ID: 1096675044

View in Genome Browser
Species Human (GRCh38)
Location 12:53221704-53221726
Sequence TTTCCGGGAGTCGCCGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096675044_1096675058 14 Left 1096675044 12:53221704-53221726 CCAGCAGCGGCGACTCCCGGAAA 0: 1
1: 0
2: 1
3: 2
4: 47
Right 1096675058 12:53221741-53221763 GCGCCCCGCCCTCAGCCGCCGGG 0: 1
1: 0
2: 4
3: 34
4: 355
1096675044_1096675063 22 Left 1096675044 12:53221704-53221726 CCAGCAGCGGCGACTCCCGGAAA 0: 1
1: 0
2: 1
3: 2
4: 47
Right 1096675063 12:53221749-53221771 CCCTCAGCCGCCGGGCCGCCCGG 0: 1
1: 0
2: 4
3: 42
4: 261
1096675044_1096675057 13 Left 1096675044 12:53221704-53221726 CCAGCAGCGGCGACTCCCGGAAA 0: 1
1: 0
2: 1
3: 2
4: 47
Right 1096675057 12:53221740-53221762 CGCGCCCCGCCCTCAGCCGCCGG 0: 1
1: 1
2: 7
3: 38
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096675044 Original CRISPR TTTCCGGGAGTCGCCGCTGC TGG (reversed) Intronic
902033257 1:13438317-13438339 TTTCCTGGATTCTCCTCTGCAGG - Intergenic
904035841 1:27558125-27558147 GTTCAGGGAGTTGCCTCTGCAGG + Intronic
904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG + Intergenic
912641030 1:111346410-111346432 TTTCCTGGATTCGCGGCTGTAGG - Exonic
915689153 1:157670211-157670233 TTTCAGGGAGTCCACGCTGATGG + Intergenic
924056438 1:240128764-240128786 TTTCCGGGACTGGCTGCTGTTGG - Intronic
1075241273 10:120781050-120781072 TTTCAGGGAGTCCCTGCAGCAGG + Intergenic
1078987060 11:16607066-16607088 TGGCCGGGAGCCGCGGCTGCCGG - Intronic
1083934113 11:65861393-65861415 CTTCCGCAAGTCGCCCCTGCGGG - Exonic
1096675044 12:53221704-53221726 TTTCCGGGAGTCGCCGCTGCTGG - Intronic
1104623438 12:130335243-130335265 TTTCCGGGAGCCGCCTCTAGAGG - Intergenic
1112010951 13:95293444-95293466 TGTCCAGCAGTCGCTGCTGCAGG - Intronic
1113784369 13:112994729-112994751 CTGCCTGGGGTCGCCGCTGCGGG + Intronic
1128293566 15:66497791-66497813 TTTCCGGGAGTCGGCGGCGATGG - Exonic
1132588841 16:717658-717680 TTCCGGGGAGGGGCCGCTGCTGG + Exonic
1138328147 16:56192026-56192048 CTGCCGCGAGTCTCCGCTGCTGG + Exonic
1141430587 16:83968696-83968718 GCTCCGGGAGCCGCCGCAGCAGG + Exonic
1152426309 17:80220451-80220473 TCTCCTGGCGTCGCCGCAGCTGG - Exonic
1155209219 18:23586532-23586554 TTTCTGGGAGGTGCCGCTGCCGG + Exonic
1160512296 18:79459344-79459366 TTTCATGGACTCACCGCTGCGGG + Intronic
1165717336 19:38054916-38054938 TTCCCGGGAGCCCCTGCTGCTGG + Intronic
1165955332 19:39498935-39498957 GTCTCGGGAGTCGCAGCTGCTGG - Intronic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
924962174 2:45597-45619 GTGCCGGGAGAAGCCGCTGCCGG + Exonic
925708416 2:6713398-6713420 TTTCCTGGAGTCGCTGCCTCTGG - Intergenic
935434350 2:103012804-103012826 TTTCCTGGAGTCACTGCTGATGG - Intergenic
935547703 2:104418460-104418482 GTCCAGGGAGTCGCCGTTGCGGG + Intergenic
1176051938 20:63124590-63124612 TTCCCGGGAGCCACCGCTGCAGG + Intergenic
1179977148 21:44874597-44874619 GGTCCGGGATTCGCCGGTGCCGG + Intergenic
1182078570 22:27512370-27512392 TTTCCCCAAGACGCCGCTGCTGG - Intergenic
1182861475 22:33563157-33563179 TTTCTGAGAGCCCCCGCTGCAGG + Intronic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
952318926 3:32258027-32258049 TTTCCAGAAGTCGCTGCTGGAGG + Intronic
953972248 3:47356397-47356419 TTTCAGGGAGGCGCGTCTGCAGG + Intergenic
954764592 3:52902733-52902755 TATACGGGAGTCGGCGCTGGGGG + Intergenic
961458725 3:127036989-127037011 TCTCCCGGACTCGACGCTGCAGG - Exonic
968574938 4:1361235-1361257 CTTCCTGGAGTCCCAGCTGCAGG - Intronic
973820744 4:54659317-54659339 TTTCCAGGTGTCGCTGGTGCGGG + Intronic
995512391 5:112922045-112922067 TGGCCGGGGGTCGCCGCCGCTGG - Intronic
1002071307 5:176680315-176680337 CTCCCGGGAGCCGCCGCTGTCGG + Intergenic
1007820058 6:44554550-44554572 TTTCCAGGTGTTGCTGCTGCTGG + Intergenic
1021510524 7:21428088-21428110 TTTCCGCGAATGGCCGCCGCTGG - Exonic
1024629977 7:51238860-51238882 TTCCCGGGAGTCCCCGGTGAAGG + Intronic
1031919031 7:127588260-127588282 GCTCCGCGAGTTGCCGCTGCTGG - Intronic
1032344415 7:131106110-131106132 TTTCCGGGAGCGGGCGCTGGCGG - Intergenic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1040309764 8:46230737-46230759 TTTCCCTGAGTCGCTGCGGCTGG - Intergenic
1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG + Intergenic
1040871023 8:52100449-52100471 CTTCCCGGAGCCGCCTCTGCTGG + Intergenic
1048518642 8:135133839-135133861 TTTCCGGGAGTCACTCTTGCAGG + Intergenic
1048985730 8:139733765-139733787 TTTCCAGGATCCTCCGCTGCAGG - Intronic