ID: 1096673843

View in Genome Browser
Species Human (GRCh38)
Location 12:53215804-53215826
Sequence AAGCAGTGATGTGAGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096673838_1096673843 -8 Left 1096673838 12:53215789-53215811 CCACCGCTGGGAGGGAAGCAGTG 0: 1
1: 0
2: 7
3: 20
4: 199
Right 1096673843 12:53215804-53215826 AAGCAGTGATGTGAGGGTCAGGG 0: 1
1: 0
2: 1
3: 24
4: 239
1096673832_1096673843 22 Left 1096673832 12:53215759-53215781 CCATCTCCTCTGAGCTGGTGCTC 0: 1
1: 0
2: 5
3: 31
4: 279
Right 1096673843 12:53215804-53215826 AAGCAGTGATGTGAGGGTCAGGG 0: 1
1: 0
2: 1
3: 24
4: 239
1096673833_1096673843 16 Left 1096673833 12:53215765-53215787 CCTCTGAGCTGGTGCTCTGTGTC 0: 1
1: 0
2: 1
3: 34
4: 285
Right 1096673843 12:53215804-53215826 AAGCAGTGATGTGAGGGTCAGGG 0: 1
1: 0
2: 1
3: 24
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096673843 Original CRISPR AAGCAGTGATGTGAGGGTCA GGG Intronic
900141709 1:1141538-1141560 AAGCAGGGATGGGGGGGACAGGG - Intergenic
900319098 1:2073723-2073745 AGGCAGGGATGTGAGGGGCGGGG + Intronic
900371098 1:2332555-2332577 GGGCAGTGCTGTGAGGGGCACGG + Intronic
900591426 1:3461990-3462012 AAGCAGTAGTGTCAGGGGCAGGG + Intronic
901153580 1:7120950-7120972 CAGCAGAGATGTCAGGGCCAGGG + Intronic
902837133 1:19054436-19054458 AGGCAGTGCTGTGTGGCTCAGGG - Intergenic
903697412 1:25218106-25218128 CAGCAGTCAGGTGAGAGTCAAGG + Intergenic
904286482 1:29455974-29455996 TAGCAGTGTTGTGAAGGTCAGGG + Intergenic
905849922 1:41266092-41266114 TAGCAGTGATGTGAGGAAAAAGG + Intergenic
906424447 1:45698465-45698487 AAGCAGTTTTGTTTGGGTCAAGG + Intronic
906459540 1:46026887-46026909 AAGGAGGAACGTGAGGGTCAGGG - Intronic
906703239 1:47875084-47875106 AATCAGTGCTGTAAGGCTCATGG + Intronic
906995728 1:50791937-50791959 TAGCAGTGAATTGAAGGTCAAGG - Intronic
909184864 1:72474239-72474261 AAGCAGTAATGTGAGGAGAAAGG + Intergenic
910337490 1:86151556-86151578 AACCAGACATGTGAGGGTAAAGG + Intronic
911692476 1:100850142-100850164 AAGCAGAGATGTGAGGAAGAAGG + Intergenic
912823481 1:112885612-112885634 AAGCAGAGATGGGAGGCTGAGGG - Intergenic
912977578 1:114344591-114344613 AAGCAGAGATGGGAGAGACATGG + Intergenic
914387327 1:147182753-147182775 CAGCAGTGAAATGAGGGTCAAGG + Intronic
914945651 1:152063201-152063223 AAGCAATGATGGGGGGGCCAAGG - Intergenic
915462100 1:156076476-156076498 AAGCGGTGATTTGAGGGGCAAGG - Exonic
916576856 1:166075001-166075023 AAGCATGGATGTGAGTGTCCAGG + Intronic
917632754 1:176905974-176905996 GACCAGTGATGTGAGGGCCATGG + Intronic
918022390 1:180707915-180707937 AAGTAGTGATGTGAGGATGATGG + Intronic
920375040 1:205503779-205503801 AAGCAGAGATGAGAGGGGCCTGG + Intergenic
922559606 1:226559590-226559612 GAGCAGTGAGGAGAGGGTCCTGG - Intronic
924017271 1:239740883-239740905 ATGCACTGAGGTGAGGGTGAAGG + Intronic
1062977417 10:1695016-1695038 GAACAGGGATGTGTGGGTCATGG + Intronic
1063209769 10:3869500-3869522 GTGCAGACATGTGAGGGTCATGG + Intergenic
1064450810 10:15440605-15440627 ATGCAGTGACGTGAGGGTGGAGG + Intergenic
1064528567 10:16283745-16283767 AGGGAGAGATGTGAAGGTCAAGG + Intergenic
1065008926 10:21404369-21404391 ATTCACTGATGTGAGGGCCAAGG - Intergenic
1068008319 10:51416751-51416773 AGACAGAGATGTGTGGGTCATGG - Intronic
1070358351 10:75662434-75662456 AAACAGTGGGGTGAGGGTCTGGG + Intronic
1070674545 10:78403467-78403489 AAGCAGGGGTCTGAAGGTCATGG - Intergenic
1071431888 10:85612947-85612969 AAGGAGTGCTGGGAGGGACAGGG + Intronic
1072475992 10:95760316-95760338 AAGCACTGCTGGGAGGGTGAAGG - Intronic
1072764192 10:98082751-98082773 AAGCAGTGTTCTGACGGTGAGGG + Intergenic
1073894652 10:108141090-108141112 AAGTAATGATGTCAGTGTCAAGG - Intergenic
1074546138 10:114403838-114403860 AAGGAGGGATGCGAGGGTCGGGG - Intronic
1075418843 10:122285936-122285958 AAGCAGTGAAGTGTGGGCCTCGG - Intronic
1076224756 10:128765049-128765071 GAGCAGTAATGTGAAGATCAGGG + Intergenic
1078493731 11:11795233-11795255 CAGAAGTGAGGTGAGGGGCATGG + Intergenic
1078538768 11:12196852-12196874 GGCCAGTGAAGTGAGGGTCAGGG - Intronic
1083707689 11:64527496-64527518 ATGCAGAGATGTGCGGGGCAAGG - Intergenic
1085956609 11:81405410-81405432 AAGGAGAGATGTTTGGGTCATGG + Intergenic
1088266937 11:107996754-107996776 AAGGAATGATGTGACAGTCAGGG + Intergenic
1089021846 11:115223889-115223911 AAGCAGTGAATTGAGTTTCAGGG - Intronic
1090229027 11:125088671-125088693 CAGCAGTGATGGGCGGGTAATGG - Exonic
1090273857 11:125405976-125405998 CAGCAGGGATGTGAGGCTCTGGG + Intronic
1090984611 11:131755011-131755033 AAGCAGAAATGTGAAGGTCTGGG + Intronic
1091090963 11:132770938-132770960 AGGCAGAGATTTAAGGGTCAAGG - Intronic
1091760295 12:3082874-3082896 CAGCAGTGATTTCAGGGTCAAGG - Intronic
1092134981 12:6140740-6140762 AATTAGTGCTGTGAGGCTCAAGG + Intergenic
1095602195 12:44026475-44026497 AACCACTGATGAGAAGGTCAGGG - Intronic
1096673843 12:53215804-53215826 AAGCAGTGATGTGAGGGTCAGGG + Intronic
1096817755 12:54212363-54212385 AAGCATGGGTGTGAGGGTGAGGG + Intergenic
1100071396 12:90724000-90724022 AGGCTGTGACGGGAGGGTCAGGG - Intergenic
1100979589 12:100153989-100154011 CAGCAGTGGTGGGAGGGCCAGGG - Intergenic
1101012699 12:100467460-100467482 AAGCATGGACGTTAGGGTCAGGG - Intergenic
1101065750 12:101018665-101018687 ACACAGGTATGTGAGGGTCATGG - Intronic
1102635106 12:114316573-114316595 CATAAGTGATGTGAGGGGCAGGG - Intergenic
1104543480 12:129688549-129688571 AAGCAGTGGTGTGGGTTTCAAGG - Intronic
1105342324 13:19538939-19538961 AAGCTGAGATGTCAAGGTCAAGG + Intergenic
1105987800 13:25586367-25586389 AAGCCGTGAGGTGAGGTTGAGGG + Intronic
1108472493 13:50781549-50781571 AGGCAGTGATGTGGGGAACAAGG - Intronic
1110265458 13:73532198-73532220 AAACAGGAATGTGAGGCTCATGG - Intergenic
1110478796 13:75949672-75949694 AGGCAGTGAGGTGAGGTGCAGGG + Intergenic
1110537591 13:76669702-76669724 AACCAGTCATGTGAGGGTAGGGG - Intergenic
1112074388 13:95894120-95894142 AAGGAGTGAAGAGAGGGTCAAGG - Intronic
1113051018 13:106212292-106212314 AAGAAGTGAGGTGAGATTCAAGG + Intergenic
1113183445 13:107658742-107658764 AAGAAGTGATGAGTGGGTCAAGG - Intronic
1113374957 13:109756503-109756525 AAGCAGAGCTGTTAGGTTCATGG + Intronic
1113979461 13:114261482-114261504 AAGCAGTGAGGTCAGGGGCTGGG + Intronic
1115422466 14:33212326-33212348 ATGATGTGATGTGAGAGTCATGG + Intronic
1116073475 14:40080438-40080460 AAGAACTGATATGAGGGTGAAGG + Intergenic
1116805635 14:49491632-49491654 AAGAAGTCATGAGAGGGTGAGGG - Intergenic
1117323281 14:54644594-54644616 AGGCAGTGATGGAAGGGTCTTGG - Intronic
1117592133 14:57281513-57281535 AAGCAGAGATGTGACAGACAGGG - Intronic
1119133542 14:72196126-72196148 AAGCAGAGATGCGAGAGACACGG + Intronic
1119887571 14:78155846-78155868 AACCAGTGATGTGAGGTGCATGG + Intergenic
1125383282 15:39110438-39110460 AAGCAGTGATTTCAAGATCAAGG + Intergenic
1126405625 15:48319802-48319824 AAGCAGTAATCTGAGTGTCTTGG - Intergenic
1127441846 15:59016830-59016852 AAGCAGTAATGTAAGTGACAGGG - Intronic
1127821887 15:62665570-62665592 AAGCGGGGCTGTGAGAGTCAAGG - Intronic
1128312233 15:66638214-66638236 AAGCAGCCAAGTGAGGGTGAGGG + Intronic
1128859231 15:71051679-71051701 CAGCAGGGATGGGAGGGTTAGGG - Intronic
1129183353 15:73890887-73890909 AGGAAATGATGTGAGGTTCAAGG - Intergenic
1129598341 15:76982371-76982393 AAGCAGTTTTGTGAGGACCAAGG + Intergenic
1129622505 15:77161294-77161316 AACCAGTAAGGTAAGGGTCAAGG - Intronic
1131581895 15:93651480-93651502 ACCAAGTGATGAGAGGGTCAAGG + Intergenic
1132246031 15:100297066-100297088 AGGCAGTGATGCAAGGGCCAAGG + Intronic
1133693412 16:8237514-8237536 AAACAGTGGTGGGAGGTTCAGGG + Intergenic
1134063062 16:11210621-11210643 AAGCAGAGATGGGGGCGTCATGG + Intergenic
1134567408 16:15263392-15263414 AGGCAGTGTTGTGAGGATAAGGG + Intergenic
1134735084 16:16493308-16493330 AGGCAGTGTTGTGAGGATAAGGG - Intergenic
1134932437 16:18218909-18218931 AGGCAGTGTTGTGAGGATAAGGG + Intergenic
1135002451 16:18788377-18788399 AAGCAGTGAAGGAAGGGTCAAGG - Intronic
1135729742 16:24884018-24884040 GAGCACGGAGGTGAGGGTCAGGG - Intronic
1136037056 16:27548596-27548618 AAGCCATATTGTGAGGGTCAGGG - Intronic
1137355431 16:47758414-47758436 ATGCCATGAAGTGAGGGTCAAGG - Intergenic
1137560127 16:49497071-49497093 AAGCAGTGATTTGTGGGTACAGG - Intronic
1141674779 16:85512033-85512055 TCGCAGTGTTGTGAGGGTCCGGG + Intergenic
1142333584 16:89472030-89472052 AAGTAGTCACCTGAGGGTCAAGG - Intronic
1143500583 17:7336516-7336538 AGGCAGTGCTGGGAGGGGCAGGG - Exonic
1144205053 17:12974086-12974108 CAGCATGGGTGTGAGGGTCATGG + Exonic
1144827014 17:18111002-18111024 AAGAAGAGCTGTGAAGGTCAGGG - Intronic
1148707967 17:49652657-49652679 ATGCAGGGATGAAAGGGTCAGGG - Intronic
1149585257 17:57782265-57782287 AAGCAGAGATGTGAGGGAGGAGG - Intergenic
1152003444 17:77662019-77662041 AAGGAGTGAGAGGAGGGTCAGGG + Intergenic
1152338753 17:79713064-79713086 AAACAGAGAGGTGAGGCTCAGGG - Intergenic
1152744528 17:82032683-82032705 GAGCAGTGAGGGCAGGGTCAGGG - Intronic
1153116660 18:1665329-1665351 ATACTGTGATGAGAGGGTCAGGG - Intergenic
1153478338 18:5520968-5520990 AAGGAGTGGTGTGTGGGTTATGG - Intronic
1153953765 18:10078699-10078721 AAGCTGTGATGTGAGCTTCAGGG + Intergenic
1154949118 18:21191007-21191029 ACGCAGTGAGGTGAGGCTCTGGG + Intergenic
1155107438 18:22681424-22681446 GAGCAGTGACTTCAGGGTCAGGG + Intergenic
1157785750 18:50481160-50481182 AAGCAGTAAAGTGAGGCTCAGGG + Intergenic
1159816244 18:73077364-73077386 ACGCAGTGATATGAGTGGCAGGG - Intergenic
1159998541 18:74992588-74992610 AAGAAGGGCTGTGAGCGTCACGG + Intronic
1160231316 18:77051742-77051764 AAGCAGTGGTGTGACAGTGATGG + Intronic
1160270937 18:77382870-77382892 GAGCAGTGATGATGGGGTCAGGG + Intergenic
1161156088 19:2732564-2732586 TAGCAGTGCTCTGAGGCTCAGGG + Exonic
1162959832 19:14118953-14118975 AAGCACTTAAGAGAGGGTCAGGG + Intergenic
1163597705 19:18229966-18229988 AAGCATTCAGGTGAGGGCCATGG - Intronic
1166089188 19:40497313-40497335 TAGCTGTGATGTGAGTGTGATGG - Intronic
1167308979 19:48725554-48725576 AAGAAGTGGTGTTAAGGTCAAGG + Intronic
1167445506 19:49534909-49534931 AAGGAGGGATCTGAGAGTCAGGG - Intronic
1167596835 19:50432461-50432483 AAGCAGGGAGGGGAGGGACAGGG - Intergenic
925799630 2:7585458-7585480 AAGCATTGAGGTGAGGGACAGGG - Intergenic
933560609 2:83881129-83881151 AAGCACTGATGAGAAGGTAATGG + Intergenic
933577536 2:84086734-84086756 AAACAGTGATGTCAGGGAAATGG - Intergenic
933697723 2:85232446-85232468 CAGCAGTGATATGAGTGTCCTGG + Intronic
934718498 2:96556912-96556934 AAGCAGTGAGGTAAAGGGCAGGG - Intergenic
934721392 2:96579529-96579551 AAGCAGGGATGTGAGGGAGAAGG - Intergenic
935567233 2:104621488-104621510 AAGCAGGGGTGTGGGGGTAAGGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937505005 2:122527013-122527035 AAGCTTTGAGGAGAGGGTCAGGG - Intergenic
938163617 2:129008139-129008161 ATGGAGTGATGTGCAGGTCATGG - Intergenic
940030737 2:149258860-149258882 AAGGAGTGGTGTTAAGGTCAAGG + Intergenic
945584551 2:211643045-211643067 ACGCAGTGTGGTGAGGGTGAGGG - Intronic
947706985 2:232284263-232284285 AAGCACTGAACTGAGAGTCAGGG + Intronic
947740486 2:232482654-232482676 AAGCTGTGATGTGAGGGTAGCGG - Intronic
948015197 2:234683219-234683241 TAGCAGTGATGTGATGGTGGTGG + Intergenic
948015204 2:234683263-234683285 TAGCAGTGATGTGATGGTGGTGG + Intergenic
1173381687 20:42550322-42550344 AAGCAGTGATGTGAGTGGGAAGG + Intronic
1174424841 20:50424610-50424632 AAGCAGTGGTGTGAGGGCTCAGG - Intergenic
1174769299 20:53283469-53283491 AAGCTGTGTGGTGATGGTCAAGG - Intronic
1177946219 21:27472586-27472608 AAGCACTTATGTGCTGGTCAAGG + Intergenic
1178904383 21:36624428-36624450 AAGCAGTCATGTGGGTCTCAAGG + Intergenic
1183051975 22:35270202-35270224 AGGCAGTAATGTGAGCGACAGGG - Intronic
950834291 3:15904381-15904403 AAGCATTGATGTCATGGTCAGGG - Intergenic
951747023 3:25990015-25990037 AAGCAGTAATGAGAGAGTAATGG + Intergenic
951924272 3:27889949-27889971 AAGAAGTGACGTCAGGGTTAGGG - Intergenic
956588346 3:70887284-70887306 AAACCGTGGTCTGAGGGTCAGGG + Intergenic
956928476 3:74015673-74015695 AGGCAGTGAGGTCTGGGTCATGG + Intergenic
957969263 3:87362270-87362292 TAGTAGAGATGTGAGGGGCAGGG - Intergenic
962201321 3:133403302-133403324 AAGGAGTGCTGTGAGGAGCACGG - Intronic
962642746 3:137405235-137405257 AAGAGGTGATGTGAGGGAGAAGG - Intergenic
962982703 3:140505226-140505248 GAGCAATGATGTGATGTTCATGG + Intronic
969298118 4:6281376-6281398 AAGCAGGGCCCTGAGGGTCAGGG + Intronic
970569441 4:17365448-17365470 AAACAGTGATGTGCTGGTGAAGG + Intergenic
972046155 4:34666830-34666852 AAGAAGTGATGGGAGGGTATTGG + Intergenic
972095644 4:35343868-35343890 TAGCAGTAAAGTGAGTGTCATGG - Intergenic
972650990 4:41017478-41017500 AAGCACAGATCTCAGGGTCAAGG + Intronic
976263959 4:83172923-83172945 AAGCAGCTATGTCAGGCTCAAGG + Intergenic
976779883 4:88747265-88747287 AAGCAGGGCTGTGAGGCACATGG + Intronic
979788074 4:124741969-124741991 AGGCAGGGAAGTGAGGGGCATGG + Intergenic
982202294 4:152972789-152972811 AGGCATTAATGTGAGTGTCAGGG - Intronic
983266197 4:165510743-165510765 AAGGAGTCATGGGAAGGTCATGG + Intergenic
983279717 4:165665229-165665251 AAGAAGTGCTGTGATGGTCCTGG - Intergenic
983875709 4:172872240-172872262 AAGCAATTATGTGATCGTCAGGG + Intronic
983985267 4:174052233-174052255 AAGGAGTTATGAGTGGGTCATGG - Intergenic
985118873 4:186619454-186619476 GAGCAGTGATGTGATTGTCACGG - Exonic
987424398 5:17756379-17756401 GAGCAGAGGTGTCAGGGTCATGG - Intergenic
987520050 5:18970163-18970185 AAGCAGTGAGGTGAGGGCAGAGG + Intergenic
988979277 5:36549371-36549393 GTGTAGTGATGTGAGGCTCACGG - Intergenic
990204080 5:53410124-53410146 ATGATGTGATGTAAGGGTCAAGG + Intergenic
991012872 5:61901977-61901999 AAGCAATGCTGTGAGGGAAATGG - Intergenic
992189201 5:74274368-74274390 ATGCTGTGATGTGAGGCTCATGG - Intergenic
993702766 5:91137691-91137713 AAGCAGTGGTCTGAGATTCAGGG + Intronic
994602691 5:101926868-101926890 AAGCAGAGATCTGAGTGACATGG + Intergenic
996584847 5:125074845-125074867 AAGCAGTGATATGAGGACTAAGG - Intergenic
997073471 5:130643964-130643986 AATGAGTTATGTGAGGGGCAGGG - Intergenic
997451844 5:133989995-133990017 ATATAGTGATGTTAGGGTCAAGG - Intronic
998127557 5:139634731-139634753 AAGGAGTGGGGTCAGGGTCAGGG + Intergenic
998152466 5:139765139-139765161 AACCAGGGGTGGGAGGGTCACGG - Intergenic
998416232 5:141948193-141948215 AAGGAAAAATGTGAGGGTCAGGG - Intronic
999089643 5:148924987-148925009 AAGCAGTGAGGTAAGCTTCAGGG + Intronic
999154382 5:149447917-149447939 AAGCAGGGATCTGAGTGACATGG - Intergenic
1001830828 5:174788026-174788048 AAGAAGAGATGTGAGGGGCCAGG - Intergenic
1005190308 6:23214055-23214077 AAGCAGTGATCTGAGAGGGATGG + Intergenic
1005605909 6:27477312-27477334 GAGAAGCAATGTGAGGGTCAGGG + Intergenic
1006326718 6:33359875-33359897 AGGCAGGGAGGTGAGAGTCAAGG + Intergenic
1006943019 6:37765491-37765513 AAGCAGTGAGGGGAGGGTGGAGG - Intergenic
1007787659 6:44290530-44290552 CAGGAGTGATGTGAAGGGCAAGG + Intronic
1008124135 6:47649647-47649669 AAGCAGTAAGGTGAGGGGCTGGG + Intergenic
1012981967 6:105840654-105840676 AAGGAGGGAGATGAGGGTCAGGG - Intergenic
1013982221 6:116144962-116144984 AAGAAGTGATCTGAGGGAAAAGG + Intronic
1014058944 6:117048997-117049019 AATCAGTGATGTGAAGATAAGGG - Intergenic
1015000388 6:128207204-128207226 GAGCAGTAATGTGAGAGTCCAGG - Intronic
1016886972 6:148967831-148967853 AAGCAGCTCTGTGAGGCTCAGGG - Intronic
1017006410 6:150030662-150030684 CAGCTGTGATCTGAGGGTGAGGG + Intergenic
1018654681 6:166024186-166024208 AAGGAGTGAGGTGGGGGACAGGG + Intergenic
1019317813 7:398550-398572 GGACAGTGATGTGAGGGTGATGG - Intergenic
1019448502 7:1083848-1083870 AAACAGTGCGGTGAGGGGCAGGG - Intronic
1020906726 7:14072556-14072578 AAGGAGAGATGTGAGGTTCCTGG + Intergenic
1021924786 7:25523840-25523862 AAGCAGTGGCGTGGGGGTAATGG + Intergenic
1022894644 7:34737770-34737792 AAGCATTGATCTGAGGGGTAGGG - Intronic
1024300738 7:47885683-47885705 TACCAGAGAGGTGAGGGTCAGGG + Exonic
1026651237 7:72217442-72217464 AAGCGGTGATGTCAGGGCCAGGG - Intronic
1028506207 7:91572905-91572927 AAGGTGTGATGTGAAGGTCTTGG + Intergenic
1028511686 7:91632262-91632284 CAGCAGTGCTGTGAGGGTTGGGG + Intergenic
1031392889 7:121237748-121237770 AAGCTGTGGTGTGAAGTTCATGG - Intronic
1031433222 7:121699127-121699149 CAGCAGTCATCTGTGGGTCATGG - Intergenic
1031523707 7:122798252-122798274 AAGTATTGATGTTTGGGTCAAGG - Intronic
1033039776 7:137907389-137907411 AAGGAGTGAAGTCAGGTTCAAGG + Intronic
1033778815 7:144645522-144645544 AGGCAGTAAAATGAGGGTCAAGG - Intronic
1034548539 7:151805335-151805357 AGGGAGTGATGTGAGAGTGAAGG + Intronic
1034634773 7:152558525-152558547 GAGAAGTGGTGTGAGGGACAAGG - Intergenic
1035975320 8:4304030-4304052 AAGCAGTGATGAGAGAACCAGGG + Intronic
1035999967 8:4591730-4591752 AAGCAGTGAAGTGAGGGGATAGG + Intronic
1036950544 8:13134982-13135004 AAGCGGTGCTGTGAGGGCCCAGG + Intronic
1038065691 8:23961585-23961607 CAGCAGTGATCAGAGGGGCAGGG + Intergenic
1040436614 8:47397724-47397746 AAGGAGTGACGACAGGGTCATGG + Intronic
1040656545 8:49516705-49516727 ATGCAGTTAAGTAAGGGTCAGGG + Intergenic
1045192332 8:99895274-99895296 GAGCACTGATGTGATGCTCAAGG - Intergenic
1045664987 8:104474850-104474872 ATGCAGTGTTGTGAGGGTTCTGG - Intergenic
1046295744 8:112217624-112217646 AAGCAGTGATGAGAGGGTTACGG + Intergenic
1047359953 8:124160078-124160100 AAGCAGTGCTGGAAAGGTCAGGG - Intergenic
1048161026 8:132022231-132022253 AAGCAGTGCAGAGAGGGCCAGGG - Intergenic
1049026548 8:139994759-139994781 AAGCAATCATGTGATGGTCTTGG + Intronic
1049176299 8:141194593-141194615 AACCAGAGACGTGAGGGCCACGG - Exonic
1049572488 8:143375826-143375848 AGGCAGGTCTGTGAGGGTCATGG - Intronic
1050567190 9:6897995-6898017 AAGCAGACCTGTGAGTGTCACGG - Intronic
1051168214 9:14288754-14288776 AAGTAGAAATGAGAGGGTCATGG - Intronic
1052412953 9:28146259-28146281 AAGCAGGGATTTGAGGGCCCAGG - Intronic
1054969727 9:71071243-71071265 AAGCCGTGTTTTGAGGGTAACGG + Intronic
1055780474 9:79815706-79815728 AAGCAGTAAACTGAGGGACAGGG - Intergenic
1056330789 9:85519558-85519580 AAGCAGAGAGGTGGGAGTCAGGG - Intergenic
1056759855 9:89406744-89406766 CAGGAGTCCTGTGAGGGTCATGG + Intronic
1056814813 9:89793297-89793319 GAGCAGCGCTGTGAGGGTCAGGG + Intergenic
1060968141 9:127722999-127723021 ATGGAGGGATGTGAGGGGCACGG + Intronic
1061225934 9:129281003-129281025 AAGCTGTGAGGTCAGGGTAAGGG + Intergenic
1187174752 X:16886206-16886228 AAGCAGTGATGTGTTGGAGAAGG - Intergenic
1189125470 X:38441285-38441307 AAGCAGTGAAATGTGGTTCATGG + Intronic
1189580388 X:42400057-42400079 TAGCTGTGATCTGAGGCTCAAGG + Intergenic
1189755815 X:44270367-44270389 AAGCAGGGATTTGAGGGCCATGG - Intronic
1189919005 X:45885186-45885208 GAGCAGTGATTTGAAAGTCAGGG - Intergenic
1190212690 X:48460575-48460597 AGGCATGGATGTGTGGGTCAAGG - Intronic
1190680256 X:52820517-52820539 AGGCAGTGATGGGATAGTCAGGG - Intergenic
1191872223 X:65757448-65757470 AGGCATTGATGGGAGAGTCATGG - Intergenic
1192174895 X:68879391-68879413 AAGCTGTGAGGGGAGGGCCAGGG - Intergenic
1192433110 X:71125871-71125893 AAACAGGGAAGGGAGGGTCAAGG - Intronic
1193145188 X:78068845-78068867 CAGCATTAATGTGAGGGTCAGGG - Intronic
1193898687 X:87148073-87148095 ATGCAGTGATGGGATGGGCACGG + Intergenic
1194730325 X:97445741-97445763 AACCAGTGTTGTGAGGGGCTGGG - Intronic
1195577337 X:106466757-106466779 AAGCAAAAATGTGAGGGTCCTGG - Intergenic
1195759765 X:108233825-108233847 ATATATTGATGTGAGGGTCAAGG - Intronic
1195878304 X:109565496-109565518 AAGCTGTAATGGGAGGGTGATGG + Intergenic
1197313974 X:124941089-124941111 GAGAAGTGATGGGATGGTCAAGG - Intronic
1197446819 X:126560929-126560951 AAGAAGTGAGGTTTGGGTCAAGG - Intergenic
1197507068 X:127319015-127319037 AGGCAGTGGTGGGAGGGTCGTGG + Intergenic
1197728773 X:129793521-129793543 AAGCAGTGAGGAGAGGGGCAGGG + Intronic
1200105555 X:153710129-153710151 AAGCAGTCATGTGGGTCTCATGG - Intronic