ID: 1096673565

View in Genome Browser
Species Human (GRCh38)
Location 12:53214428-53214450
Sequence GCTCTGCCCATTCCTCACCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 197}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096673558_1096673565 7 Left 1096673558 12:53214398-53214420 CCAAAGTGAAGAGTGCCCTGCCC 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1096673565 12:53214428-53214450 GCTCTGCCCATTCCTCACCGTGG 0: 1
1: 0
2: 0
3: 11
4: 197
1096673553_1096673565 16 Left 1096673553 12:53214389-53214411 CCCCATTCCCCAAAGTGAAGAGT 0: 1
1: 0
2: 1
3: 21
4: 229
Right 1096673565 12:53214428-53214450 GCTCTGCCCATTCCTCACCGTGG 0: 1
1: 0
2: 0
3: 11
4: 197
1096673552_1096673565 20 Left 1096673552 12:53214385-53214407 CCAGCCCCATTCCCCAAAGTGAA 0: 1
1: 0
2: 1
3: 30
4: 336
Right 1096673565 12:53214428-53214450 GCTCTGCCCATTCCTCACCGTGG 0: 1
1: 0
2: 0
3: 11
4: 197
1096673551_1096673565 21 Left 1096673551 12:53214384-53214406 CCCAGCCCCATTCCCCAAAGTGA 0: 1
1: 0
2: 1
3: 38
4: 276
Right 1096673565 12:53214428-53214450 GCTCTGCCCATTCCTCACCGTGG 0: 1
1: 0
2: 0
3: 11
4: 197
1096673555_1096673565 14 Left 1096673555 12:53214391-53214413 CCATTCCCCAAAGTGAAGAGTGC 0: 1
1: 0
2: 0
3: 21
4: 170
Right 1096673565 12:53214428-53214450 GCTCTGCCCATTCCTCACCGTGG 0: 1
1: 0
2: 0
3: 11
4: 197
1096673554_1096673565 15 Left 1096673554 12:53214390-53214412 CCCATTCCCCAAAGTGAAGAGTG 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1096673565 12:53214428-53214450 GCTCTGCCCATTCCTCACCGTGG 0: 1
1: 0
2: 0
3: 11
4: 197
1096673562_1096673565 -9 Left 1096673562 12:53214414-53214436 CCTGCCCTCACTGGGCTCTGCCC 0: 1
1: 0
2: 9
3: 87
4: 682
Right 1096673565 12:53214428-53214450 GCTCTGCCCATTCCTCACCGTGG 0: 1
1: 0
2: 0
3: 11
4: 197
1096673550_1096673565 30 Left 1096673550 12:53214375-53214397 CCAACACAACCCAGCCCCATTCC 0: 1
1: 0
2: 1
3: 29
4: 402
Right 1096673565 12:53214428-53214450 GCTCTGCCCATTCCTCACCGTGG 0: 1
1: 0
2: 0
3: 11
4: 197
1096673556_1096673565 9 Left 1096673556 12:53214396-53214418 CCCCAAAGTGAAGAGTGCCCTGC 0: 1
1: 0
2: 0
3: 2
4: 145
Right 1096673565 12:53214428-53214450 GCTCTGCCCATTCCTCACCGTGG 0: 1
1: 0
2: 0
3: 11
4: 197
1096673557_1096673565 8 Left 1096673557 12:53214397-53214419 CCCAAAGTGAAGAGTGCCCTGCC 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1096673565 12:53214428-53214450 GCTCTGCCCATTCCTCACCGTGG 0: 1
1: 0
2: 0
3: 11
4: 197
1096673561_1096673565 -8 Left 1096673561 12:53214413-53214435 CCCTGCCCTCACTGGGCTCTGCC 0: 1
1: 0
2: 9
3: 85
4: 637
Right 1096673565 12:53214428-53214450 GCTCTGCCCATTCCTCACCGTGG 0: 1
1: 0
2: 0
3: 11
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096673565 Original CRISPR GCTCTGCCCATTCCTCACCG TGG Exonic