ID: 1096673570

View in Genome Browser
Species Human (GRCh38)
Location 12:53214445-53214467
Sequence CCGTGGTATACTTGCCCAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 25}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096673563_1096673570 4 Left 1096673563 12:53214418-53214440 CCCTCACTGGGCTCTGCCCATTC 0: 1
1: 0
2: 3
3: 37
4: 331
Right 1096673570 12:53214445-53214467 CCGTGGTATACTTGCCCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 25
1096673564_1096673570 3 Left 1096673564 12:53214419-53214441 CCTCACTGGGCTCTGCCCATTCC 0: 1
1: 0
2: 6
3: 49
4: 424
Right 1096673570 12:53214445-53214467 CCGTGGTATACTTGCCCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 25
1096673556_1096673570 26 Left 1096673556 12:53214396-53214418 CCCCAAAGTGAAGAGTGCCCTGC 0: 1
1: 0
2: 0
3: 2
4: 145
Right 1096673570 12:53214445-53214467 CCGTGGTATACTTGCCCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 25
1096673561_1096673570 9 Left 1096673561 12:53214413-53214435 CCCTGCCCTCACTGGGCTCTGCC 0: 1
1: 0
2: 9
3: 85
4: 637
Right 1096673570 12:53214445-53214467 CCGTGGTATACTTGCCCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 25
1096673557_1096673570 25 Left 1096673557 12:53214397-53214419 CCCAAAGTGAAGAGTGCCCTGCC 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1096673570 12:53214445-53214467 CCGTGGTATACTTGCCCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 25
1096673558_1096673570 24 Left 1096673558 12:53214398-53214420 CCAAAGTGAAGAGTGCCCTGCCC 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1096673570 12:53214445-53214467 CCGTGGTATACTTGCCCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 25
1096673562_1096673570 8 Left 1096673562 12:53214414-53214436 CCTGCCCTCACTGGGCTCTGCCC 0: 1
1: 0
2: 9
3: 87
4: 682
Right 1096673570 12:53214445-53214467 CCGTGGTATACTTGCCCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096673570 Original CRISPR CCGTGGTATACTTGCCCAGC TGG Exonic