ID: 1096673557

View in Genome Browser
Species Human (GRCh38)
Location 12:53214397-53214419
Sequence GGCAGGGCACTCTTCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096673557_1096673565 8 Left 1096673557 12:53214397-53214419 CCCAAAGTGAAGAGTGCCCTGCC 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1096673565 12:53214428-53214450 GCTCTGCCCATTCCTCACCGTGG 0: 1
1: 0
2: 0
3: 11
4: 197
1096673557_1096673570 25 Left 1096673557 12:53214397-53214419 CCCAAAGTGAAGAGTGCCCTGCC 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1096673570 12:53214445-53214467 CCGTGGTATACTTGCCCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096673557 Original CRISPR GGCAGGGCACTCTTCACTTT GGG (reversed) Intronic