ID: 1096674518

View in Genome Browser
Species Human (GRCh38)
Location 12:53219391-53219413
Sequence CCCCTGCGTGGCTGCGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 321}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096674518_1096674533 28 Left 1096674518 12:53219391-53219413 CCGCCCCCGCAGCCACGCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 321
Right 1096674533 12:53219442-53219464 ACATCCCCTCACAGGCCATGTGG 0: 1
1: 0
2: 0
3: 18
4: 369
1096674518_1096674525 -8 Left 1096674518 12:53219391-53219413 CCGCCCCCGCAGCCACGCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 321
Right 1096674525 12:53219406-53219428 CGCAGGGGCACACGCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 155
1096674518_1096674531 20 Left 1096674518 12:53219391-53219413 CCGCCCCCGCAGCCACGCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 321
Right 1096674531 12:53219434-53219456 CGCCACAAACATCCCCTCACAGG 0: 1
1: 0
2: 0
3: 11
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096674518 Original CRISPR CCCCTGCGTGGCTGCGGGGG CGG (reversed) Intronic