergenic
1173880273 20:46406537-46406559 GTCTGCGCCCTGGTGAGTGAGGG - Exonic
1176118206 20:63442395-63442417 TGGTGGGGCCTGGTGAGTTGTGG - Exonic
1179967032 21:44813279-44813301 AGCTGCTGCCTGGTGTGTTGGGG - Intronic
1184539080 22:45107813-45107835 GGCTGCAACCTGGTGAGTGAGGG - Intergenic
1185156546 22:49196505-49196527 AGCTGGGGCCTGGTGACTGAGGG + Intergenic
949143365 3:663447-663469 CACTCCGGCCTGGTGACATAGGG + Intergenic
950499018 3:13352433-13352455 CACTGGGGCCTGGTGGGTTGGGG - Intronic
952788301 3:37176756-37176778 CCCTGCGGCCTGGTGGGCTTGGG + Intronic
953383935 3:42494006-42494028 GGCTGCTGCCTGGTGAGGTGAGG - Intronic
954210368 3:49093791-49093813 CGCTGGGCCCTGGAGAGTTCGGG - Intronic
956607979 3:71092285-71092307 CGCTTGAACCTGGTGAGTTAGGG + Intronic
966868736 3:184276585-184276607 GGCTGGGGCCTGGTGAGAAAGGG - Intronic
967254620 3:187577018-187577040 CGCTGGGGCCTGGAGATTTCTGG + Intergenic
967795389 3:193593398-193593420 CGCTGTGGCCTGGTAAGTGCAGG + Exonic
969684617 4:8664168-8664190 CTGGGCGGCCTGGTGAGTCACGG - Intergenic
980586006 4:134816971-134816993 TTCTGCGGCCTGGAGAATTATGG + Intergenic
981739096 4:147984316-147984338 TGCTGGGGCCTGGAGAGTTTGGG - Intronic
998200316 5:140113700-140113722 GGCCTCGGCCTGGGGAGTTAGGG - Intronic
1000802690 5:165748237-165748259 TGCTGGGGCCTTGTGAGTGAAGG - Intergenic
1004155963 6:13168639-13168661 CGCCGAGGCCTGGGGACTTAGGG + Intronic
1015705761 6:136085808-136085830 CCCTGTGGCCTAGTCAGTTACGG - Intronic
1017073142 6:150594192-150594214 CACTGGGGCCTGGTAAGTCAAGG + Intergenic
1018735381 6:166683944-166683966 TGCTGCTGCCTGGTGAGCTCTGG - Intronic
1019901697 7:4026081-4026103 CGCTGCGGCCTGGCGTGTCCAGG - Intronic
1024710157 7:52006349-52006371 GACTGCGGTCTGATGAGTTAAGG - Intergenic
1030545420 7:110889120-110889142 GGCTGGGGACTGCTGAGTTAGGG - Intronic
1056258518 9:84824689-84824711 CTCTGTGTCCTGGTGAGTTCTGG + Intronic
1188580398 X:31705027-31705049 CCCAGTGGCCTTGTGAGTTATGG + Intronic
1192234332 X:69286185-69286207 CGCTGCGGCCGGGTGAGCCAAGG - Intergenic