ID: 1096675200

View in Genome Browser
Species Human (GRCh38)
Location 12:53222346-53222368
Sequence TTTTTGTTGTTGTTTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1938
Summary {0: 1, 1: 3, 2: 16, 3: 232, 4: 1686}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096675200_1096675201 -4 Left 1096675200 12:53222346-53222368 CCAGCAGCAAACAACAACAAAAA 0: 1
1: 3
2: 16
3: 232
4: 1686
Right 1096675201 12:53222365-53222387 AAAACAGTTAAGTGCAAAATAGG 0: 1
1: 0
2: 2
3: 39
4: 391
1096675200_1096675202 -3 Left 1096675200 12:53222346-53222368 CCAGCAGCAAACAACAACAAAAA 0: 1
1: 3
2: 16
3: 232
4: 1686
Right 1096675202 12:53222366-53222388 AAACAGTTAAGTGCAAAATAGGG 0: 1
1: 0
2: 0
3: 27
4: 345
1096675200_1096675204 18 Left 1096675200 12:53222346-53222368 CCAGCAGCAAACAACAACAAAAA 0: 1
1: 3
2: 16
3: 232
4: 1686
Right 1096675204 12:53222387-53222409 GGAGTACCCCGAAAACAAGAGGG 0: 1
1: 0
2: 1
3: 10
4: 52
1096675200_1096675203 17 Left 1096675200 12:53222346-53222368 CCAGCAGCAAACAACAACAAAAA 0: 1
1: 3
2: 16
3: 232
4: 1686
Right 1096675203 12:53222386-53222408 GGGAGTACCCCGAAAACAAGAGG 0: 1
1: 0
2: 1
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096675200 Original CRISPR TTTTTGTTGTTGTTTGCTGC TGG (reversed) Intronic
901173502 1:7281767-7281789 TTTTTGTTGTTGTTTATGGAAGG + Intronic
901254133 1:7806426-7806448 TTTTTGTTGCTGTTTCATGAAGG + Intronic
901348507 1:8569314-8569336 CTTTGGTTGTTGTTTGGTGACGG + Intronic
901600573 1:10420399-10420421 TTTTTTTTTTTTTTTGCTCCTGG + Intergenic
901661615 1:10801542-10801564 TTTTTGTTGTTGTTTGTTTTTGG - Intergenic
901716820 1:11161687-11161709 GTTTTGTTGGAGTTTGCTGGAGG - Intronic
901778801 1:11578870-11578892 TTTTTGTTGTTTTTTGAGACAGG - Intergenic
901812367 1:11775282-11775304 TTGTTGTTGTTGTTTGTAGACGG - Intronic
902352470 1:15867597-15867619 TTGTTGTTGTTTTTTGAGGCAGG + Intronic
902609952 1:17591246-17591268 TTTTTGTTGTTGTTTGAAACAGG + Intronic
902811508 1:18890542-18890564 TTTTTGTTGTTGTTTTGAGATGG - Intronic
902991278 1:20188880-20188902 TTGTCGTCGTTGTTTGCTTCGGG - Intronic
903098154 1:21000587-21000609 TTTTTGTTTTTTTTTTGTGCTGG - Intronic
903210521 1:21815603-21815625 TTTTTGTTGTTGTTTTAGGCAGG - Intronic
903561627 1:24232370-24232392 TTTTTGTTTTTTTTTTTTGCGGG + Intergenic
903855342 1:26334416-26334438 TTTTTGTTTTTGTTTGAGACAGG - Intronic
903869290 1:26421028-26421050 TTTTTTTTCTTGATGGCTGCTGG + Intronic
903995451 1:27302733-27302755 TTGTTGTTGTTGTTTGAGACAGG - Intronic
904031194 1:27534334-27534356 TTGTTGTTGTTGTTTTCTGTTGG - Exonic
904122646 1:28211157-28211179 TTTTTGTTTTTGTTTTTTCCTGG - Intronic
904365021 1:30005130-30005152 TTTTTGTCTTTTTCTGCTGCTGG - Intergenic
904596465 1:31649259-31649281 TTTTTTTTTTTTTTTGGTGCTGG - Intergenic
904797670 1:33069601-33069623 TTTTTGTTTTTGTTTGAGACAGG - Intronic
905103301 1:35544794-35544816 GTTTTGTAGTTGTTTACGGCAGG - Intronic
905354354 1:37370733-37370755 TTTTTGTTTTTGTTTTTTCCTGG - Intergenic
905458433 1:38104674-38104696 TTTTTGTTTTTGTTTGAGACAGG - Intergenic
905556423 1:38888803-38888825 TTTTTGTTTTTGTTTTCAGAAGG + Intronic
905613565 1:39377013-39377035 TTTTTGTTGTTGTTTTGAGATGG + Intronic
905741054 1:40372279-40372301 TTGTTGTTGTTGTTTGAGACAGG + Intronic
906145164 1:43556238-43556260 TTGTTGTTGTTGTTTGGTTTTGG + Intronic
906324899 1:44839495-44839517 TTTTTGCTGTTGTTTGGGGGAGG - Intronic
906599869 1:47116582-47116604 TTTTTGTTTTTGTTTTTTGTGGG + Intronic
906754779 1:48300592-48300614 TTTTTGTTGTTGTTTTTGTCTGG - Intronic
907012890 1:50979190-50979212 TTTTTGTTTTTATTTGGTGGTGG - Intergenic
907147789 1:52252318-52252340 TTGTTGTTGTTGTTTGTTTTGGG + Intronic
907203315 1:52746700-52746722 TTTTTTTTTTTTTTTGCGGCTGG + Intronic
907215822 1:52862782-52862804 TTTTTGTTGTTCTTTGAGACAGG + Intronic
907295843 1:53453524-53453546 TTTTTTTTTTTTTTTGCAGCAGG - Intergenic
907383802 1:54112353-54112375 ATTTTGTTGTTGTTTGAGACAGG - Intronic
907401351 1:54226801-54226823 TTTTTGTTGTTTTTTGTTTGGGG - Exonic
907479335 1:54733759-54733781 TTTTTTTTTTTTTTTGCGGCGGG + Intronic
907571016 1:55483845-55483867 TTTTTGTTTTTGTTTTTTCCTGG + Intergenic
908093475 1:60711805-60711827 TTTTTCAAATTGTTTGCTGCTGG - Intergenic
908661714 1:66444297-66444319 TTATTGTTGTTGTTTCAGGCAGG + Intergenic
908724458 1:67160303-67160325 TTTCTGTTTTTGTTTTTTGCTGG - Intronic
908888113 1:68813290-68813312 GTTTTTTTTTTGTTTGCTTCTGG - Intergenic
908992409 1:70108962-70108984 TTTTTGTTGTTGTTGTTTGGTGG + Intronic
908992410 1:70108965-70108987 TTGTTGTTGTTGTTTGGTGGTGG + Intronic
909116586 1:71545107-71545129 TTTTTGTTGTTGTTTTTGGTTGG - Intronic
909118353 1:71568573-71568595 TTTTTGTTGTTATTTACCACTGG - Intronic
909118940 1:71575776-71575798 TTTTTGTTTTTGTTTTGAGCCGG - Intronic
909136859 1:71812160-71812182 TTTTTGTGTTAGTTTGCTGACGG + Intronic
909301526 1:74018712-74018734 TTTTTTTTATTGTTTACTTCTGG - Intergenic
909305033 1:74063113-74063135 TTGTTGTTGTTGTTTGGTTTTGG - Intronic
909570438 1:77104150-77104172 TTTTTGTTGCTGTTAGCTGCTGG - Intronic
909852951 1:80492149-80492171 TTGTTGTTGTTGTTTGTTTTTGG - Intergenic
909863839 1:80640289-80640311 TTTATTTCCTTGTTTGCTGCAGG - Intergenic
909871008 1:80739039-80739061 TTTTTCAGGTTGTTTGCTGTTGG - Intergenic
910033139 1:82756292-82756314 TTGTTGTTGTTGTTTGTTTTTGG - Intergenic
910102747 1:83596269-83596291 TTTTTGTTGTTGTTTAGGGTGGG + Intergenic
910168040 1:84348576-84348598 TTTTTGTTATTGTTTGCTATGGG - Intronic
910252404 1:85211572-85211594 TTTTTGTTTTTGTTTTCAGACGG + Intergenic
910296674 1:85653602-85653624 TTTTTGTTGTTGTTTTTTTTTGG - Exonic
910520992 1:88122302-88122324 TTGTTGTTGTTGTTTTCAGATGG - Intergenic
910525817 1:88177000-88177022 TTTTTGTTCTTCTTAGCTTCAGG + Intergenic
911006170 1:93227086-93227108 TTTTTGTTCTTGTTGTCTGTAGG + Intronic
911100705 1:94093927-94093949 TTTTTGTTGTTGTTTTTGGGGGG - Intronic
911115479 1:94241791-94241813 TTTTTCTAGTTGTTTACTACAGG - Intronic
911406147 1:97442312-97442334 TTTTTGTTGTTGTTTCCATTGGG + Intronic
911654858 1:100432103-100432125 TTGTTGTTGTTGTTAGGTACAGG + Intronic
911812241 1:102297156-102297178 TTTTTTTTTTTCTGTGCTGCTGG + Intergenic
912074284 1:105852476-105852498 TTTTAGTTGTTTATTGCTGCAGG - Intergenic
912210574 1:107552390-107552412 TTTTTTTTTTTCTTTTCTGCAGG - Intergenic
912772731 1:112479617-112479639 TTTGTGATCTTGTTGGCTGCTGG - Intronic
912828501 1:112928771-112928793 TTTTTTTTGTTGATCTCTGCTGG - Intronic
913096299 1:115519517-115519539 TTTTTCTGTTTGTTTGCTGTTGG + Intergenic
913393821 1:118344170-118344192 TTTTTGTTAGAGTTTGATGCTGG - Intergenic
913576835 1:120183673-120183695 TTGTTGTTGTTGTTTGCTTGTGG + Intergenic
914219326 1:145664643-145664665 TTTTTGTTGTTTTTTGAGACAGG - Intronic
914471910 1:147987513-147987535 TTTTTGTTGTTTTTTGAGACAGG - Intronic
914558744 1:148795108-148795130 TTGCTGTTGTTGTTTGCTTGTGG + Intergenic
914614089 1:149335122-149335144 TTGCTGTTGTTGTTTGCTTGTGG - Intergenic
914806530 1:150996035-150996057 TTTTTGTTTTTGTTTTCTATGGG - Intergenic
914886116 1:151585718-151585740 TGTGTGTTGCTGTTTTCTGCAGG + Intergenic
915188616 1:154128839-154128861 TTTTTGTTTTTGTTTGAGACAGG - Intronic
915517213 1:156420580-156420602 TTTTTGTTGTTGTTTTGTCTCGG - Intronic
915658082 1:157378026-157378048 TTTTTGCTTTTGTTTTCTTCTGG - Intergenic
915802065 1:158804279-158804301 TTTTTGTTCTGGTTGGCTCCAGG + Intergenic
915825466 1:159071512-159071534 TTGTTGTTGTTGTTTGAGACAGG + Intronic
916232144 1:162550997-162551019 TTTGTGTTTTTGTTGGCTGGAGG + Intergenic
916360975 1:163967952-163967974 TTTTTCAGCTTGTTTGCTGCTGG - Intergenic
916435890 1:164777415-164777437 TTGTTGTTGTTGTTTGAGGCAGG - Intronic
916471996 1:165133042-165133064 TTTTTTTTGTAGTTTGTTACAGG + Intergenic
916492442 1:165313882-165313904 TTGTTGTTGTTGTTACCTGCAGG - Intronic
916519919 1:165554440-165554462 TTGTTGTTGTTGTTTTTTGGAGG + Intronic
916634082 1:166649360-166649382 TTGTTGTTGTTGTATGGAGCAGG - Intergenic
916745297 1:167680475-167680497 TTTTTGTTTTTGTTTTTTTCAGG + Intronic
916772298 1:167922835-167922857 TTTTTGTTGTTGTTGAGTGATGG - Intronic
916791927 1:168132729-168132751 TTTTTGTTGTTGTTGTTTGTTGG + Intronic
916824612 1:168431464-168431486 TTGTTGTTGTTGTTTGTTTTTGG - Intergenic
916926743 1:169529350-169529372 TTGTTGTTGTGGTTTTCTGTTGG + Intronic
917037834 1:170768650-170768672 TTTTTGTTTTTGTTTTTTGATGG - Intergenic
917213803 1:172657500-172657522 TTGTTGTTGTTGTTTAAAGCTGG - Intergenic
917231291 1:172840714-172840736 TTTTTGTTTTTGTTTTTTGATGG + Intergenic
917349489 1:174062368-174062390 TTGTTGTTGTTGTTTGAGTCAGG + Intergenic
917575576 1:176317979-176318001 TTTTTTTTTTTTTTTTCTGCTGG + Intergenic
917678665 1:177344068-177344090 TTTTTGTTGTTGTTTAGAGTGGG + Intergenic
917785708 1:178455339-178455361 TTGATGTTTTTGTTTGCTACAGG + Intronic
917829817 1:178869540-178869562 TTTTTGTTGTTGCATGCTATGGG - Intronic
917986281 1:180322972-180322994 TTTTTCTTCTTTTTTGATGCAGG + Intronic
918161443 1:181904487-181904509 TTTTTCTTGTTGTTTGAGGCAGG + Intergenic
918280272 1:182997672-182997694 TTGTTGTTGTTGTTTTTTGGGGG + Intergenic
918517285 1:185376918-185376940 TTTTTCTTTTTTTTTGCTACTGG - Intergenic
918746744 1:188210922-188210944 TTTTTGTTGTTTTTTGACACAGG - Intergenic
919283661 1:195525082-195525104 TTTTTGTTTTTGTTTTTTGATGG + Intergenic
919351070 1:196454703-196454725 TACTAGTTGTTGATTGCTGCAGG + Intronic
919353695 1:196494402-196494424 TTTTTGTTGTTTTTTGGTGACGG + Intronic
919402304 1:197134411-197134433 TTTTTTTTCTTTTTTGCTGTTGG - Intronic
919436198 1:197564388-197564410 TTTTTTTTTTTTTTTGCTGGTGG - Intronic
919489521 1:198188180-198188202 TTTTTGTTGTTGTTTTGTTTAGG + Intronic
919595379 1:199555313-199555335 TTTTTCTTGTTTTTTGATGTAGG - Intergenic
919642584 1:200059919-200059941 TTTTTGTTGTTCTTGGCTGTGGG - Intronic
919823448 1:201487401-201487423 TTTTTGTTTTTGTTTTCTTTTGG - Intronic
919829356 1:201529606-201529628 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
919889278 1:201958684-201958706 TTTTTGTTGCTGTTTGAGACAGG - Intronic
920094407 1:203476835-203476857 TTTTTATTTTTTTTTCCTGCAGG + Intronic
920114167 1:203608236-203608258 TTTTTGTTGTTGTTTTTAGATGG - Intergenic
920273237 1:204783050-204783072 TTGTTGTTGTTTTTTGCTTTGGG - Intergenic
920312189 1:205054993-205055015 TTGTTGTTGTTGTTGTTTGCGGG + Intronic
920501699 1:206489702-206489724 TTATTGTTGTTGTTTGAGACAGG - Intronic
920605051 1:207373595-207373617 TTTTTGTTGTTTTTTTTTTCAGG - Intergenic
920646118 1:207805645-207805667 TTTTTGTTTTTGTTTGAGACAGG - Intergenic
920775540 1:208933160-208933182 TTTTTTTTTTTTTTTGCTTCAGG + Intergenic
920851188 1:209629007-209629029 TTTCTGTTGATGTTTGTTTCTGG - Intronic
920863033 1:209726580-209726602 TTTTTGTTGTTGTTAGAAACAGG - Intronic
921054295 1:211532441-211532463 CTTTTGTTTTTGTTTGTTGTTGG - Intergenic
921088497 1:211819484-211819506 TTTTTGTTGTTGTTGGAGACAGG - Intronic
921112583 1:212053591-212053613 TTGTTGTTGTTGTTTGAGACAGG + Intronic
921213261 1:212917338-212917360 TTTTTTTTTTTTTTTGCTCCAGG + Intergenic
921216703 1:212943897-212943919 TTTTTGTTGTTGTTTTGTGATGG + Intergenic
921266446 1:213424672-213424694 ATTTTGTTGTTGTTTTATGCAGG + Intergenic
921297342 1:213717052-213717074 TTTTTCCTGATGTTTGCTACAGG + Intergenic
922114862 1:222603137-222603159 TTTTTGTTGTTGTTTCAGACAGG + Intergenic
922168350 1:223134434-223134456 TTTTTGCTGTTTTTTGATGCTGG - Intronic
922346558 1:224701198-224701220 TTTTTTTTTTTTTTTGCTGGAGG + Intronic
922411055 1:225375770-225375792 TTGTTGTTGTTGTTTTTTGATGG - Intronic
922441730 1:225661349-225661371 TTTTTGTTTTTGTTTTTTGGGGG + Intergenic
922501519 1:226100363-226100385 TTTTTGTTTTTGTTTTCAGAGGG + Intergenic
922564388 1:226592050-226592072 TTGTTGTTGTTGTTTTATGATGG + Intronic
922649405 1:227324324-227324346 TTGTTGTTGTTGTTTTAGGCAGG + Intergenic
922867197 1:228870193-228870215 TTCTTGATGTTGATGGCTGCAGG - Intergenic
922904143 1:229160974-229160996 TTTTTTTTTTTTTTTACTGCAGG - Intergenic
923278652 1:232420317-232420339 TTTTTGTTGTTGTTTGGAGACGG - Intronic
923281596 1:232448368-232448390 TTGTTGTTGTTGTTTTATGTTGG - Intronic
923385541 1:233462165-233462187 TTTCTGTTTTTGTTTTCTGCAGG + Intergenic
923568933 1:235097521-235097543 TTGTTGTTGTTTTTTGAGGCGGG + Intergenic
923657458 1:235930510-235930532 TTTTTGTTTTTGTTTTTTGTGGG + Intergenic
923666619 1:236003862-236003884 TTGTTGTTGTTGTTTGGGACAGG - Intronic
923671359 1:236043791-236043813 TTTTTGTTGTTGTTTTGAGATGG - Intronic
923953916 1:238993150-238993172 TTTTTGTTTTTGTTTGGTTTCGG + Intergenic
924052232 1:240091271-240091293 TTTTTGTTGTTGTTGACAGAAGG - Intronic
924712739 1:246543982-246544004 TTTTTGTTGTTGTTAGAGACAGG - Intronic
1062872184 10:914822-914844 TTTTTTTTTTTCTTTGCTGGGGG - Intronic
1062891987 10:1069393-1069415 TTTTTTTTTTTTTTTGCAGCAGG + Intronic
1063204206 10:3815204-3815226 TTGTTGTTGTTGTTTGTTGTTGG + Intergenic
1063246805 10:4228863-4228885 TTTTTGTTTTTGTTTTTTGATGG - Intergenic
1063540500 10:6928778-6928800 TTTTTTTTTTTTTTTTCTGCTGG + Intergenic
1063818377 10:9804850-9804872 TTTTTGTTTTTGTTTTTTTCCGG - Intergenic
1064081616 10:12312389-12312411 TTTTTGTTTTTGTTTTTTGCGGG - Intergenic
1064112094 10:12548455-12548477 TTTTTTTTTTTTTTTGCTGGGGG + Intronic
1064313943 10:14237333-14237355 TTTTTGTTGTTGTTTTGAGATGG + Intronic
1064446858 10:15402423-15402445 TTTTTCTTCTTTTTTGCTGTAGG - Intergenic
1064455327 10:15482524-15482546 TTTTTGTTTTTGTTTTTTGGGGG + Intergenic
1064859162 10:19807066-19807088 TTTTTGTTGTTGTTTTTTGATGG - Intergenic
1065004401 10:21366261-21366283 TTATTATTGTTGTTTGATACAGG - Intergenic
1065038719 10:21668054-21668076 TTGTTGTTGTTGTTTTCTACTGG - Intronic
1065231682 10:23605079-23605101 TTTTTGTTGTCTTTTTCTGTAGG + Intergenic
1065819218 10:29509906-29509928 TTTTTGTTTTTGTTTGAGACAGG + Intronic
1065891527 10:30125428-30125450 TTTTTGTTGTTGTTGTTTGAAGG - Intergenic
1065960905 10:30733403-30733425 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1066091158 10:32021966-32021988 TTTTTGTTGTTGTTTTGAGACGG - Intronic
1066142646 10:32522767-32522789 TTTTTCTTCTTTTTTGATGCAGG + Intronic
1066253963 10:33660950-33660972 TTTTTGTTGTTGCTCGTGGCTGG + Intergenic
1067056028 10:43051255-43051277 TTTTTTTTGTTGTTTGAGACAGG + Intergenic
1067114770 10:43426624-43426646 TTTTTGTTTTTTTTTGAGGCAGG - Intergenic
1067295630 10:44973793-44973815 TGTGTGTTGGTGTATGCTGCGGG + Intronic
1067515449 10:46937062-46937084 TTGTTGTTGTTGTTTAGTGCAGG + Intronic
1067561762 10:47309547-47309569 TTGTTGTTGTTGTTTGCTACGGG + Intronic
1067646801 10:48114748-48114770 TTGTTGTTGTTGTTTAGTGCAGG - Intergenic
1067832641 10:49619258-49619280 TTATTGATATTGTTGGCTGCTGG - Intronic
1067879190 10:50029134-50029156 TTTTTGTTTTTGTTTTTTGATGG + Intergenic
1067923313 10:50481473-50481495 TTGTTGTTGTTGCTTTCTGTTGG - Intronic
1068014587 10:51499989-51500011 ATTATGTTTTTGTTTGTTGCTGG - Intronic
1068029674 10:51691210-51691232 TTTTTGTTTTTGTTTGCTTTGGG + Intronic
1068079009 10:52295074-52295096 TGTTTGTTGTTTTTTGGTTCAGG - Exonic
1068132574 10:52912894-52912916 TTTTTGTTGTTGTGTGTTACTGG - Intergenic
1068389693 10:56378605-56378627 TATTGGTTGTTCCTTGCTGCAGG + Intergenic
1068448728 10:57159031-57159053 TTTTTGTTGTTGTTTTGTTGGGG - Intergenic
1068475900 10:57524386-57524408 TTTATATTTTTGTTTGTTGCTGG + Intergenic
1068801535 10:61145922-61145944 TTTTTGTTGTTGTTAATTTCTGG + Intergenic
1068885176 10:62090928-62090950 TTTTTCTTCATGTCTGCTGCTGG - Exonic
1069228244 10:65971682-65971704 TTTTTGTTGTTGTTGGTGGTGGG - Intronic
1069357948 10:67609374-67609396 TTTTCGTTGTTGTTTGTTTATGG + Intronic
1069539817 10:69285417-69285439 TTTTTGTTGTTGTTTTGAGATGG - Intronic
1069708483 10:70474232-70474254 TTTTTGTTATTGCTGACTGCAGG - Intergenic
1069889306 10:71643424-71643446 TGTTTGGGGTTGTTTCCTGCAGG + Intronic
1070024362 10:72617825-72617847 TTTTTGTTGTTGTTTTGAGTTGG - Intronic
1070061474 10:72987816-72987838 TTTTTGTTGTTGTTTTTTTCTGG + Intergenic
1070099631 10:73372894-73372916 TTTTTGTTTTTGTTTTCAGATGG - Intergenic
1070398838 10:76035290-76035312 TTTTTATTTGTTTTTGCTGCGGG - Intronic
1070487874 10:76948008-76948030 TTTTTGTTTTTGTTTGAGGCAGG + Intronic
1071013792 10:80970711-80970733 TTAGTGTTGTTCTCTGCTGCTGG + Intergenic
1071219390 10:83445953-83445975 CTTATGTGGTTTTTTGCTGCTGG + Intergenic
1071248810 10:83794152-83794174 TTCTTTTTCTTGTTTGCTGTTGG + Intergenic
1071681120 10:87706751-87706773 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1071684254 10:87737802-87737824 TTTTTGTTTTTGTTTGAGGCAGG - Intronic
1071685304 10:87748777-87748799 TTTTTGTTGTTTTTTTCTTTCGG + Intergenic
1071769546 10:88711149-88711171 TTTTTGTTGTTATTTATTTCTGG + Intergenic
1071837512 10:89433326-89433348 ATTTTGCTGTTGTTTGTTACAGG - Exonic
1071917528 10:90311923-90311945 GTTTTGCTGTTGGTTGCTGTAGG + Intergenic
1072295697 10:94007582-94007604 TTTTTTTTTTTTTTTGCTACTGG + Intronic
1072381918 10:94881532-94881554 TTTTTCAAGTTGTTTGCTGCTGG + Intergenic
1072415675 10:95244892-95244914 TTTTTGTTTTTGTTTGAGACAGG - Intronic
1072446886 10:95506863-95506885 TTTTTGTTGTTGTTTTGAGATGG + Intronic
1072632815 10:97158334-97158356 TTTTTTTTATTGTTTGCTTTGGG + Intronic
1072959244 10:99914332-99914354 TTTTTGTTGTTGTTTTGCGTGGG + Intronic
1073029647 10:100515284-100515306 TTTTTGTTTTTGTTTGGAACAGG - Intronic
1073206080 10:101770175-101770197 TTGTTGATATTGTTTGCTGTTGG - Intronic
1073551497 10:104406089-104406111 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1073618582 10:105023542-105023564 TTTTTTTTGTTTTTTGCTTGGGG + Intronic
1073681669 10:105711542-105711564 TTTATGGTGTTGTCTTCTGCTGG + Intergenic
1073801260 10:107044086-107044108 CTTTTTTTGTTGTTTCCAGCAGG - Intronic
1073974250 10:109082561-109082583 TTATTTTTGTTGTTTGCTGCAGG - Intergenic
1074253800 10:111780311-111780333 TTTTTGTTTTTGTTTGATTTAGG + Intergenic
1074330627 10:112504370-112504392 ATTTTGTTGTTGTTTAAAGCAGG - Intronic
1074408844 10:113206047-113206069 TTTTTCTGATTGTTCGCTGCTGG - Intergenic
1074411333 10:113230991-113231013 TTTTTGTTTTTGTTTGAGACAGG - Intergenic
1074629681 10:115238523-115238545 TTTTTGTTCTTGTTCACTGCTGG + Intronic
1074645328 10:115444311-115444333 TTTCTTTTGTTTTTTGGTGCAGG + Intronic
1074756080 10:116625101-116625123 TTGTTGTTGTTGTTTTTTGTTGG + Intronic
1075255425 10:120922810-120922832 TTTTTGTTTTTGTTTTCAGACGG + Intergenic
1075578972 10:123602364-123602386 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1076372413 10:129964033-129964055 TTGTTGTTGTTGTTGTTTGCAGG + Intergenic
1076473156 10:130734309-130734331 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1076596773 10:131627952-131627974 TTTTTGTTGTCCCTTGCTGTAGG + Intergenic
1076891416 10:133285818-133285840 TTTTTGTTGTTTTGTTCTGATGG - Intronic
1076918221 10:133436915-133436937 TTGTTGTTGTTGTTTTGTGATGG + Intergenic
1077092387 11:785261-785283 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1077861257 11:6182348-6182370 TTCTTGTTTTTGTTTGCTTTGGG - Intergenic
1078007776 11:7545422-7545444 TTTTTGTTTTTGTTTGAGACAGG - Intronic
1078275423 11:9840245-9840267 TTTTTTTTTTTTTTTGCGGCTGG - Intronic
1078383170 11:10862441-10862463 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1078388723 11:10916652-10916674 TTTTTGTTGTTGTTTGAGATAGG - Intergenic
1078485493 11:11719094-11719116 TTTTTGTTTTAGTTTGCTTTTGG - Intergenic
1078494991 11:11808974-11808996 TTTTTGTTGTTGTTGTTTTCCGG - Intergenic
1078597540 11:12701383-12701405 TTTGTTTTGTTGTTTGCTACAGG - Intronic
1078685641 11:13528259-13528281 TTTTTCTTGTTGTTTTTTGTGGG - Intergenic
1078841696 11:15082394-15082416 TTTTTGTTGTTGTTTCTTTCAGG + Intergenic
1078870246 11:15336391-15336413 TTTTTGTTGTTGTTACTTCCTGG + Intergenic
1079348460 11:19672931-19672953 TTTGTGTGTTTGTTTGCTCCTGG + Intronic
1079412975 11:20207427-20207449 TTGTTGTTGTTGTTTTTTGAGGG + Intergenic
1079779476 11:24582311-24582333 TTTTTTTTTTTTTTTGCTGAGGG + Intronic
1079834758 11:25320560-25320582 TTTTTTTTTTTTTTTGCTGGAGG + Intergenic
1079845830 11:25466567-25466589 TTTTTGTTCTTATTTGCTTCAGG - Intergenic
1079944577 11:26725796-26725818 TTTTTGTTGTGCTGTGCTGGGGG + Intergenic
1080034164 11:27694591-27694613 TTTTTTTTTTTTTTTGGTGCTGG + Intronic
1080042814 11:27776941-27776963 TTTGTCTTGTTGTTTGCTATTGG - Intergenic
1080449381 11:32366017-32366039 TTTTTGTTTTTGTTTGTTTTTGG + Intergenic
1080493649 11:32794839-32794861 TTTTTGTTTTTGTTTGTTTTCGG + Intergenic
1080545777 11:33316815-33316837 TTTTTGTTGTTGTTTTGTGATGG - Intronic
1080623970 11:34012019-34012041 TTTTTGTTTTTGTTTTTTTCTGG + Intergenic
1080799103 11:35592923-35592945 TTTTTTTTTTTTTTTGCTGTTGG - Intergenic
1080886810 11:36375669-36375691 TTGTTCTTGTTGTTTTTTGCAGG - Intronic
1080979835 11:37388405-37388427 GTTTTGTTGTTGTTTTTTTCTGG - Intergenic
1081136797 11:39449425-39449447 TTGTTGTTGTTGTTTTCAGACGG - Intergenic
1081201645 11:40223377-40223399 TTCTTTTTGTCGTTTGCTGTAGG - Intronic
1081338149 11:41893584-41893606 TTCTTGTTGCTGTTTGCTTCTGG + Intergenic
1081381474 11:42421463-42421485 TTTTTGTTGTTTTTTGAGACAGG - Intergenic
1081843872 11:46224287-46224309 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1081868155 11:46371079-46371101 TTTTTGTTTTTGTTTGGAGATGG - Intronic
1081939631 11:46929638-46929660 TTTTTGTTTTTGTTTGAGACAGG + Intergenic
1081956233 11:47096805-47096827 TTTTTTTTTTTTTTTTCTGCTGG - Intronic
1082178593 11:49090816-49090838 TTTTGTTTGTTTTTTGCTCCTGG - Intergenic
1082671947 11:56044948-56044970 TTTTTTTTTTTTTTTGCTGGTGG - Intergenic
1082946071 11:58761894-58761916 TTTTTGTTTTTCTTTTTTGCAGG - Intergenic
1083149453 11:60782856-60782878 TTTTAGTTGCTGTGTGCTTCCGG - Intergenic
1083368132 11:62155483-62155505 TTGTTGTTGTTGTTGGAGGCAGG + Intergenic
1083809213 11:65093941-65093963 TTTTTGTTGTTGTTTGTTTGGGG + Intronic
1084062003 11:66682060-66682082 TTTTTGTTTTTGTTTTTTGGGGG + Intergenic
1084744282 11:71158092-71158114 TTATTTTTGATGTTTGCTACAGG - Intronic
1085007827 11:73110776-73110798 TTTTTTTTCTTGTTTGATGTAGG + Intronic
1085183256 11:74553992-74554014 TTTTTTTTTTTTTTTGCGGCAGG + Intronic
1085188338 11:74595620-74595642 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1085372355 11:76020659-76020681 TTTTTTTTTTTTTTTGCTGCAGG + Intronic
1085672323 11:78479502-78479524 TTTTTGTTGTTTTTTGAGACAGG - Intronic
1085748930 11:79142331-79142353 TTTTTCTGATTGTTTGCTGTTGG - Intronic
1085839369 11:79993475-79993497 TTTTTGTTTTTGTTTTTTCCTGG + Intergenic
1085891042 11:80579367-80579389 TTTTTGTTGTTGTTTTATCTTGG - Intergenic
1085999647 11:81966518-81966540 TTTTTGTTGTTGTTGGGTATGGG - Intergenic
1086549620 11:88040695-88040717 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1086830918 11:91562388-91562410 TTTATGCTGTTGTCTGCTACTGG - Intergenic
1086832727 11:91585356-91585378 TTTTTGGAGTTGTCTTCTGCCGG - Intergenic
1087045145 11:93838479-93838501 TTTTTGTTTTTGTTTTTTGTGGG - Intronic
1087480208 11:98691372-98691394 TTCTTGTTGTTGTTTGAAGCTGG + Intergenic
1087481495 11:98706911-98706933 TTTTTTTTTTTGTTTGGTGGGGG + Intergenic
1087524620 11:99294368-99294390 TTTTTCAAATTGTTTGCTGCTGG - Intronic
1087568520 11:99894508-99894530 GTTTTTTTTTTTTTTGCTGCTGG - Intronic
1087617020 11:100498155-100498177 TATTTGTTTTTGTTTGCTTTTGG - Intergenic
1087824984 11:102754904-102754926 TTTTTTTTTTTTTTTGCTGCTGG - Intergenic
1087940949 11:104096237-104096259 TTTTTGTAGTTTTTTTTTGCAGG - Intronic
1087984041 11:104655491-104655513 TTATTTTTGTTGCTTGTTGCTGG + Intergenic
1088470298 11:110182593-110182615 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1088629420 11:111760257-111760279 TTTTTGTTGTTGTTTGTCGGGGG + Intronic
1088657647 11:112015808-112015830 TTTTTTTTTTTTTTTGCGGCAGG + Intronic
1088950981 11:114569631-114569653 TTGTTGTTGTTTTTTGAGGCTGG + Intergenic
1089348224 11:117805544-117805566 TTGTTTTTGTTTTTTACTGCAGG + Intronic
1089393170 11:118115816-118115838 TTGTTGTTGTTGTTTTCAGATGG - Intronic
1089726987 11:120490635-120490657 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1090029357 11:123194540-123194562 TTTTTGTTGTTGTTTCAAACAGG - Intronic
1090289971 11:125534596-125534618 TTTTTGTAGTTGTTTCCTGTAGG + Intergenic
1090419077 11:126561682-126561704 TTTTTGATGCTGTTGGCTTCAGG + Intronic
1090467762 11:126950359-126950381 TTTTTGTTTTTGTTTTCAGATGG - Intronic
1090483544 11:127089911-127089933 TTTTTGTTTTTGTTTTTTGGTGG - Intergenic
1090804622 11:130195238-130195260 TTTTTGTTGTTTTTTGAGACAGG - Intronic
1090814608 11:130281584-130281606 TTGTTGTTGTTGTTTTTTGGGGG + Intronic
1091647792 12:2286949-2286971 TTTTTATTCTTGTTTTCTGGAGG + Intronic
1091733784 12:2901981-2902003 TTTTTGTAGTTGTTTTCTTGAGG + Intronic
1091894805 12:4092784-4092806 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1091992446 12:4966586-4966608 TTTTTGTTTTTGTTTTTTGTTGG - Intergenic
1092086034 12:5761051-5761073 TTTTTTTTTTTTTTTGCTGTGGG - Intronic
1092150691 12:6246335-6246357 TTTTTGTTTTTGTTTTCAGACGG + Intergenic
1092278036 12:7077039-7077061 TCTTTGTTGTTGTTTGGTTCAGG + Intergenic
1092582652 12:9862653-9862675 ATTTTGTTGTTGTTTTCTGTGGG - Intronic
1092617979 12:10233166-10233188 TTTTTGTTGTTGTTTTAAGATGG + Intergenic
1092757490 12:11777449-11777471 TTTTTGTTTTTTTTTTCTTCTGG + Intronic
1092839824 12:12529114-12529136 TTTTTGTTGTTTTTTGAGACAGG + Intronic
1093012245 12:14120038-14120060 TTTTTGTTGTTGTTAGAGACAGG - Intergenic
1093039213 12:14359771-14359793 TTTTTTTTTTTTTTTGCTCCTGG + Intergenic
1093041076 12:14380265-14380287 TTTTTGTTTTTGTTTTCTTTTGG + Intronic
1093052630 12:14520455-14520477 TTTTTGTTGTTGTTTTTAACAGG - Intronic
1093535025 12:20212583-20212605 TTTTTGTGTTTGTTTGCTTTTGG - Intergenic
1093648443 12:21616226-21616248 TTTTTGTTTTTGTTTTCTGATGG + Intergenic
1093841665 12:23909947-23909969 TGTTTTTTGTTTTTTGCTGCTGG + Intronic
1094274105 12:28649612-28649634 CTTTTGTGGGTGTCTGCTGCAGG + Intergenic
1094485256 12:30921226-30921248 TTTTTTTTTTTTTTTGCTACAGG - Intergenic
1094614180 12:32021576-32021598 TTTTTGTTGTTGTTTGTGTTTGG + Intergenic
1094725945 12:33116351-33116373 TTTTTGTTGTTGTTGGGGGAAGG - Intergenic
1094812945 12:34159515-34159537 TGTTTGTTTTGGTTTGCTGGTGG - Intergenic
1095054232 12:37581333-37581355 TTTTTGTTTTTGTTTTGTGGTGG + Intergenic
1095144203 12:38704919-38704941 TTTTTTTTTTTTTTTGCTGATGG + Intronic
1095146081 12:38728147-38728169 TTTTTGTTGTTGTTGAATGCTGG - Intronic
1095164552 12:38956421-38956443 TTTGTGTAGGTCTTTGCTGCTGG + Intergenic
1095181287 12:39149354-39149376 TTTTTTTTTTTTTTTGCTGTTGG + Intergenic
1095371281 12:41470395-41470417 TGTTTGTTTTTGTTTGTTGGTGG + Intronic
1095380603 12:41586391-41586413 TTTCTCTTGTTGTTTGCTGTTGG + Intergenic
1095465494 12:42484004-42484026 TTTTTTTTTTTTTTTACTGCGGG - Intronic
1095468698 12:42513994-42514016 TTTTTGTTGTTGTTTTTTGGAGG - Intronic
1095576690 12:43748727-43748749 TTGTTGTTGTTGTTTTGTGATGG + Intronic
1095636545 12:44440819-44440841 TCATTGTTCTGGTTTGCTGCTGG - Intergenic
1095652044 12:44622860-44622882 TTTATCTTGTATTTTGCTGCAGG - Intronic
1095763356 12:45866953-45866975 TTGTTGTTGTTGTTTGGAGATGG + Intronic
1095773928 12:45991554-45991576 TTTTTGTTGTTGTTTGAGACAGG - Intronic
1095780556 12:46054393-46054415 TTGTTGTTGTTGTTTTTTGATGG - Intergenic
1095811984 12:46381680-46381702 TTTTTGTTGTTGTTTTGAGACGG - Intergenic
1096181468 12:49553316-49553338 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1096238508 12:49945840-49945862 ATTAGGGTGTTGTTTGCTGCTGG - Intergenic
1096294271 12:50370303-50370325 TTTTTGTTTTTGTTTTTTGGGGG - Intronic
1096371295 12:51071252-51071274 TTTTTTTTTTTTTTTGATGCAGG - Intronic
1096675200 12:53222346-53222368 TTTTTGTTGTTGTTTGCTGCTGG - Intronic
1096709236 12:53443323-53443345 TTCTTTTTGTTGTTTGTTGTTGG + Intronic
1096986914 12:55765724-55765746 TTGTTGTTGTTGTTTTCCCCTGG - Intronic
1096998610 12:55856726-55856748 TTTTTGTTGTTGTTTTTTTTTGG + Intergenic
1097025690 12:56053750-56053772 TTTTTGTTTTTGTTTCTTGGGGG + Intergenic
1097495385 12:60325162-60325184 TTTTTGTTGTTGTTTTGAGATGG + Intergenic
1097683243 12:62668910-62668932 ATTTTGTTGTGTTCTGCTGCTGG - Intronic
1097746086 12:63304786-63304808 TTGTTGTTGCTGTTTGAGGCAGG - Intergenic
1097841264 12:64323805-64323827 TTTTAGTTAATGTTTGCAGCTGG - Intronic
1097859345 12:64503165-64503187 TTATTGGTGTTGTTTGCTAGAGG - Intergenic
1097898219 12:64847486-64847508 TTTTTCTTGTTTTTTGATGTAGG + Intronic
1097903965 12:64901443-64901465 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1098420359 12:70290232-70290254 TTTTTGTTTTTTTTAGCTTCTGG + Intronic
1098439269 12:70500824-70500846 TTGATGTTGTTGTTTGATACAGG - Intergenic
1098616562 12:72533091-72533113 TGTTTGTTGTTGTTTGTTTTTGG + Intronic
1098687082 12:73435266-73435288 TTTTTGTTGTTGTTTCCACTGGG + Intergenic
1098754464 12:74341598-74341620 TTTTTGTTGTTGTTTTGAGATGG - Intergenic
1098842280 12:75490563-75490585 TTGTTGTTGTTTTTTTTTGCGGG - Intronic
1098865659 12:75760365-75760387 TTTTTTTTTTTTTTTTCTGCAGG + Intergenic
1099257184 12:80328311-80328333 TTGTTGTTGTTGTTTGTGACAGG - Intronic
1099502819 12:83434379-83434401 TTTTTTTTTTTTTTTGCTGTTGG + Intergenic
1099801185 12:87458864-87458886 TTTTGTTTGTTGTTTGTTTCTGG + Intergenic
1099804188 12:87497394-87497416 TTTTTGTTTTTTTTTGCCTCAGG + Intergenic
1099808594 12:87551655-87551677 TTTTTCATATTGTTTGCTGTTGG - Intergenic
1099992636 12:89741648-89741670 TTTTTCAGATTGTTTGCTGCAGG - Intergenic
1100023888 12:90104145-90104167 GTATTGTTATAGTTTGCTGCAGG + Intergenic
1100044680 12:90365059-90365081 TTGTTTTTGTTGTTTGTTGCAGG + Intergenic
1100053704 12:90483215-90483237 TTTTTGTTTTTGTTATTTGCAGG + Intergenic
1100086755 12:90920389-90920411 TTGTTGTTGTTGTTACCAGCTGG + Intronic
1100103864 12:91144330-91144352 TTTTTGTTGTTGTTCAGAGCTGG - Exonic
1100236436 12:92666468-92666490 GTTTTGTTATTATTTTCTGCAGG - Intergenic
1100304194 12:93335593-93335615 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1100648077 12:96552347-96552369 TTTTTGTTGTTTTTTGAAACAGG + Intronic
1100817042 12:98396610-98396632 TTTTTGTTGTTGTTGTTTGGGGG + Intergenic
1100905249 12:99291093-99291115 TTTTTCATATTGTTTGCTGTTGG - Intronic
1100981100 12:100163243-100163265 TTTTTTTTTTTTTTTGCTGCAGG + Intergenic
1101222928 12:102659273-102659295 TTATTGTTGGTCTCTGCTGCTGG - Intergenic
1101250936 12:102934709-102934731 TTTTTCAGATTGTTTGCTGCTGG + Intronic
1101414435 12:104497114-104497136 TTGTCATTTTTGTTTGCTGCAGG + Intronic
1101548335 12:105738090-105738112 TTTTTGTTATTGTGTGATTCTGG + Intergenic
1101580133 12:106035424-106035446 TTTTTTTTTTTTTTTGATGCAGG + Intergenic
1101582411 12:106053539-106053561 TTTTTGTTGTTGTTTTGGGAGGG - Intergenic
1101623301 12:106412270-106412292 TTTCAGCTGATGTTTGCTGCAGG - Intronic
1101665082 12:106805489-106805511 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1101938129 12:109075844-109075866 TTTTTTTTTTTTTTTGCTGTTGG + Intronic
1101956650 12:109217792-109217814 TTTTTGTTGTTTTTTGAGACAGG - Intronic
1102159064 12:110753982-110754004 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1102185797 12:110947637-110947659 TTTTTGTATTTGTTTGCTATGGG + Intergenic
1102358004 12:112256240-112256262 TTCTTATTTTTCTTTGCTGCTGG - Intronic
1102830519 12:115994459-115994481 TTTTTGTTTTTGTTTTTTGGGGG - Intronic
1102902984 12:116653047-116653069 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1103077293 12:117994350-117994372 TTGTTGTTGTTGTTTGACACAGG - Intergenic
1103081983 12:118031443-118031465 TTTTTGTGGTTGTTTGGAGCAGG + Exonic
1103424090 12:120816509-120816531 TTTTTGTTGTTGTTTCTTTTTGG + Intronic
1103441813 12:120968556-120968578 TTTTTGTTTTTGTTTTTTGAAGG + Intergenic
1103854102 12:123953234-123953256 TTTTTTTTTTTGGTTGCTACTGG - Intronic
1104136481 12:125944474-125944496 TTGTTGTTGTTGTTTTAGGCAGG - Intergenic
1104147768 12:126052257-126052279 TTTTTGTTTTTGTTTGGTGGGGG - Intergenic
1104235743 12:126934667-126934689 TTTTTGTTTTTGTTTTGAGCAGG - Intergenic
1104241219 12:126991627-126991649 TTTTTGTTGTTGTTGGAGGGGGG - Intergenic
1104516075 12:129428094-129428116 CTTTTGTTTTTGTTTGCTTGTGG - Intronic
1104947132 12:132420753-132420775 TTGTTGTTGTTGTTTGGAGATGG + Intergenic
1105327026 13:19380131-19380153 GTTTGGTTTTTGTTTGCTGTTGG + Intergenic
1105361544 13:19722791-19722813 TTTTTGTTTTTGTTTTCTTGAGG - Intronic
1105559216 13:21474690-21474712 TTTTTCTTTTTCTTTGCTGCAGG + Intergenic
1105754854 13:23454649-23454671 TCTTTTTTCTTGATTGCTGCAGG - Intergenic
1106181115 13:27370123-27370145 TTTTTGTTTTGGTTTGCTTTGGG - Intergenic
1106290619 13:28357874-28357896 TTTTTTTTTTTTTTTTCTGCAGG + Intronic
1106449487 13:29867078-29867100 TTTTTGTTTTTGTTTGTTTTTGG - Intergenic
1106538866 13:30672275-30672297 TTGTTGTTGTTGTTTTCAGATGG - Intergenic
1106737326 13:32600857-32600879 TTTTAGTTGTTGTTTTCTTCTGG + Intronic
1106747970 13:32724120-32724142 TTGTTGTTGTTGTTTGTGTCAGG + Intronic
1106859633 13:33891643-33891665 TTTTTGTTGTTGTTCATTGATGG - Intronic
1106993344 13:35450479-35450501 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1107043382 13:35971877-35971899 TTGTTGTTGTTGTTTGCACAAGG + Intronic
1107056124 13:36105804-36105826 TTTTTTTGTTTGTTTGTTGCAGG + Intronic
1107084290 13:36409024-36409046 ATTTTGTTGTTATTTGCTGCTGG - Intergenic
1107362228 13:39632134-39632156 GTTTTGTTTTTGATTGCTGTAGG + Intergenic
1107492659 13:40896202-40896224 TTTTTTTTTTTTTTTGCTGGGGG - Intergenic
1107854357 13:44600188-44600210 TTGTTGTTGTTGTTTGAGACGGG + Intergenic
1108085965 13:46794153-46794175 TTGTTGTTGTTGTTTTTTGGAGG - Intronic
1108525597 13:51283445-51283467 TTTTTGTTGTTGACTGGAGCTGG - Intronic
1108873381 13:55014979-55015001 TTGTTGTTGTTGTTTTTGGCAGG + Intergenic
1108945178 13:56014169-56014191 TTTTAGTAGTTGTTTGCTTTGGG - Intergenic
1109038198 13:57294076-57294098 TTTTTCTTTTTGTTCTCTGCAGG - Intergenic
1109241951 13:59900552-59900574 GTTTTGTTTGTTTTTGCTGCTGG - Intronic
1109476326 13:62883955-62883977 TTTTTTGTGTTGTTTGCTGTTGG - Intergenic
1109586832 13:64415808-64415830 TTTTTTTTTTTTTTTGCTGGGGG + Intergenic
1109697564 13:65979936-65979958 TTGTTGTTGTTGTTGGATGATGG + Intergenic
1110078588 13:71282177-71282199 TTTTTCATATTGTTTGCTGTTGG + Intergenic
1110160613 13:72373825-72373847 ATTTTGTTGTTGTTTGGTTGTGG + Intergenic
1110401745 13:75100069-75100091 TTTTGGTTGTTTTTTGCAACAGG - Intergenic
1110429028 13:75401720-75401742 TTCTTGTTGTTGTTAGCTACTGG + Intronic
1110692854 13:78452225-78452247 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1110871170 13:80453835-80453857 TTTTTGTTGTTTTATGCTTTTGG - Intergenic
1110954815 13:81540853-81540875 TTGTTGTTTTTGTTTGCTTAAGG - Intergenic
1111290530 13:86162777-86162799 TTGTTGTTGTTGTTCCCTTCTGG - Intergenic
1111490004 13:88960065-88960087 TTTTTGTTTTTTTTTTTTGCTGG - Intergenic
1111546331 13:89741582-89741604 TTTTTTTTCTTTTTTGCTTCTGG + Intergenic
1111794869 13:92905769-92905791 TTTTTGTTGTTGTTGAAAGCTGG - Intergenic
1112010913 13:95293184-95293206 TTTTTGTTGTTGTTAGAGACAGG - Intronic
1112117903 13:96377345-96377367 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1112270705 13:97966567-97966589 TTTTTTTTGTTTTTGGCAGCAGG + Intronic
1112390557 13:98980029-98980051 TTATTGTTGTTGTTTGAGACAGG + Intronic
1112535586 13:100251947-100251969 TGTTTGTTGTTTTGTGCTGATGG - Intronic
1112836748 13:103524172-103524194 TTGTTGTTGTTTTCTGCTGTGGG + Intergenic
1113153460 13:107290170-107290192 TTTTTGTTTTTTTTTTTTGCTGG - Intronic
1113160940 13:107380601-107380623 TTTTAGTTGTTGTTTATTTCTGG - Intronic
1113445886 13:110366503-110366525 TTACTGTTGTTGTTTTCTTCTGG + Intronic
1113693728 13:112329793-112329815 TTGTTGTTGTTGTTTGGAGATGG + Intergenic
1114143114 14:19939959-19939981 TTTTTGTTGTTGTTTGTTAAAGG - Intergenic
1114740077 14:25087792-25087814 TTTTTGTTGTTGTTTGGCTTGGG - Intergenic
1114888889 14:26890739-26890761 TTTTTTTGGTTGTGTGATGCAGG + Intergenic
1114889958 14:26907543-26907565 TCATTGGTCTTGTTTGCTGCTGG + Intergenic
1114958286 14:27849897-27849919 TTGTTGTTGTTGTTTTCTGTTGG - Intergenic
1115116066 14:29881563-29881585 TTTTTGTTTTGTTTTGCTTCTGG + Intronic
1115170533 14:30500563-30500585 TTTTTTTTGGTGTTCGGTGCAGG - Intergenic
1115359649 14:32487281-32487303 TTTTTGTTGTTGTCTGTGCCAGG + Intronic
1115833279 14:37366261-37366283 TTTTTCTTCTTTTTTGCTGTAGG + Intronic
1115868375 14:37773294-37773316 TTTTTGTTGCAATTTGCTTCTGG + Intronic
1115887644 14:37991553-37991575 TTTTGGTTGTTGTTTGCATGTGG - Intronic
1116077946 14:40135918-40135940 TTTGCTTTTTTGTTTGCTGCTGG + Intergenic
1116266979 14:42704815-42704837 TTTTTGTTGTTGTTGTTTTCTGG + Intergenic
1116595219 14:46833106-46833128 TTTTTTTTTTTTTTTGCTCCTGG + Intergenic
1116727908 14:48585918-48585940 TTGTTGTTGTTGTTTGCTTTTGG - Intergenic
1117096138 14:52300290-52300312 TGGTTGTTGTTGTTTGTTGTTGG + Intergenic
1117161098 14:52990670-52990692 TTTTTCTAGTTTTTTGCTGTAGG + Intergenic
1117324848 14:54659468-54659490 TTTTTGTTTTTGGTTTCTGAGGG + Intronic
1117357928 14:54943941-54943963 GTTTTGTTTTTGTTTGAGGCAGG - Intronic
1117429734 14:55644565-55644587 TTTTTTTTTTTTTTTGCTGTGGG + Intronic
1117600676 14:57371271-57371293 TTTTGGTTGTGGTTTTCTGTAGG - Intergenic
1117612965 14:57503286-57503308 TTGTTGTTGTTGTTTGGGGGAGG + Intergenic
1117909118 14:60619603-60619625 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1117987336 14:61400431-61400453 TTTTTGTGTTTGTTTTTTGCTGG + Intronic
1118033923 14:61845778-61845800 TTTTTCTTGTTTTTTGATGTAGG + Intergenic
1118354023 14:64996773-64996795 TTTTTTTTTTTTTTTGCTTCTGG + Intronic
1118525776 14:66640418-66640440 TTTTTGTTGTTGTTTTGTTGAGG - Intronic
1118652269 14:67909671-67909693 TTTTTGTTGTTGTTTTGTTTTGG + Intronic
1118874568 14:69772640-69772662 TTTTTGTTTTTTTTTGAGGCAGG + Intergenic
1119065274 14:71519291-71519313 TTTTTGTTTTTGTTTGAGGCAGG - Intronic
1119207350 14:72804414-72804436 TTTTTGTTGTTGTTTGCTCCTGG - Intronic
1119283046 14:73426840-73426862 TTTTTGTTGTTGTTTTGAGATGG - Intronic
1119306800 14:73614193-73614215 TTGTTGTTGTTGTTTGAGGCAGG - Intronic
1119347966 14:73942009-73942031 TTTTTGTTGTTGTTTTTAGATGG + Intronic
1119537758 14:75416833-75416855 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1119617063 14:76105810-76105832 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1119676675 14:76560884-76560906 TTTTTTTTTTTTTTTGCAGCTGG - Intergenic
1119734049 14:76969883-76969905 TTTTTGTTTTTGTTTTCAGATGG + Intergenic
1119784849 14:77305351-77305373 TTTTTGTTTTTTTAAGCTGCTGG + Intronic
1119978118 14:79048629-79048651 TTTTTTTTATTTTTTGCTGGTGG + Intronic
1120013340 14:79442481-79442503 TTTTTGTTTTTGTTTTCTATAGG - Intronic
1120078881 14:80191934-80191956 ATTTTGCTGTTGTTTGATGAAGG - Intergenic
1120115398 14:80611311-80611333 CTTTTTTTGTTATTTGATGCTGG - Intronic
1120213840 14:81660870-81660892 TTTTTGTTTTTGTTTTTTGATGG - Intergenic
1120383283 14:83810288-83810310 TTTTTGTTTTTGTATATTGCTGG - Intergenic
1120416789 14:84229483-84229505 TTGTTGTTGTTGTTTTGTCCTGG - Intergenic
1120531389 14:85636384-85636406 TTTTTTTTTTTTTTTTCTGCAGG - Exonic
1120536214 14:85699166-85699188 TTTTTTCTGTTGATTGCTTCTGG + Intergenic
1120655709 14:87187592-87187614 TTTTTGTTTTTGTTTTCTTAAGG - Intergenic
1120672368 14:87377714-87377736 TTATTGTTGTTGTTTGTGGTTGG + Intergenic
1121040060 14:90739017-90739039 TTTTTGTTGTGTTTTGAGGCAGG - Intronic
1121161666 14:91748158-91748180 TTTTTGTTTTTGTTTGGAACTGG - Intronic
1122299337 14:100723110-100723132 TTTTTGTTTTTTTTTTTTGCCGG - Intergenic
1122512281 14:102279298-102279320 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1122750049 14:103926652-103926674 TTTTTGTTGTTGTTTTGAGACGG - Intronic
1123191259 14:106574469-106574491 TTTTTGTTATGGTTTATTGCTGG + Intergenic
1202845063 14_GL000009v2_random:163063-163085 ATTTAGCTGTTGTTTTCTGCTGG + Intergenic
1202875722 14_GL000225v1_random:208162-208184 ATTTAGCTGTTGTTTTCTGCTGG - Intergenic
1202878206 14_KI270722v1_random:29378-29400 ATTTAGCTGTTGTTTTCTGCTGG - Intergenic
1123878155 15:24645680-24645702 TTTTTGTTGTTGTTTTGAGACGG - Intergenic
1123966266 15:25462321-25462343 ATTTTCTAGTTGTTTGCTGCTGG - Intergenic
1124084849 15:26538625-26538647 TTTTTTTTTTTTTTTGCTTCAGG + Intergenic
1124203339 15:27697114-27697136 TCTGTGTTGTTGGGTGCTGCAGG - Intergenic
1124848436 15:33312861-33312883 TTTTTGTTTTTGTTTGTTTTTGG + Intronic
1125185097 15:36920979-36921001 TTTTTGTTTTTGTTTTTTCCTGG - Intronic
1125227854 15:37415233-37415255 TTTTTGTTTTTGTTTTTTCCTGG + Intergenic
1125352379 15:38781304-38781326 TTGTAGTATTTGTTTGCTGCTGG + Intergenic
1125544299 15:40490966-40490988 TTTTTGTTGTTGTTTTGAGACGG + Intergenic
1125549160 15:40531618-40531640 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1125565409 15:40674087-40674109 TTTTTGTTATTTTTTGATGTAGG + Intergenic
1125648641 15:41294700-41294722 GTTTTGTTGTTGTTTGAGACAGG + Intergenic
1125790434 15:42361464-42361486 TTATTGTTGTTGTTTGAGACTGG - Intronic
1126057579 15:44745231-44745253 TTGTTGTTGTTGTTTGATTTGGG + Intronic
1126126888 15:45302541-45302563 TTGTTGTTGTTGTTTGGTTTTGG + Intergenic
1126159408 15:45596201-45596223 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1126357951 15:47816045-47816067 ATTTTGTTCTTGTGTGCTGTGGG - Intergenic
1126502682 15:49363726-49363748 CTTTTGATGATGTTTGCTGTGGG + Intronic
1126602923 15:50447243-50447265 TTTTTGTTGTTGTTTTCAAACGG + Intronic
1126635212 15:50772941-50772963 TTTTTGTTGTTGTTGAATGTAGG - Intergenic
1126725757 15:51629967-51629989 TTTTTGTTGTTGTGTGGTGGTGG + Intergenic
1126819754 15:52490722-52490744 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1126855718 15:52837625-52837647 TTTTTTTTTTTTTTTACTGCAGG + Intergenic
1126863392 15:52910092-52910114 TTTTTGTTGTTGATTCTTTCAGG - Intergenic
1127177751 15:56379155-56379177 TTTTTGTTCTTTTTTGTTGTAGG + Intronic
1127196795 15:56595536-56595558 TTTTTCAGATTGTTTGCTGCTGG - Intergenic
1127236959 15:57064359-57064381 TTTTTGTTTTTGTTTTTTGCTGG - Intronic
1127255768 15:57291528-57291550 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1127471144 15:59291410-59291432 TGTTTGTTGGTGTTTGTTGGAGG + Intronic
1128599681 15:68985446-68985468 TTTTTTTTCTTATTTGCTGGTGG - Intronic
1128664668 15:69529427-69529449 TTCTTGTTGTTGTTTGAGACAGG + Intergenic
1128964164 15:72040760-72040782 TTTATTTTTTTGTTTCCTGCTGG - Intronic
1129103489 15:73288159-73288181 TTGTTGTTGTTGTTGGGGGCAGG + Intronic
1129346266 15:74921723-74921745 TTTTTGTTGTTGTTTTGAGACGG - Intronic
1129425654 15:75460679-75460701 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1129557583 15:76529047-76529069 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1129564024 15:76602525-76602547 TTTTTGTTTTTGTTTTTTGGGGG + Intronic
1130433871 15:83876601-83876623 TTTTTGTTGTTGTTTGTTTGTGG + Intronic
1130626281 15:85518821-85518843 TTTTTGTTGTTGTTTGAGACAGG - Intronic
1130765162 15:86862713-86862735 TTTTTGTTTTTGTTTGGAGATGG - Intronic
1131087452 15:89588893-89588915 TTTTTGTCGTTATTTTCAGCAGG + Intronic
1131208769 15:90475001-90475023 TTTTTTTTTTTTTTTGCTGACGG + Intronic
1131241244 15:90745413-90745435 TTTTTGTTGTTTTTTGAAACAGG + Intronic
1131623483 15:94092607-94092629 TTTTTGTTTTTGTAGGATGCAGG - Intergenic
1131731855 15:95290212-95290234 TTTTTTTTTTTTTTTGCAGCAGG + Intergenic
1131766544 15:95681908-95681930 TGTTTGTTGTTTTTTGTTCCTGG + Intergenic
1132052303 15:98617044-98617066 TTATTGTTGTTGTTTGAGACAGG - Intergenic
1132186075 15:99802894-99802916 TTCTTATTGTTGTTTATTGCTGG + Intergenic
1132261653 15:100430329-100430351 TTTTTGTTTTTGTTTTCTTTTGG - Intronic
1132304377 15:100800921-100800943 GGTTTGTTGTTGTTTTCAGCAGG + Intergenic
1132366662 15:101262648-101262670 TTTTTGTTGTTGTTTTGGCCTGG + Intergenic
1132420088 15:101658304-101658326 TTTTTTTTTTTTTTTGCTGATGG - Intronic
1132429599 15:101749813-101749835 TTCTTATTGTTGTTTATTGCTGG - Intergenic
1132479234 16:158690-158712 TTTTTGATGTTATTTACTGAAGG + Intronic
1132713889 16:1281070-1281092 TTTTTTTTTTTTTTTGCAGCAGG + Intergenic
1132878164 16:2149311-2149333 TTTTTTTTTTTTTTTGCTGGGGG + Intronic
1132916108 16:2345800-2345822 TCTTTGTTGTTGTTTGGAGATGG + Intergenic
1133222856 16:4326612-4326634 TTTTTGTTGTTTTTTGAGACAGG + Intronic
1133556917 16:6914546-6914568 TTTTTATTTTTGTTTTCTTCTGG - Intronic
1133753993 16:8748086-8748108 CTTTTGTTGTTCTTGCCTGCAGG + Exonic
1133814783 16:9188370-9188392 TTGTTGTTGTTGTTTTCAGATGG - Intergenic
1133942646 16:10323106-10323128 TTGTTGTTGTTGTTTTGTGACGG - Intergenic
1134043119 16:11083166-11083188 TGTTTGTTGTTGTTTGAGGCAGG + Intronic
1134143815 16:11743907-11743929 TTTTGGTTGTTTTTTGATACAGG + Intergenic
1134162754 16:11905060-11905082 TTGTTGTTATTGTTTGATACAGG - Intronic
1134463621 16:14452044-14452066 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1135417816 16:22282190-22282212 TTTTTGTTGTTTTTTGAGACAGG - Intronic
1135422000 16:22311478-22311500 TTTTTGTTGTTGTTTGTTTTGGG + Intronic
1135565162 16:23506363-23506385 TATTTGTTGTTGTTTTCTTCTGG - Intronic
1135590039 16:23698560-23698582 TTTTTGTTTTTGTTTTTTGTGGG + Intronic
1135742845 16:24991465-24991487 TTTTTGTTTTTGTGTGGTCCAGG - Intronic
1135888856 16:26338992-26339014 CTTTTGTTGTTCCTTGCTGGGGG - Intergenic
1135894542 16:26387004-26387026 TTTTTTTTGTTGTTTGAGACAGG + Intergenic
1136078366 16:27832810-27832832 GTTTTGTTGTTGTTTACTGTTGG + Intronic
1136090758 16:27918276-27918298 TGGTTGTTGTTTTTTTCTGCTGG - Intronic
1136357348 16:29753781-29753803 TTTTTGTTGTTGTTAGAGACAGG - Intergenic
1136390300 16:29960158-29960180 TTTTTGTTTTTGTTTTTTGTGGG + Intronic
1136407352 16:30055803-30055825 TTTTTGTTGTTGTTTGAGACAGG + Intronic
1136558455 16:31023614-31023636 TTATTGTTGTTGTTTTGAGCAGG - Intergenic
1136717692 16:32297533-32297555 TTTTTGTTGTTGTTTTGAGATGG + Intergenic
1137013356 16:35346182-35346204 TTTTTGTTTTTTTCTGCTGTGGG - Intergenic
1137254941 16:46767116-46767138 TTTTTGTTGTTTTCTGTTGTTGG + Intronic
1137263044 16:46846481-46846503 TTGTTGTTGTTGTTTGGTTGGGG - Intergenic
1137423520 16:48356504-48356526 TTTTTTTTTTTTTTAGCTGCTGG - Exonic
1137632251 16:49955155-49955177 TTTTTGTTTTTGTTCTCTGCAGG - Intergenic
1137786974 16:51147326-51147348 TTTTTTTTGTGATTTGCTTCAGG - Intronic
1137850815 16:51740573-51740595 GTTTGTTTGTTTTTTGCTGCAGG - Intergenic
1139199531 16:64959542-64959564 TTTTTGTTGTTGTTGGATTGAGG + Intronic
1139213281 16:65101956-65101978 TTTTTGTTGTTGTTTGTTTCAGG + Intronic
1139216645 16:65132186-65132208 TTATTGTTGTTGTTTTAAGCAGG + Intergenic
1139487604 16:67267090-67267112 TTTTTTTTTTTTTTTGCTACGGG + Intronic
1139541935 16:67624591-67624613 TTTTTGTTTTTGTTTTTTACTGG + Intronic
1139602668 16:67995964-67995986 TTGTTGTTGTTGTTTGGCGGGGG - Intronic
1139693173 16:68654404-68654426 TTTTTTTTTTTTTTTGCGGCTGG + Intronic
1139745212 16:69068715-69068737 TTTTTGTTGTTGTTTTGAGATGG + Intronic
1139824187 16:69744312-69744334 TTTTTCTTGTTGTTTGAGACAGG - Intronic
1139842104 16:69889958-69889980 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1139845206 16:69916198-69916220 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1139929954 16:70518362-70518384 TTTTTGTTTTTGTTTGAGACAGG + Intronic
1139941814 16:70610977-70610999 TTTTTGTTGTTGTTTGAGACAGG + Intronic
1140055082 16:71518943-71518965 TTGTTGTTGTTGTTTTCAGCTGG + Intronic
1140085023 16:71787475-71787497 TTTTTGTTGTTTTTAGAGGCAGG - Intronic
1140404335 16:74698228-74698250 TTTTTGTTGTCGTTTGTTAGTGG - Intronic
1140447280 16:75040576-75040598 TTTTTGTTTTTGTTTTTTGTGGG + Intronic
1140730348 16:77850646-77850668 TTTTTGTTTTTGTTTTCTTTTGG + Intronic
1140806825 16:78540221-78540243 TTTCTGTTGCTCCTTGCTGCAGG - Intronic
1140965637 16:79963637-79963659 TTTTTGTTGTTGTTGTTTGTTGG - Intergenic
1141183619 16:81771688-81771710 TTTTTGTTGTTGTTTTTTTTGGG - Intronic
1141281614 16:82634305-82634327 TTTCTTGTGTTGTGTGCTGCAGG + Intronic
1141370286 16:83480308-83480330 TTATTGTTGTTGTTTGAGACAGG - Intronic
1141948827 16:87327648-87327670 TTTTTGTTGTTTTTTGAGACAGG - Exonic
1142308089 16:89296829-89296851 TTTGTGCTGTTTTATGCTGCTGG - Intronic
1142329091 16:89438984-89439006 TTTCTGTTTTTGTTTGAGGCAGG - Intronic
1142330091 16:89446596-89446618 TTTTTGTTTTTGTTTGAGACGGG - Intronic
1142388228 16:89780616-89780638 TTTTTTTTTTTTTTTGATGCAGG - Intronic
1142419087 16:89959475-89959497 TTTTTGTTTTTGTTTGTTTTTGG + Intronic
1143189053 17:5028341-5028363 TTTTTGTTGTTGTTGTCACCTGG + Exonic
1143693573 17:8591775-8591797 TTTTTGTTGTTGTTTGACAGGGG - Intronic
1143695279 17:8610423-8610445 TTTTTATTTTTTTTTGCTTCTGG - Intronic
1144005496 17:11095670-11095692 TTGTTGTTGTTTTTTGTTGTTGG - Intergenic
1144162390 17:12572581-12572603 TTTTTGTTTTGTTTTGCTTCTGG + Intergenic
1144434412 17:15227266-15227288 TTTTTGTTGTTGTTTGTGTAGGG + Intergenic
1144707917 17:17381670-17381692 TTTTTGTTTTTGTTTTTGGCGGG + Intergenic
1144995620 17:19266136-19266158 TTTTTATTTTTGTTTGGAGCAGG - Intronic
1145210897 17:21012256-21012278 TTTTTGTTTTTGTTTTTTTCAGG - Intronic
1145226058 17:21128902-21128924 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1145407502 17:22617645-22617667 TTTTTGTTGTTGTTTCTTATTGG + Intergenic
1146143117 17:30387119-30387141 TTGTTGTTGTTGTTTTCAGATGG + Intronic
1146436358 17:32852139-32852161 TTTTTGTTGTTTTTTGAGACAGG + Intronic
1146617257 17:34366814-34366836 TTTCTGTGGTTGTATGTTGCTGG - Intergenic
1146769790 17:35558235-35558257 TTGTTGTTGTTGTTTGTTTTGGG + Intergenic
1146794404 17:35771045-35771067 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1146808492 17:35884645-35884667 TTGTTGTTGTTGTTTGAAACAGG + Intergenic
1146838389 17:36131296-36131318 TTTTTTTTTTTTTTTGCTGCTGG - Intergenic
1146965492 17:37025213-37025235 TTTTTGTTGTTGTTTTTTGAGGG + Intronic
1147355159 17:39889838-39889860 TTTTTGTTGTTGTTGGGTGGGGG + Intergenic
1147370198 17:39987341-39987363 TTTTGGTTGTTGTTTGGTTGGGG + Intronic
1147576314 17:41601743-41601765 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1147589663 17:41673995-41674017 TTTTTGTTTTTGTTTGAGACCGG + Intergenic
1147690422 17:42311567-42311589 TTTTTGTTTTTGTTTTTTCCAGG - Exonic
1147771326 17:42869804-42869826 TTTTTGTTGTTGTTTGAAACAGG + Intergenic
1148201883 17:45754597-45754619 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1148272986 17:46278407-46278429 TTTTTGTTGTTGTTTTAAGATGG + Intronic
1148483790 17:47977605-47977627 TTTTTCTTGGTGTTTGGTACAGG + Intronic
1148649386 17:49238789-49238811 TTCTTGTTATTGGTTGCTGTGGG + Intergenic
1148762136 17:50010716-50010738 TTGCTGTTGTTGCTTACTGCAGG + Intergenic
1149004202 17:51788063-51788085 TTTTTCTTCTTTTTTGATGCAGG + Intronic
1149405274 17:56343062-56343084 TTTTTGTTGTTGTTCTTTGTTGG + Intronic
1149414818 17:56448272-56448294 TTTTTGTTTTTTTTTTCAGCAGG - Intronic
1149504431 17:57182324-57182346 TTTTTGTTTTTGTTTTCAGATGG + Intergenic
1149692605 17:58590559-58590581 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1149742547 17:59060334-59060356 TTTTTTTTTTTGGTTGTTGCAGG + Intronic
1150068594 17:62132879-62132901 TTTTTGTTGTTGTTTTTTCTGGG - Intergenic
1150071505 17:62154643-62154665 TTTTTGTTGTTGTTTTTAGATGG + Intergenic
1150193313 17:63266855-63266877 TTGTTGTTGTTGTTTGAAACAGG + Intronic
1150341561 17:64372508-64372530 TTTTTGTTGTTGTTTTGAGATGG + Intronic
1150372160 17:64648746-64648768 TTTTTGTTTTTGTTTGAAACAGG - Intronic
1150435594 17:65151936-65151958 TTTCTGTTGTTGTTTGCTGCTGG - Intronic
1150482807 17:65523509-65523531 TTTTTTTTTTTTTTTGCTGGTGG + Intergenic
1150585334 17:66512433-66512455 TTTTTGTTGTTGTTGGAGACAGG - Intronic
1150628942 17:66863369-66863391 TTGTTGTTGTTGTTTTCAGATGG + Intronic
1150646867 17:66984204-66984226 TTTTTGTTGTTGTTAGAAACGGG - Intronic
1150715101 17:67566207-67566229 TGTTTGTTGTTTTTTGATACAGG + Intronic
1150905974 17:69337816-69337838 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1151194877 17:72424339-72424361 TTTTTTTTTTTTTTTACTGCTGG + Intergenic
1151195349 17:72427335-72427357 TTTTTTTTTTTTTTTGCTGCTGG + Intergenic
1151372766 17:73659375-73659397 TTGTTGATGTTCTTTGCAGCAGG - Intergenic
1151406655 17:73891914-73891936 ACTTTGGTGTTGTTTGCTACTGG - Intergenic
1151612997 17:75188957-75188979 TTTTTGTTGTTTTTTGAGGTAGG - Intergenic
1151847054 17:76663978-76664000 TTTTTGTTTTTGTTTGGAGATGG + Intergenic
1151861983 17:76771031-76771053 TTTTTGTTGTTGTTAGAGACAGG - Intronic
1151868846 17:76822842-76822864 TTCTTGTTGTTGTTTGAGACAGG + Intergenic
1151936349 17:77264137-77264159 TTTTTGTTGTTTTTTGAGACAGG - Intergenic
1151947681 17:77328369-77328391 TTGTTGTTGTTGTTTGATACGGG + Intronic
1152021470 17:77782045-77782067 CTTTTATTGTTGTTTGGTTCTGG + Intergenic
1152274357 17:79346857-79346879 TATTTGTGTGTGTTTGCTGCTGG + Intronic
1152429626 17:80241263-80241285 TTCTTGTTGTTGTTTGAGACAGG + Intronic
1152590714 17:81210562-81210584 TTTTTGTTTTTGTTTTTTGACGG - Intronic
1153052349 18:910879-910901 TTTTTTTTTTTGTTTGATGCAGG + Exonic
1153193877 18:2571784-2571806 TTTTGGTGTTTGTTTGCTGTTGG + Intronic
1153258775 18:3200162-3200184 TTTTTGTTTTTGTTTTCAGCTGG - Intronic
1153267542 18:3285865-3285887 TCTTTGTTGTTGTTTTTTTCTGG - Intergenic
1153386043 18:4498039-4498061 TTTGTGTTTTATTTTGCTGCTGG - Intergenic
1153403929 18:4713745-4713767 TTCTTGTTCTTGTTTCCTTCTGG - Intergenic
1153448996 18:5205654-5205676 TTTTTGTTGTTTTATTTTGCTGG + Intergenic
1153605888 18:6831414-6831436 TCTTTTCTGTTGTTTGTTGCTGG + Intronic
1153677677 18:7469858-7469880 TTTTTGTTTTTGTTTTTTACAGG - Intergenic
1153762301 18:8343401-8343423 TTTCTGTTGTGTTTTGCTGCAGG + Exonic
1153786731 18:8542124-8542146 TTTTTTTTTTTTTTTGATGCAGG - Intergenic
1153844944 18:9041077-9041099 TTTTTGTTGTTTTTTTCAGACGG - Intergenic
1154029128 18:10735639-10735661 TTTTTGTGCATGTTTGCAGCTGG - Intronic
1154193719 18:12251272-12251294 TTTTTGTTTTTTTTTGGTGGAGG - Intergenic
1154198228 18:12281486-12281508 TTTTTTTTGTTGTTAGCAACAGG + Intergenic
1154283891 18:13033967-13033989 TTTTAGCTGTTGGTTGCTTCTGG + Intronic
1154461098 18:14587580-14587602 TTTTTGTAGTTGTTTGTTCAAGG - Intergenic
1154952541 18:21224398-21224420 TTTTTTTTTTTTTTTGCTGGTGG + Intergenic
1155247155 18:23921674-23921696 TTTTTGTGTTTGTTTGTTGGTGG - Intronic
1155291259 18:24344810-24344832 TTTTTGTTTTTGTTTTCTTGGGG + Intronic
1155303957 18:24460331-24460353 TTGTTGTTGTTGTTTGGAGATGG - Intergenic
1155314018 18:24553082-24553104 TTCTTGTTGTTGTTTGAGACAGG - Intergenic
1155344819 18:24847857-24847879 ATTTTGTTTTCTTTTGCTGCTGG - Intergenic
1155855417 18:30828658-30828680 TTTTTGTTTTTGTTTGTTTGGGG - Intergenic
1156045048 18:32868518-32868540 TTTTTGGTGCTGGTTGCAGCAGG + Intergenic
1156179986 18:34591984-34592006 TTTCTGTTTTTGTTTGTTGATGG - Intronic
1156204884 18:34874598-34874620 TTTTTGGTATTATTTCCTGCAGG - Intronic
1156257723 18:35413678-35413700 TTTTTGTTGTTGTTTCAGGTGGG - Intergenic
1156263380 18:35465375-35465397 TTTTTGTTGTTGTTTGAATGAGG + Intronic
1156389492 18:36637291-36637313 TTTTTGTTTTTGTTTGTTTTGGG + Intronic
1156390552 18:36646767-36646789 TTGTTGTTGTTGTTTACACCAGG - Intronic
1156419126 18:36931758-36931780 TTTTTGTTGTTTTTTGCTTTAGG + Intronic
1156870516 18:41940051-41940073 TTTTTGTTTTTGTTTTCTTCTGG - Intergenic
1156952820 18:42923763-42923785 TTTTTTTTTTTTTTTCCTGCAGG - Exonic
1157089533 18:44620379-44620401 TATTTTTATTTGTTTGCTGCTGG - Intergenic
1157303244 18:46496101-46496123 TTTTTCTTTTTGGTTGCTGGGGG - Intronic
1157371371 18:47115348-47115370 TTTTTGTTGTTGTTCTCTCTAGG - Exonic
1157904490 18:51557192-51557214 TTTTTGTTGTTGTTTTTTGTTGG + Intergenic
1158089443 18:53693786-53693808 TTGTTGTTGTTGTTGGATACAGG + Intergenic
1158263816 18:55638118-55638140 TTTTCGTTTTTGTTTTTTGCCGG + Intronic
1158275424 18:55761672-55761694 TTTTTGTTGTTGTTGTTTGCTGG + Intergenic
1158275425 18:55761675-55761697 TTGTTGTTGTTGTTTGCTGGTGG + Intergenic
1158280822 18:55824127-55824149 TTTTTGCTGTTCTTTTCTGAAGG + Intergenic
1158356998 18:56632292-56632314 TTTTTTTTCTTTTTTCCTGCAGG + Intronic
1158476244 18:57782239-57782261 TCTGTGTAGTTATTTGCTGCTGG - Intronic
1158745053 18:60190290-60190312 TTTGTTTTGTTTTTTGCAGCTGG + Intergenic
1158808199 18:61000336-61000358 TTTTTGTTGTTGTTTTGAGATGG + Intergenic
1158816978 18:61112716-61112738 ATTTTGTAGTTGTTTGCTCTAGG - Intergenic
1158937972 18:62382636-62382658 GTTTTGTTTTGGTTTTCTGCGGG + Intronic
1159182230 18:64923426-64923448 TTTTTGTTGTTGTTAGCAGAAGG - Intergenic
1159587467 18:70294349-70294371 TTTTTGTTGTTGTTCTTTGGAGG + Intronic
1159689865 18:71473226-71473248 TTTTGGTTGTTGATTATTGCAGG + Intergenic
1159906398 18:74096635-74096657 TTTTTTTTTTTGTTTGCTTTGGG - Intronic
1160190524 18:76710983-76711005 TGTTTGGTGTCGTTTCCTGCTGG - Intergenic
1160706662 19:533023-533045 TTTTTGTTGTTGTTGGGAGCGGG + Intronic
1160963132 19:1733492-1733514 TTTTTTTTGTTTTTTGAGGCAGG - Intergenic
1161178508 19:2863487-2863509 GTTTTGTTGTTGTTTTCAGACGG + Intergenic
1161844283 19:6703027-6703049 TTTTTGTTTTTGTTTTCAGATGG - Intronic
1162216912 19:9142508-9142530 TTTTTCTTGTGAATTGCTGCAGG + Intronic
1162269355 19:9601469-9601491 TTTTTTTTTTTTTTTGATGCAGG + Intergenic
1162365576 19:10247063-10247085 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1162671405 19:12260597-12260619 TTTTTGTTTTTGTTTTTTGCGGG - Intronic
1163060967 19:14761405-14761427 TTGTTGTTGTTGTCTTCTGTTGG - Intronic
1163063606 19:14776935-14776957 TTTTTATTGTGCTTTCCTGCTGG - Intronic
1163247105 19:16103379-16103401 TTTTTGTTATTGTTTGTAGACGG - Intergenic
1163408323 19:17137396-17137418 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1163422513 19:17221964-17221986 CTTTTGTTGTTGTTTGAGACAGG - Intergenic
1163471011 19:17497015-17497037 TTTTTGTTGTTTTTTGGTTGGGG - Intronic
1163616483 19:18331936-18331958 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1163952906 19:20607241-20607263 TTTTTGTTGTTTCTTGCTTCTGG - Intronic
1164005411 19:21143872-21143894 TTTTTGTTTTTGTTTTTTTCTGG - Intronic
1164097734 19:22026785-22026807 TTTTTTTTTTTTTTTGCTGGGGG + Intergenic
1164107606 19:22122641-22122663 TTTTTCTTGTTTCTTGCTTCTGG - Intergenic
1164273547 19:23696217-23696239 TGTTTGTTTTTGTTTTTTGCTGG + Intergenic
1164588388 19:29491972-29491994 TTTTTGTTGTTGTTCTCTAGAGG - Intergenic
1164641592 19:29830098-29830120 TTTTTGTTGTTGTTGTCGTCAGG - Intergenic
1164853932 19:31505953-31505975 TTGTTGTTGTTGTTTGACACAGG + Intergenic
1164974160 19:32559393-32559415 TTTTTGTTGTTGTTTTGAGATGG + Intergenic
1165202199 19:34154228-34154250 TTTTTGTTGTTGTTAGAGACAGG - Intergenic
1165251222 19:34537376-34537398 TTTTTGTTGTTGTTGAATACTGG + Intergenic
1165304122 19:34993164-34993186 TTTTTGTTTTTTTTTGGTGGGGG - Intergenic
1165421538 19:35724491-35724513 TTTTTCTTGTTTTTTGAGGCAGG - Intronic
1165645904 19:37436371-37436393 TTTTTCTTCTTGTTTGATGTAGG - Intronic
1165789883 19:38484964-38484986 TTGTTGTTGTTGTTTAGTGATGG - Intronic
1165988195 19:39788918-39788940 TTTTTGTTGTTGTTTTTAGATGG - Intergenic
1166188232 19:41156842-41156864 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1166693304 19:44837426-44837448 TTTTTGTTGTTGTTTTGAGACGG - Intergenic
1166826348 19:45611876-45611898 TTTTTGTTTTTGTTTTATGACGG + Intronic
1166858490 19:45795566-45795588 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1167109581 19:47451312-47451334 TTTTTGTTTTTGTTTGAGACAGG + Intronic
1167196997 19:48036344-48036366 TTTGTGTTGTTGTGTGGGGCAGG + Intronic
1167518634 19:49938747-49938769 TTTTTTTTTTTTTTTTCTGCAGG + Intronic
1167623744 19:50573148-50573170 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1167659645 19:50789116-50789138 TTTTTGTTGTTTTTTGAGACAGG - Intergenic
1168028324 19:53660168-53660190 TTTTTTTTTTTTTTTGCTGGGGG + Intergenic
1168282411 19:55312526-55312548 TTTTTTTTTTTTTTTGCCGCCGG - Exonic
1168450799 19:56465149-56465171 TTTCTGCTGTTGTTGGCAGCAGG - Intronic
1168476471 19:56679064-56679086 TTTTTGTTGTTGTTTTGAGACGG - Intergenic
1168670986 19:58240975-58240997 TTATTGTTGTTGTTTGAGACAGG + Intronic
1168706810 19:58475044-58475066 TTTTTGTTTTTTTTTCCTTCTGG + Intronic
1202672471 1_KI270710v1_random:3548-3570 ATTTAGCTGTTGTTTTCTGCTGG + Intergenic
925021316 2:571036-571058 TTTTTGATATTATTTGCTGTTGG - Intergenic
925049968 2:805715-805737 TTTGTTTTGTTGTTTTCTCCTGG - Intergenic
925075291 2:1011539-1011561 TTTTTCTTTTTGGTTGCTGGTGG + Intronic
925528121 2:4827075-4827097 TGTTTGTTTTTGTTTGCTCTGGG - Intergenic
925636487 2:5946293-5946315 TTTTTGTTGTTGCTTGGTTCTGG - Intergenic
925734720 2:6952995-6953017 TTTTTGTTTTTGTTTGTTACAGG + Intronic
925989375 2:9241634-9241656 TTTTTGTTGTTGTTTGAGCCTGG - Intronic
926081337 2:9988805-9988827 TTTTTGTTGTTGTTTCAGGGTGG + Intronic
926779700 2:16458694-16458716 TTTTTGTTGTTGTTTTGTTTTGG + Intergenic
926920545 2:17935768-17935790 TTTTTTTTATTGTTTGCTTTTGG + Intronic
926997070 2:18747282-18747304 GTTTTGTTGTTGTTTGAGACAGG - Intergenic
927047405 2:19293816-19293838 ATTTTCCAGTTGTTTGCTGCTGG - Intergenic
927104834 2:19814659-19814681 TTGTGATGGTTGTTTGCTGCAGG - Intergenic
927143951 2:20148658-20148680 TTTTTTCTGTGGTTTGCTCCAGG - Intergenic
927320891 2:21744584-21744606 TTTTTTTTTTTTTTTGCTGGTGG - Intergenic
927433148 2:23043932-23043954 TTTTTTTTTTTTTTTGCTGGGGG - Intergenic
927539009 2:23890329-23890351 TTTTTTTTGTTGTTTTCTAGAGG - Intronic
927772620 2:25877619-25877641 CTTTTGTTTTTGTTTGGTGTTGG - Intronic
927774283 2:25889943-25889965 TTGTTGTTGTTGTTTTCAGATGG - Intergenic
927779855 2:25930361-25930383 TTTTTGTTGTTGTTTTGAGATGG + Intronic
927782303 2:25949536-25949558 TTGTTGTTGTTGTTTGAGACAGG - Intronic
927914089 2:26923323-26923345 TTTTTGTTTTTGTTTGAGACTGG - Intronic
928132594 2:28663616-28663638 TTTTTCTTTTTGTCTGGTGCTGG + Intergenic
928521892 2:32097259-32097281 TTTTTGTTGTTATTTGATGTGGG + Intronic
928538325 2:32261186-32261208 TTGTTGTTGTTGTTTTCAGATGG - Intronic
928989142 2:37213062-37213084 TTTTTGTTGTTGTTTTTTGGGGG - Intronic
928990369 2:37226900-37226922 TTTTTGTTGTTGTTTTTTAATGG - Intronic
929129073 2:38548479-38548501 TTTTTGTTGTTGTTTTGAGATGG + Intergenic
929462651 2:42114817-42114839 TTTTTGTTTTTGTTTTTTGGTGG + Intergenic
929472213 2:42205638-42205660 TTGTTGTTGTTGTTTGTTTAAGG + Intronic
929515525 2:42603111-42603133 TTTTTTTTTTTTTTTGCTGGGGG + Intronic
929634228 2:43500716-43500738 TTTTTATTGTACTTTGCTGCTGG - Intronic
929883300 2:45856001-45856023 GTTTTGTTTTTGTTTGTTGAGGG - Intronic
930325146 2:49906814-49906836 TTTTTGTTGTTTTTTGAGACAGG - Intergenic
930395191 2:50814162-50814184 TTTTTGTTTTTGTTTGGTAGAGG + Intronic
930419012 2:51126102-51126124 TTTTTGTGGTTGGTTGCTACAGG + Intergenic
930439491 2:51388983-51389005 TTGTTGTTGTTGTTTGTTTGTGG + Intergenic
930575098 2:53136987-53137009 TTTTTTTTTTTTTTTGCTGTAGG - Intergenic
930638485 2:53831128-53831150 TTTTTTTTTCTTTTTGCTGCAGG + Intergenic
930814506 2:55579861-55579883 TTTTTGTTTTGGTTTGGTTCTGG - Intronic
931248157 2:60508203-60508225 TTGTTGTTGTTGTTTGGGGGTGG - Intronic
931425531 2:62167797-62167819 TTGTTGTTGTTGTTTGGAGACGG - Intergenic
931530501 2:63209076-63209098 TTTTTGTTTTTGTTTTTTACTGG - Intronic
931659470 2:64545563-64545585 TTTTTTTTTTTTTTTACTGCTGG - Intronic
931772357 2:65508881-65508903 TTGTTGTTGTTGTTTTTTGGCGG - Intergenic
931811746 2:65861075-65861097 TCTTTGCTTTTGCTTGCTGCTGG - Intergenic
931837146 2:66111107-66111129 TTTTTGTTGCTGTTTTCTGCAGG - Intergenic
931902170 2:66802163-66802185 TTTTTGTTTTTTTTTGCAGGAGG - Intergenic
932009801 2:67963847-67963869 TTTTTTTTTTTGTTTTCTGGAGG - Intergenic
932082510 2:68727765-68727787 TTGTAGCTGTTGTTTTCTGCAGG - Intronic
932121708 2:69106778-69106800 TTTAGGGGGTTGTTTGCTGCAGG - Intronic
932320486 2:70818704-70818726 TTTTTGTTTTTGTTTTTTGACGG - Intronic
932672602 2:73751482-73751504 TTGTTGTTGTTGTTTGGTTTGGG + Intergenic
932828725 2:74967447-74967469 TTGTTGTTCTTATTTTCTGCAGG + Intronic
932889903 2:75584730-75584752 TTTTTCAGGTTGTTTGCTGTTGG - Intergenic
932890812 2:75596056-75596078 TTTTTTTTTTTTTTTCCTGCTGG - Intergenic
932977138 2:76616255-76616277 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
933100645 2:78252229-78252251 TTTGAGTTGTGGTTTGTTGCCGG + Intergenic
933132126 2:78684596-78684618 TCTTTGTTTTTGTTTGCTTTTGG - Intergenic
933144099 2:78830124-78830146 TTTTTGTTGTCCTTTGCTTAAGG + Intergenic
933405087 2:81847801-81847823 TTTTTGTTGTTGTTTTTTAATGG - Intergenic
933542142 2:83660137-83660159 TCTTTGTTTTTGTTTTCTCCTGG + Intergenic
933899218 2:86837149-86837171 ATTTTGTTGTTGTTTGAGACAGG - Intronic
933929824 2:87138145-87138167 TTTTAGATGTTGTTTGCTAATGG + Intergenic
934001156 2:87713937-87713959 TTTTAGATGTTGTTTGCTAATGG + Intergenic
934070387 2:88378753-88378775 TTTTTGTTGTGTTTTGTTTCTGG - Intergenic
934902907 2:98175092-98175114 TTTTTGTTGTTGTTGACAACTGG - Intronic
934959197 2:98653104-98653126 TTTTTGTTTTCGTTTGTTTCTGG - Intronic
935236075 2:101139309-101139331 TTTTTGTTGTTTTTTGTTTTTGG - Intronic
935614914 2:105068456-105068478 TTGTTGTTGTTATTTGTTTCTGG + Intronic
935781337 2:106512079-106512101 ATTTTGTTGTTGTTTGAGACAGG + Intergenic
935822716 2:106910068-106910090 GTTTTGTTGGAGTTTGCTGGAGG - Intergenic
935902570 2:107808374-107808396 TTTTTGTTTTTGTTTTCAGATGG + Intergenic
936111939 2:109671662-109671684 TTTTTATTGTTTTTTGTTGATGG + Intergenic
936343651 2:111658980-111659002 TTGTTGTTGTTGTTTGGTTTTGG - Intergenic
936700979 2:115011568-115011590 TTGTTGTTGTTGTTTAATGCTGG + Intronic
936849882 2:116883102-116883124 TTTTTTTTTTTTTTTGCTGGAGG + Intergenic
937174435 2:119914262-119914284 TTTTTTTTTTTTTTTGCTTCTGG + Intronic
937487419 2:122329740-122329762 TTTGTTTTGTTGTTTTTTGCTGG - Intergenic
937504851 2:122525669-122525691 TTGTTGTGGTTCTTTGCTGTGGG + Intergenic
937736915 2:125302829-125302851 TTTTTGTTGTGGTTGGTTTCAGG - Intergenic
937841095 2:126525384-126525406 TTAGTGTTGGTCTTTGCTGCTGG + Intergenic
938161166 2:128985734-128985756 GTTTTGTTGTTGTTTTCTGAAGG + Intergenic
938376984 2:130814412-130814434 TTTTTGTTGCTCTTTGTTTCTGG + Intergenic
938595367 2:132783022-132783044 TTTTAGGTGTGGTTTGCTGGAGG + Exonic
938796388 2:134720957-134720979 TTTTTCTTTTTCTTTGCAGCAGG - Intergenic
938894645 2:135738029-135738051 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
938912722 2:135900078-135900100 TTGTTGTTGTTTTTTGTTTCTGG - Intergenic
938987070 2:136587075-136587097 TTTTTGTTGTTGTTTTGTAGAGG + Intergenic
939056312 2:137369112-137369134 TTTTTGTTGTTGTTGTTTGGAGG + Intronic
939056315 2:137369115-137369137 TTGTTGTTGTTGTTTGGAGGGGG + Intronic
939414594 2:141878355-141878377 TTGTTGTTGTTATTTTTTGCCGG - Intronic
939441038 2:142249785-142249807 TTTCTGCTGTTGCTAGCTGCAGG - Intergenic
939540626 2:143490002-143490024 TTTTTGTTTTTGTTTTGTGATGG + Intronic
939725374 2:145713693-145713715 TTTTTGTTGTTGTTTATTTCTGG - Intergenic
939902976 2:147873239-147873261 TTTTGGCTCATGTTTGCTGCTGG - Intronic
940002353 2:148979040-148979062 TTGTTGTTGATGTTTGTTCCAGG + Intronic
940019268 2:149140004-149140026 TTTTTGTTGTTGTGTGGGGGTGG + Intronic
940091477 2:149924358-149924380 TTTTTGTTATTGTTTTTTGTGGG + Intergenic
940162636 2:150729932-150729954 TTTTTGTTTTTGTTTTTGGCCGG - Intergenic
940321241 2:152378979-152379001 TTTTTTTTTTTTTTTGCAGCTGG - Intronic
940346068 2:152630461-152630483 TTGTTGTTGTTGTTGCATGCAGG + Intronic
940585675 2:155645615-155645637 TTTTTTTTTTTTTTTGCTGTGGG + Intergenic
940671237 2:156670861-156670883 TTTTTGTTGTTTTTGGCTGAGGG + Intergenic
940751585 2:157632119-157632141 TATTTGTTGTTGTTTTCTTTTGG - Intergenic
940766609 2:157796542-157796564 TTGTTGTTGTTGTTTGAAACGGG - Intronic
940831256 2:158468944-158468966 TTTTTGTTTTTGTTTTTTGTAGG + Intronic
940943338 2:159588207-159588229 TTTTTTTTTTTTTTTGATGCAGG - Intronic
941202766 2:162533195-162533217 TTTTTGTTGTTGTTTTATTCTGG - Intronic
941221322 2:162785746-162785768 TTTTTGTTGTTGTTGCTTGTTGG + Intronic
941405923 2:165088091-165088113 TTGTTTTTGTTTTTTGCTGTTGG - Exonic
941512071 2:166424367-166424389 TTTTTCTGGTTCTTTGCAGCAGG - Intronic
941590046 2:167408690-167408712 TTTTTCTGATTGTTTGCTGTTGG - Intergenic
942093322 2:172514851-172514873 TTTTTGTTTTTGTTTTCTACTGG - Intergenic
942186441 2:173428949-173428971 TTTTTTTTCTTGTTTGATACAGG + Intergenic
942384277 2:175424813-175424835 TTTTTGTTCTTGTTTCAAGCAGG - Intergenic
942462935 2:176181694-176181716 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
942651296 2:178171146-178171168 TTTTTCTTGTTTTTTGATGTAGG + Intergenic
942861271 2:180615519-180615541 TTTTTGGTGTGGTTTTCTACTGG - Intergenic
942874015 2:180770526-180770548 TTTTTGTTGTTGTTATCAGGTGG + Intergenic
942902817 2:181143716-181143738 ATTTTCTTATTGTTAGCTGCTGG + Intergenic
943120627 2:183730473-183730495 TTTTTGTTTTTGTTTGTTGGTGG - Intergenic
943214062 2:185007363-185007385 TTTTTGTTGTTCTGTCTTGCGGG - Intergenic
943338186 2:186644703-186644725 TCTTAGTTGGTGTTTACTGCAGG + Intronic
943668907 2:190639651-190639673 TTTTTGTTTTTGTTTTTTGACGG + Intergenic
943732742 2:191320154-191320176 GTTTTGTTGTTGTTTTCAACAGG + Intronic
943778613 2:191795840-191795862 TTTCTGTTGTTGGTAGCAGCTGG + Intergenic
943926760 2:193793988-193794010 TTTTTGTTTTTGTTTTCTTTTGG - Intergenic
944064150 2:195601685-195601707 TTTTTTTTTTTTTTTGCTTCAGG - Intronic
944180824 2:196891141-196891163 TTTTTGTTGTTGTTTTATTGTGG + Intronic
944225527 2:197345534-197345556 CTTTTGTTTTTGTTTTCTTCTGG - Intergenic
944288234 2:197975814-197975836 TTGTTGTTGTTGTTGGATGGGGG - Intronic
944301217 2:198126895-198126917 TTGTTGTTGTTGTTTGAGACAGG - Intronic
944305805 2:198177668-198177690 TTTTTGTTGTTGTTGCTGGCAGG + Intronic
944398659 2:199299954-199299976 TTATTGTTGTTGTTTTTTGTGGG + Intronic
944451331 2:199845826-199845848 TTTTTTTTTTTTTTTGCTGAAGG - Intronic
944498916 2:200338028-200338050 TTTTTGTTGTTTTTTGAGACGGG + Intronic
944507241 2:200425157-200425179 TTTTTGTTGTTGTTTGTTACAGG - Intronic
944681501 2:202081549-202081571 TTTTTTTTTTTTTTTGCTGACGG + Intronic
944751310 2:202713617-202713639 TTTTTCTTGTTTTTTGATGTAGG + Intronic
944754859 2:202750505-202750527 TTGTTGTTGTTGTTTGAGACAGG - Intronic
945242551 2:207689456-207689478 TTTTTGTTTTTGTTTTTTGGGGG - Intergenic
945378314 2:209106760-209106782 TTTTTCTTCTTTTTTGATGCAGG - Intergenic
945378362 2:209107804-209107826 TTTTTCTGATTGTTTGCTGTTGG - Intergenic
945381925 2:209150512-209150534 TTTTTGTCGTTGTTTGCCTGAGG - Intergenic
945406016 2:209449826-209449848 TTTTTATTGCTGTGTGTTGCAGG + Intronic
945622842 2:212163796-212163818 TTTTTGTTTTTGTTTGAGGGAGG + Intronic
945655883 2:212623299-212623321 TTTTTGTTTTTATTTGCTTTAGG - Intergenic
945682882 2:212935084-212935106 TTTTTGTTTTTGTTTGGTGAGGG - Intergenic
945732136 2:213552314-213552336 TATTTGTTGTTGGTTGGTGGAGG - Intronic
945937847 2:215921417-215921439 TTTTTTTTGTTTTTTGTTGTTGG + Intergenic
945937850 2:215921450-215921472 TTTTTTTTGTTTTTTGTTGTTGG + Intergenic
945937852 2:215921482-215921504 TTTTTTTTGTTTTTTGTTGTTGG + Intergenic
945937859 2:215921599-215921621 TTTTTTTTGTTTTTTGTTGTTGG + Intergenic
945937860 2:215921635-215921657 TTTTTTTTGTTTTTTGTTGTTGG + Intergenic
945937864 2:215921667-215921689 TTTTTTTTGTTTTTTGTTGGTGG + Intergenic
945939090 2:215930430-215930452 TTTTTGTTTTTGTTTGAGACAGG + Intergenic
945970840 2:216229740-216229762 TTTTTTTTTTTTTTTGCTGTTGG + Intergenic
946171193 2:217896940-217896962 TTTTTATTGTTATTTACTGTTGG + Intronic
946479488 2:220040480-220040502 TGTTTGGTGTTGTATGTTGCAGG + Intergenic
946791774 2:223308203-223308225 CTATTGATGTGGTTTGCTGCAGG - Intergenic
946984149 2:225252648-225252670 TTTTTGTTTTTGTTTTCGCCAGG - Intergenic
947135460 2:226972922-226972944 TTTTTTTTTTTTTTTGCTACAGG - Intronic
947149370 2:227099075-227099097 TTTTTGTTTTTGTTTTCAGACGG + Intronic
947185168 2:227448537-227448559 TTTTTTTTTTTTTTTCCTGCAGG - Intergenic
947393448 2:229663830-229663852 TTTTTGTTGTTGTTCCAAGCTGG + Intronic
947540050 2:230970597-230970619 CTTTTGTTGTTGTTTGAGACAGG + Intergenic
947562190 2:231165502-231165524 TTTTAGTTGTCATTTGCTCCAGG - Intronic
948285179 2:236778769-236778791 TTGTTGTTGTTGTTTTGTGACGG + Intergenic
948300296 2:236901285-236901307 TTTTTGTTGTTGCTTGGTTTTGG - Intergenic
948408430 2:237740410-237740432 TTTTTGTTTTTGTTTTCTAGAGG - Intronic
948951400 2:241254383-241254405 TTTTTGTTCATGTTTCCTGGGGG + Intronic
1168905024 20:1396244-1396266 TTTTTGTTCTGGTTTGCTAAGGG - Intergenic
1169624053 20:7542255-7542277 TTTTTGTTTTTTTTGGCGGCGGG - Intergenic
1170280731 20:14644852-14644874 TTGTTTTTGTTGTTTGCTTTTGG - Intronic
1170729642 20:18962186-18962208 TTTTTGTTGTTGTTGTTTTCAGG - Intergenic
1171106817 20:22441256-22441278 TTTTTTTTTTTGTTTGTTGATGG - Intergenic
1171345422 20:24462174-24462196 TGTTTGTTGGTGTCTGCTACTGG - Intergenic
1171528026 20:25831011-25831033 TTTTTGTTTTTGTTTTGTGGAGG - Intronic
1171548800 20:26024869-26024891 TTTTTGTTTTTGTTTTGTGGAGG + Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1172427528 20:34865171-34865193 TTATTGTTGTTGTTTGAGACAGG + Intronic
1172521980 20:35573396-35573418 TTTTTGTTGTTGTTTTGAGATGG - Intergenic
1172526977 20:35605806-35605828 TTTTTGTTGTTGTTTTGAGACGG - Intergenic
1172659291 20:36556620-36556642 ATTTTGTTGACTTTTGCTGCAGG - Intergenic
1172855199 20:37996462-37996484 GTTTTGTTTTTCTTTTCTGCAGG - Exonic
1172892651 20:38278027-38278049 TTTTTTTTTTTTTTTGCAGCTGG - Intronic
1173096444 20:40034058-40034080 TTTTTGTTGTTGTTTTTTGGTGG + Intergenic
1173160805 20:40651171-40651193 TTTATTATTTTGTTTGCTGCTGG - Intergenic
1173381890 20:42552325-42552347 TTTATGTTTGTGTTTGCTTCTGG - Intronic
1173700419 20:45065414-45065436 TTTTTGTTTTTGTTTTTTGGTGG + Intronic
1173763938 20:45588920-45588942 TTGTTGTTGTTGTTGGCTTCTGG + Intergenic
1174598354 20:51702990-51703012 TTTTTGTTGTTGTTTTGTTTTGG + Intronic
1174756507 20:53163851-53163873 TGTTTGTTGTTGTTAGTTGCTGG + Intronic
1175329647 20:58154811-58154833 TGTTTGTTGTTGTTTGAGACAGG + Intronic
1175385493 20:58592381-58592403 TTTCTGCTGCTGTTAGCTGCTGG - Intergenic
1175659462 20:60799817-60799839 TTTTTGTTGTTGTTGCAGGCTGG + Intergenic
1175690438 20:61061828-61061850 TTTTTGTTGTTGTTTTCTAGGGG + Intergenic
1175848275 20:62070723-62070745 TTTTTGTTTTTGTTTTTGGCAGG - Intergenic
1176633817 21:9167979-9168001 ATTTAGCTGTTGTTTTCTGCTGG + Intergenic
1176639511 21:9286843-9286865 ATTTAGCTGTTGTTTTCTGCTGG - Intergenic
1176813404 21:13570262-13570284 TTTTTGTAGTTGTTTGTTCAAGG + Intergenic
1177024132 21:15900843-15900865 TTTTTCAGATTGTTTGCTGCTGG - Intergenic
1177038965 21:16082554-16082576 TTTTTGTTGTTGTTTTGTTTTGG + Intergenic
1177052535 21:16254914-16254936 CTTTTTTTGTTGTTTTTTGCTGG - Intergenic
1177238116 21:18419983-18420005 CATTTGTTTTTGTTTGCTACTGG + Intronic
1177253180 21:18623501-18623523 TTTATTTTGTTGATTGTTGCTGG - Intergenic
1177383306 21:20373882-20373904 TTTTTCTTGTTGTTTTTTGTGGG + Intergenic
1177466644 21:21492329-21492351 TTTTTGTTGTTGTTCTCCACAGG - Intronic
1177490922 21:21825161-21825183 TTTTTGTTGTTGTTTTGAGATGG + Intergenic
1177676199 21:24303551-24303573 TTGTTGTTGTTGTTTTCTCATGG + Intergenic
1177871410 21:26577552-26577574 TTTTTCTTCTTGTTTTCTTCTGG - Intergenic
1177877116 21:26646879-26646901 TTTTTTTTTTTTTTTGCTGTAGG - Intergenic
1178000585 21:28158325-28158347 TCTTTTTTGATGTTTGCTGTGGG - Intergenic
1178178331 21:30130204-30130226 TTTGTTTTGTTTTTTTCTGCAGG - Intergenic
1178228519 21:30753413-30753435 TTTTAGTCTTTCTTTGCTGCTGG + Intergenic
1178303763 21:31473521-31473543 ATTTTGTTTTTTTTTGCTGTTGG + Intronic
1178528926 21:33358162-33358184 TTGTTGTTGTTTTCTGCTGCTGG - Exonic
1179028287 21:37698533-37698555 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1179279758 21:39924542-39924564 TTTTTGTTTTTGTTTGAGACAGG + Intronic
1179284059 21:39961347-39961369 CTTTTGTCTTTTTTTGCTGCTGG + Intergenic
1179621401 21:42618518-42618540 TTGTTGTTGTTGTTTTGTGATGG - Intergenic
1179806909 21:43845165-43845187 TTGTTGTTGTTGTTTGGAGATGG + Intergenic
1180017532 21:45097088-45097110 TTCTTTTTCTTGTTTTCTGCTGG + Intronic
1180319824 22:11309711-11309733 TTTTTTTTTTTTTTTGCTGGGGG - Intergenic
1180348525 22:11776218-11776240 ATTTAGCTGTTGTTTTCTGCTGG - Intergenic
1180372812 22:12059672-12059694 ATTTAGCTGTTGTTTTCTGCTGG - Intergenic
1180416264 22:12718489-12718511 ATTTAGCTGTTGTTTTCTGCTGG - Intergenic
1180423556 22:12894311-12894333 ATTTAGCTGTTGTTTTCTGCTGG - Intergenic
1181269380 22:21650168-21650190 TTTTTGTTTTTGTTTTCAGACGG - Intergenic
1181280558 22:21716917-21716939 TTTTTTTTCTCGTTTGCTGTTGG - Intronic
1181616814 22:24060615-24060637 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1181731396 22:24849546-24849568 TTTTTGTTGTTGTTTTGAGACGG - Intronic
1182232645 22:28850225-28850247 TTTTTCTTTTTGTTTGATACAGG + Intergenic
1182258568 22:29055783-29055805 TTTTTGTTGTTGTTTCTGGGGGG + Exonic
1182370622 22:29807901-29807923 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1182498175 22:30725516-30725538 TTTTTGTTTTTGTTTTTTGGTGG - Intronic
1182674361 22:32026373-32026395 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1182677573 22:32051648-32051670 TTGTTGTTGTTGTTTGAAACAGG - Intronic
1182754601 22:32668591-32668613 TTGTTGTTGTTGGAAGCTGCAGG + Intronic
1182792605 22:32965698-32965720 TTGTTGTTGTTGTTTTATGATGG + Intronic
1182799457 22:33019637-33019659 TTCTTGTTGTTGTTTGTTTTTGG + Intronic
1182967853 22:34539298-34539320 TTGTTGTTGTTGTTGGCTTTAGG + Intergenic
1183199881 22:36378717-36378739 TTTTTGTTGTTTTTTGTTGGGGG - Intronic
1184138466 22:42563207-42563229 TTGTTGTTGTTGTTTTCAACAGG + Intronic
1184311254 22:43644659-43644681 TTTCTTTTCTTCTTTGCTGCTGG + Intronic
1184446873 22:44552958-44552980 TTTTTTTTTTTGTTTGTTTCCGG - Intergenic
1184592945 22:45497462-45497484 TTGTTGTTGTTTTTTGTTTCAGG - Intergenic
1184733380 22:46383464-46383486 TTTTTGTTGTTGTTTTTTTGCGG + Intronic
1184748545 22:46471121-46471143 TTTTTGTTGTTGTTTTTTTGAGG - Intronic
1185265172 22:49898170-49898192 TTTTTGTTGTTGTTTTTTGTAGG + Intergenic
1185382488 22:50516428-50516450 TTTGTGTTGTTTCTTGCAGCTGG + Exonic
949349163 3:3107373-3107395 TTGTTGTTGTTGTTTTAAGCAGG - Intronic
949601013 3:5597706-5597728 TTTTTTTTTTTTTTTGCTGTGGG + Intergenic
949647402 3:6111700-6111722 TTTTTGTTGTTGTTTTCATAAGG - Intergenic
949957641 3:9282488-9282510 TTTTTGTTTTTGTTTTCTTTTGG + Intronic
949995880 3:9616812-9616834 TTTTTGTTTTTGTTTGAGGAAGG - Intergenic
950310129 3:11949894-11949916 TGTTTGTTGTTGTTTGCTTAGGG - Intergenic
950597624 3:13998131-13998153 TTTTTCTTGTTTTTTGATGTAGG + Intronic
951067863 3:18288662-18288684 TTTTTGTTGTTGTTTGCTTTAGG + Intronic
951279388 3:20729507-20729529 TTGTTGTTGTTGTTTGATGTAGG + Intergenic
951330831 3:21365742-21365764 GGTTTGTTGGTGTTTGCTGGAGG - Intergenic
951542609 3:23796815-23796837 TATTTTGTGTTGTTTCCTGCTGG - Intergenic
951546412 3:23830424-23830446 TTTTTGTTTTTGTTTGTTTTTGG + Intronic
951809663 3:26685263-26685285 TTATTGTTGTTGTTTTTTGGCGG + Intronic
951904684 3:27693147-27693169 TTTTTCATATTGTTTGCTGTTGG - Intergenic
952117471 3:30200081-30200103 TTGTTGTTGTTGTTGGCTCTTGG - Intergenic
952152757 3:30610330-30610352 TTTTTGTTGTTGTATGCACTAGG + Intronic
952173340 3:30834092-30834114 TTTTTGTTGTTGTTTATTTAAGG + Intronic
952321821 3:32284796-32284818 TTTTTGTTTTTGTTTTTTCCTGG + Intronic
952344101 3:32468105-32468127 TTTTTGTTGCTGTTTTTTGGGGG + Intronic
952352944 3:32558225-32558247 TTGTTGTTGTTGTTTGAGACAGG - Intronic
952379766 3:32795669-32795691 TTTTTGTTGTTGTTTTGAGATGG + Intergenic
952854438 3:37757261-37757283 TTCTTGTTGAAGCTTGCTGCAGG - Intronic
952872624 3:37914824-37914846 TTTTTGTTGTTGTTGTTTTCTGG + Intronic
952882324 3:37992554-37992576 TTTGTCTTGTTGTTTACTGTGGG - Intronic
953034432 3:39199783-39199805 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
953042181 3:39265347-39265369 TTTTTGTTGTTATTTCTTACAGG - Exonic
953120944 3:40041016-40041038 TTTTTTTTTTTTTTTTCTGCTGG - Intronic
953156155 3:40376164-40376186 TTTTTGTTGTTGTTTCGCTCTGG - Intergenic
953276614 3:41507171-41507193 TTTTTTTTTTTTTTTGCTCCTGG - Intronic
953445007 3:42955758-42955780 TTTTTTTTTTTTTTTGCTCCAGG + Intronic
953757709 3:45661753-45661775 TTTTTGTTGTTGTTTGTTTTTGG + Intronic
953896396 3:46806560-46806582 TTGTTGTTGTTGTTTGGGGGGGG + Intronic
953991980 3:47491093-47491115 TTTTTTTTCTTTTTTGTTGCGGG - Intergenic
953993396 3:47501177-47501199 TTTTTGTTTTTGTTTTCTTTTGG - Intronic
954282395 3:49591601-49591623 TTTTTGTTTTTTTTTGAGGCAGG + Intronic
954641452 3:52101083-52101105 TTTTTTTTTTTTTTTGCTGAGGG - Intronic
954647688 3:52141514-52141536 TTTTGGGTGTCCTTTGCTGCTGG - Intronic
954733423 3:52685370-52685392 TTTTTGTTGTGGTTTCTTGACGG - Intronic
955122793 3:56077992-56078014 CTTTTGTTATTATTTGCAGCCGG + Intronic
955200203 3:56845078-56845100 TTCTTGTTATTGTTGGCTGGAGG - Intronic
955292519 3:57705771-57705793 TTTGTGTTGTTGTTTGAGACAGG - Intergenic
955332630 3:58060194-58060216 TTTTTGTTTTTGTTTTTTGGTGG + Intronic
956318669 3:67969576-67969598 TTGTTGTTGTTGTTTGATGGAGG - Intergenic
956364508 3:68485377-68485399 TTTTTGTTGTACTTTGCCACTGG + Intronic
956365344 3:68495991-68496013 TTTTTTTTTTTTTTTGCTTCAGG - Intronic
956687163 3:71840719-71840741 TTGTTGTTGTTGTTTGCTTTTGG + Intergenic
956698847 3:71941305-71941327 TTTTTGTTGTTTTTTGGGACAGG - Intergenic
956856147 3:73276732-73276754 TTTATGTTGTTGTTGGGAGCTGG - Intergenic
956982590 3:74656231-74656253 TTATTGTTGTTGTCTCCTGCTGG + Intergenic
957100690 3:75823988-75824010 ATTTAGCTGTTGTTTTCTGCTGG + Intergenic
957261130 3:77902660-77902682 TTTTTTTTTTTTTTTGCTGGGGG - Intergenic
957423881 3:80009920-80009942 TTTTTTTTTTTTTTTGCTACAGG - Intergenic
957655672 3:83070839-83070861 TGTTTGTTGTTGTTTCTTGTGGG - Intergenic
957848332 3:85770311-85770333 TTTTTGTTGTTGTTTGAGATAGG + Intronic
957933263 3:86910589-86910611 TTATTTTTGTTGTGTGCTGCTGG + Intergenic
957966412 3:87326899-87326921 TTTTTCTTCTTTTTTGATGCAGG - Intergenic
958036908 3:88181654-88181676 TTTTTGTTGTTGTTGGTTTTGGG - Intergenic
958049543 3:88327733-88327755 TTTTTTTTTTTTTTTGCTACAGG + Intergenic
958459433 3:94375492-94375514 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
958900200 3:99876560-99876582 TTTTTATTTTTGGTTGCTGGGGG + Intronic
959042236 3:101435634-101435656 TTTTTCGTGTTTTTTGCTGTTGG - Intronic
959211448 3:103388294-103388316 TTTTTTTTCCTGTTTGCTTCTGG - Intergenic
959338329 3:105095227-105095249 TTTTTATTGTTGGTTACTTCAGG + Intergenic
959393137 3:105801741-105801763 TTGTTGTTGTTGTTAGCAGTAGG - Intronic
959448005 3:106464269-106464291 TTTTTCTTCTTGTTTGATGTAGG + Intergenic
959516050 3:107268429-107268451 TTGTTGTTGTTGTTTTCTCCTGG + Intergenic
959664330 3:108904548-108904570 TTTTTGTTTTTGTTTGAGACAGG + Intergenic
959865491 3:111264867-111264889 TTTTTGTTGTTGTTATATTCTGG - Intronic
959955046 3:112227265-112227287 TTTGTTGTGTTGTTTGCTGTTGG - Intronic
960332233 3:116375259-116375281 TTTTGGCTGCTGTTTGTTGCTGG + Intronic
960358592 3:116682914-116682936 TTTTTGCTGTTGTTTTGGGCTGG - Intronic
961046405 3:123711685-123711707 TTTTTGTTTTTGTTTTTGGCAGG + Intronic
961151626 3:124643178-124643200 TTTTTGTTTTTGTTTTGTGGAGG + Intronic
961184777 3:124905202-124905224 TTTTTGTTGTTGTTAGAGACAGG - Intergenic
961573714 3:127818339-127818361 TTGTTGTTGTTGTTTTCAGAAGG + Intronic
961667672 3:128503863-128503885 TTTTTGTTTTTGTTTGAGACAGG - Intergenic
961843482 3:129738822-129738844 TTTTTGTTTTTGTTTGAGACAGG + Intronic
962215897 3:133521306-133521328 TTTTTGTTGTTGTTTTTTTTGGG - Intergenic
962491556 3:135898351-135898373 TTTTTGTTTTTGTTTTCAGATGG + Intergenic
962705504 3:138039411-138039433 TTTTTTTTTTTTTTTGCAGCTGG - Intergenic
962707448 3:138058778-138058800 TTTTTGTTGTAGTGTGATGGTGG + Intergenic
962734555 3:138313801-138313823 TATTTGTTGTTCTTTGCTTGGGG - Intronic
962771675 3:138616378-138616400 TTGTTGTTGTTTTTTGCTTTTGG + Intronic
962793649 3:138833004-138833026 TTATTGTTGTTTTTTGAGGCAGG - Intronic
962929640 3:140024438-140024460 TTTTTGTTTTTGTTTTCTCAAGG + Intronic
963023244 3:140893028-140893050 TGTTTGTTTTTGTTTGTTGGTGG + Intergenic
963194575 3:142512112-142512134 TTGTTGTTGTTGTTTGGAGATGG - Intronic
963224425 3:142847542-142847564 TATTTGTTGTTGTTTGAGACAGG + Intronic
963383378 3:144559376-144559398 TTTTTTTTTTTTTTTGCTGTGGG - Intergenic
963674208 3:148287966-148287988 TTGTTGTTGTTGTTTTCTAGTGG + Intergenic
964148247 3:153492320-153492342 TTTTTGTTGTTGTTACCTGTGGG - Intronic
964502158 3:157359913-157359935 ACTTTGTTGTTATTTCCTGCTGG + Intronic
964755915 3:160090640-160090662 TTTTTGTTGTTGTTTTTAGGCGG + Intergenic
964803070 3:160575264-160575286 TTTTTTTTTTTTTTTGATGCAGG - Intergenic
965249114 3:166319219-166319241 TTGTTGTTGTTGTTTGGAGACGG + Intergenic
965503312 3:169481937-169481959 TTTTTGTTATTGTTTGGTGGTGG + Intronic
965535146 3:169815427-169815449 TTTTTCTGATTGTTTGCTGTTGG + Intergenic
965757145 3:172039106-172039128 TTGTTGTTGTTGTTTGTTTTGGG - Intergenic
965780413 3:172279913-172279935 TTGTTGTTGTTGTTTGTTTGGGG + Intronic
965847895 3:172986245-172986267 TTACTGTTGTTGTTTGTTGTTGG + Intronic
966116897 3:176474806-176474828 TTGTTGTTGTTGTTTTTGGCAGG + Intergenic
966156974 3:176927104-176927126 TTTTTTTTGTTTTTGGTTGCTGG - Intergenic
966196197 3:177316219-177316241 TTTTTTTTTTTTTTTGCTGGGGG + Intergenic
966418542 3:179714874-179714896 TTTTTTTTTTTGTTTGAGGCAGG + Intronic
966618773 3:181941324-181941346 TTTTTTTTCTTTTTTTCTGCTGG - Intergenic
966709677 3:182957930-182957952 TTTTTTTTTTTTTTTGATGCAGG - Intronic
966989842 3:185218240-185218262 TTGTTGTTGTTGTTTATTTCAGG - Exonic
967202717 3:187087226-187087248 TTGTTGTTGTTCTTTGATACAGG - Intergenic
967264998 3:187682738-187682760 TTTTTGTTTTTGTTTCTGGCAGG - Intergenic
967504709 3:190240208-190240230 TTTTTGTTTTTGTTTTTTGTTGG - Intergenic
967523927 3:190470538-190470560 TTTTTGTTGTTTTTTTTTGGGGG - Intergenic
967568748 3:191002657-191002679 TTTTTGTTTTTGTTTGAGACAGG + Intergenic
967650481 3:191979466-191979488 TTGTGGTTGCTGTTTGCTGCTGG - Intergenic
967714767 3:192749885-192749907 TTGTTGTTGTTTTTTGGTGTGGG - Intronic
967786963 3:193507665-193507687 TTTTTGTAGCTGTTTTCTGAGGG + Intronic
967839249 3:193991506-193991528 TTGTTGTTGTTGTTTAATCCAGG + Intergenic
968122789 3:196137663-196137685 TTTTTGTTTTTGTTTGAGACAGG + Intergenic
968238186 3:197050404-197050426 TATTTGTTGTTGTTTGTTGTTGG - Intronic
1202747383 3_GL000221v1_random:118184-118206 ATTTAGCTGTTGTTTTCTGCTGG + Intergenic
968665235 4:1817553-1817575 TTTTTGTTGTTGTTTGAGATAGG - Intronic
968783696 4:2602663-2602685 TTTTTGTTTTTGTTTTGTGACGG + Intronic
969065543 4:4477442-4477464 GTTTTGTTGTTGTTTTTTGGTGG - Intronic
969203081 4:5621546-5621568 TTTTGGTGGTTGTTTGGGGCTGG - Intronic
970269428 4:14328276-14328298 TTGTTGTTGTTGTTTTCTTCAGG - Intergenic
970400348 4:15711458-15711480 TTTTTGTTGTTGTTGTTTGTGGG + Intronic
970515786 4:16828889-16828911 TCTTTGGTATTCTTTGCTGCAGG - Intronic
970868982 4:20792388-20792410 TTGTTGTTGTTGTTTGCTTTGGG - Intronic
970937234 4:21587539-21587561 TTGTTGTTGTTGTTGTTTGCAGG - Intronic
971658204 4:29377649-29377671 TTTTTTTTATTGTTTTCTGGAGG + Intergenic
971806774 4:31368489-31368511 CTTTTGTTGTTGTTGGATGTTGG + Intergenic
971855976 4:32044100-32044122 TTTTTGTTTTTGTTTGGAGACGG - Intergenic
971876150 4:32310847-32310869 TTTTTGTTGTTTTTTCCCCCAGG + Intergenic
971926193 4:33012426-33012448 TTTTTGTTGTTGTTGTTTACTGG - Intergenic
971992651 4:33920000-33920022 TTTTTTTTGTTGTTCCCTTCAGG + Intergenic
972217004 4:36908862-36908884 TTTTTTTTTTTTTTTGCTGTAGG - Intergenic
972555623 4:40177988-40178010 TTTTTGTTTTTGTTTTTTTCTGG - Intergenic
972584565 4:40425598-40425620 TTTTTGTTGTTGTTTTTTTAAGG - Exonic
972706046 4:41544020-41544042 TTTGTCATGTTATTTGCTGCAGG - Intronic
972769473 4:42183871-42183893 TTTTTGTTGTTGTTTGGAGGAGG - Intergenic
972773218 4:42217873-42217895 TTTTTGTTGTTGTTTTGAGACGG + Intergenic
972912358 4:43833129-43833151 TTTTTGTTTTTGTTTTCTTGTGG - Intergenic
973682598 4:53336254-53336276 TTTCTGTTTTTGTTTTCTGTGGG - Intronic
973694908 4:53481286-53481308 TTTTTGTTTGTGTTTGCCGAAGG - Intronic
973706275 4:53583924-53583946 TTGTTGTTGTTGTTTGCAGGGGG - Intronic
973706278 4:53583927-53583949 TTGTTGTTGTTGTTGTTTGCAGG - Intronic
973794849 4:54414723-54414745 TTTTATTTGTTTTTTTCTGCTGG + Intergenic
973998536 4:56485393-56485415 TTTTTTTTTTTTTTTGCTGTGGG - Intronic
974078323 4:57188148-57188170 TTTTTTTTTTTGTTTGTTACAGG + Intergenic
974375268 4:61068229-61068251 TTTTTTTTTTTTTTTGCTGTTGG - Intergenic
974486522 4:62512810-62512832 TTTATGTTGTTGTTTGTTTTGGG - Intergenic
974689728 4:65281317-65281339 TTTTTGTTTTTGTTTGTTTTTGG - Intergenic
974727531 4:65814766-65814788 TTGTTGTTGTTTTTTCCTGGTGG - Intergenic
974727532 4:65814769-65814791 TTGTTGTTGTTGTTTTTTCCTGG - Intergenic
974802608 4:66837914-66837936 TTATTGTTGTTGTTTTTTGTGGG + Intergenic
974992332 4:69109032-69109054 TTTTTGTTGTTTTTTTTTTCTGG + Intronic
975053622 4:69898851-69898873 TTGTTGTTGTTGTTTTCAGTAGG + Intergenic
975141103 4:70919501-70919523 TTTTTGTTGTTGTTTTGAGATGG + Intronic
975234235 4:71972736-71972758 GTTTTGTTGTTGTTTGAGACTGG + Intergenic
975365349 4:73522442-73522464 TTTTTGTTGTTGTTTTTTTTTGG + Intergenic
975375737 4:73642941-73642963 TTTTTCTTGTTTTTTGCTGTAGG + Intergenic
975463819 4:74686921-74686943 TTTTTGTTGTTGTTTTCTTTTGG + Intergenic
975488379 4:74960591-74960613 TTTTTGTTGTTGTTGAATACTGG - Intronic
975546396 4:75564484-75564506 TTTTTGTTGCTTTTTTCTGAAGG - Exonic
975557418 4:75678156-75678178 TTGTTGTTGTTGTTTGAGACAGG + Intronic
975569357 4:75797553-75797575 TTTTTTTTTTTTTTTGCTTCTGG - Intronic
975606609 4:76161430-76161452 ATTTTGTTGTTGTTGGGTGCTGG - Exonic
975928538 4:79490130-79490152 TTTTTTTTTTTTTTTTCTGCTGG + Intergenic
976003959 4:80406049-80406071 TTTTTGTTGTTGTTTTGTTTTGG - Intronic
976210823 4:82668041-82668063 TTTTTGTTGTTGTTTTTGGTGGG - Intronic
976378160 4:84368202-84368224 TTTTTGTTTTTGTTTGTTTGAGG + Intergenic
976417357 4:84793182-84793204 TTTTTGTTTTTGTTTGAAACTGG + Intronic
976553436 4:86422928-86422950 TCTTTGTTGTTATTTGCTAATGG + Intronic
976611292 4:87033279-87033301 TTCCTGTTGCTTTTTGCTGCTGG + Intronic
976690141 4:87859981-87860003 TTTTTATTTTTTTTTTCTGCTGG - Intergenic
976742702 4:88373379-88373401 TTTTTTATATTGTTTGCTGTTGG - Intergenic
977123011 4:93128020-93128042 TTTTTTTTTTTTTTTGTTGCGGG - Intronic
977303010 4:95289391-95289413 TTCATGTTGTTATCTGCTGCTGG + Intronic
977308606 4:95356186-95356208 TTTTTTTTTTTTTTTGCTACAGG - Intronic
977357218 4:95962098-95962120 TCATAGTTGTTCTTTGCTGCAGG - Intergenic
977364431 4:96049375-96049397 TTTTTGTTTTTTTTTGCTATTGG - Intergenic
977439926 4:97052074-97052096 TTGTTGGTTTTGTTTTCTGCTGG + Intergenic
977458405 4:97293414-97293436 TTTTTCTTGTTTTTTGATGTAGG + Intronic
977544732 4:98364045-98364067 TTTTTATTTTGTTTTGCTGCAGG + Intronic
977585534 4:98771795-98771817 TTCTTGTTGTTGTTTGAGACAGG - Intergenic
977596306 4:98885451-98885473 TTGTTGTTGTTGTTTGAGACAGG + Intronic
977625109 4:99181457-99181479 TTTTTGTTGTTTTTTGAGACAGG + Intergenic
977702903 4:100040503-100040525 TCCTTGTTGTTGCCTGCTGCTGG + Intergenic
977986060 4:103385061-103385083 TTTTTCAGGTTGTTTGCTGTTGG - Intergenic
977995022 4:103491099-103491121 TTGTTGTTGTTACTTTCTGCAGG - Intergenic
978191669 4:105920917-105920939 TTTTTGTTGTTGTTTGCTTTGGG - Intronic
978195962 4:105972425-105972447 TTGTTGTAGTTGTTTTCTCCAGG - Intronic
978439921 4:108722646-108722668 TTTTTGTTGTTGTTGTCTTTGGG + Intergenic
978535524 4:109757783-109757805 TTTTTGTTTTTGTTTTCTTCAGG - Exonic
978658897 4:111099878-111099900 GGTCTGTTGTTGTTTGCTGAAGG + Intergenic
978715528 4:111838388-111838410 TTGTTGTTGTTGTATGAAGCTGG - Intergenic
978771413 4:112460127-112460149 TTTTTGTTTTAGTTTGCTGAGGG - Intergenic
978794355 4:112694354-112694376 TTTTTGTTTTTGTTTGAGACAGG + Intergenic
978826865 4:113035172-113035194 TTTTTTTTGGTGTGTGCTGCAGG + Intronic
978855445 4:113389205-113389227 TTTTTGTTGTTGTTCTATGTAGG + Intergenic
979105299 4:116678747-116678769 TTTTTGTTGTTGTTTGTGTGTGG - Intergenic
979280511 4:118862125-118862147 TTTTTCATTTTGTTTGCTGTTGG + Intronic
979480417 4:121209817-121209839 TATTTATTGAAGTTTGCTGCAGG + Intronic
979613740 4:122718415-122718437 TTTTTATACTTGTTTGCAGCAGG - Intergenic
979701842 4:123677325-123677347 TTTTTTTTTTTTTTTGCTACTGG - Intergenic
979873153 4:125851693-125851715 TTGTTGTTGTTGTTTTCCGATGG + Intergenic
979898155 4:126187151-126187173 TTTTTGTTGTTGTTGTTTCCTGG + Intergenic
979898156 4:126187154-126187176 TTGTTGTTGTTGTTTCCTGGTGG + Intergenic
979949186 4:126871110-126871132 TTTTTGCTGTAGGTAGCTGCAGG - Intergenic
979962300 4:127035843-127035865 TTTTTGTTGTTGTTTCAAGATGG + Intergenic
980074079 4:128275729-128275751 TTTTTGTTGTTTTTTGAGACAGG + Intronic
980101807 4:128549064-128549086 CTTTTTTTTTTGATTGCTGCAGG + Intergenic
980116520 4:128684800-128684822 ATTTTGTTGTTGTTTGAATCAGG + Intergenic
980410781 4:132415094-132415116 TTATTGTTGTTGTTTTCTGGTGG - Intergenic
980462839 4:133139017-133139039 TTTTTGTTTTTGTTTGCCTTGGG + Intergenic
980595908 4:134953589-134953611 TCTTGGTTGTTGTTGGCTGTTGG + Intergenic
980620185 4:135291308-135291330 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
980874291 4:138645479-138645501 TTTTTGTTTTTGTTTTTGGCAGG + Intergenic
981118693 4:141022220-141022242 TTTTTATTCTTTTTTCCTGCAGG + Intronic
981259298 4:142700675-142700697 TTTTTTTTATTTTTTGCAGCAGG + Intronic
981451454 4:144902659-144902681 TTTTTTTTTTTTTTTGCTGCTGG - Intergenic
981455737 4:144951663-144951685 TGTTTGTTGTTTTTTGTTGGAGG - Intergenic
981530472 4:145748495-145748517 TTTTTCTTCTTTTTTGATGCAGG + Intronic
981830250 4:148991533-148991555 TTTTTTTTTTTTTTTGCTGGGGG + Intergenic
982181919 4:152756306-152756328 TTTTTGTTGTTATTTTTTCCCGG - Intronic
982191370 4:152859066-152859088 TTTTTGTTTTTGTTTGAGGCAGG + Intronic
982249679 4:153392078-153392100 TTTTTGTTGTTTTTTTGTGGGGG + Intronic
982340236 4:154290143-154290165 TTTTTCATATTGTTTGCTGCTGG - Intronic
982669056 4:158298509-158298531 TTGTTGTTGTTTTTTGCATCAGG - Intergenic
982932918 4:161430733-161430755 TTTTTGTTTTTGTTTTCTGACGG - Intronic
983138541 4:164117892-164117914 TTTTTGTTGTTGTTTTGAGATGG - Intronic
983177707 4:164611019-164611041 TTTTTGTTTTTGTTTGAGACAGG - Intergenic
983307659 4:166013543-166013565 TTTTTGTTGTTGTTTGTTTTTGG + Intronic
983391148 4:167131615-167131637 TTGTTGTTGTTGTTTGGTTTTGG - Intronic
983421935 4:167529569-167529591 TTTTTGTTGTTAATTACGGCTGG - Intergenic
983528024 4:168780684-168780706 TTGTTGTTGTTGTTTGTTTTTGG + Intronic
983635167 4:169890717-169890739 TTGTTGTTGTTGTTTACTTGGGG - Intergenic
983744793 4:171184446-171184468 TTTTTTTTTTTGTCTGCTTCTGG + Intergenic
983825891 4:172259635-172259657 TTGTTTTTGTTGTTTGCTGTTGG + Intronic
984144022 4:176039240-176039262 TGTTTGTTGTGTTTTGTTGCTGG + Intergenic
984191540 4:176612279-176612301 TTTTTGTTTTTGTTTGGGGGGGG + Intergenic
984351385 4:178599562-178599584 TTTCTTTTGTTGTTTACTGTGGG + Intergenic
984445336 4:179829571-179829593 TTTTTTTTTTTTTTTGCTTCAGG + Intergenic
984609091 4:181817945-181817967 TGTTTGTAGTGGTTTGTTGCTGG + Intergenic
984764148 4:183386736-183386758 TTTTTGTTTTTGTTTTCAGACGG + Intergenic
984895802 4:184538394-184538416 TTTTTGTTGTTGTTTTTTTTGGG - Intergenic
984963342 4:185119556-185119578 TTTTTGTTGTTTTTTGAAACAGG + Intergenic
985089663 4:186350249-186350271 TTTTTGTTTTTGTTTTGTGATGG - Intergenic
1202754399 4_GL000008v2_random:45234-45256 ATTTAGCTGTTGTTTTCTGCTGG - Intergenic
985566027 5:617858-617880 TTTTTGTTTTTGTTTTCAGATGG - Intronic
985917471 5:2933807-2933829 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
986141975 5:5039599-5039621 TTTTTGTTGTTGTTCACTGATGG - Intergenic
986386942 5:7243912-7243934 TCCTTATTGTTGTTTGCTGCAGG - Intergenic
986866819 5:11999136-11999158 TTTTGGTTTTTGTTTGGTCCTGG + Intergenic
986894498 5:12348687-12348709 TTTTTGTTGTTGTTAGAGACAGG + Intergenic
987448903 5:18056778-18056800 TTTTTTTTTTTTTTTGCTCCAGG + Intergenic
987592121 5:19943182-19943204 TTTTTGTTGTTGTTGTTTGGGGG + Intronic
987689681 5:21251021-21251043 TTTTTGTATTTTTTTGTTGCGGG + Intergenic
987899363 5:23991280-23991302 TTGCTGTTGTTGTTTTCTTCTGG + Intronic
987924629 5:24324370-24324392 TTTTTGTTGTTGTTCTCACCTGG + Intergenic
988048492 5:25991615-25991637 TTTTTGTTTTTGTTTTGTGACGG + Intergenic
988125181 5:27023551-27023573 TTTATTTGTTTGTTTGCTGCAGG + Intronic
988294473 5:29337317-29337339 TTGTTGCTGTTGTTTCCTTCTGG - Intergenic
988324435 5:29743980-29744002 TTCTTGTGTTTGTTTGCTTCAGG - Intergenic
988501805 5:31789912-31789934 TTTTTTTTGTTGTTTGGAGAAGG - Intronic
988558929 5:32262600-32262622 TTTTTGTTTTTGTTTGAGACAGG - Intronic
988724663 5:33914446-33914468 TTTTTGTTGGTGATTTTTGCTGG - Intergenic
988925325 5:35984251-35984273 TTTTTCAGGTTGTTTGCTGTTGG - Intronic
989584573 5:43064607-43064629 TTGTTGTTGTTGTTTGGAGACGG - Intergenic
989671066 5:43917676-43917698 GTTTTGTTGGAGTTTGCTGGAGG + Intergenic
989779837 5:45250494-45250516 TTTTTGTTTTTGTTTTCAGCCGG - Intergenic
990076105 5:51847682-51847704 TTTTTGTTGTTGTTTGTGTTTGG - Intergenic
990433012 5:55756010-55756032 TTTTTGTTGAGGTTTTCTCCAGG + Intronic
990575653 5:57121105-57121127 TGTTTGTTGTTTTTTTCTCCTGG - Intergenic
990590899 5:57263210-57263232 TTGTTGTTGTTGTTTTTTGGGGG - Intronic
990795129 5:59531438-59531460 TTTCTGTAGTTTTCTGCTGCTGG + Intronic
990879344 5:60521928-60521950 TTTTTTTTTTTTTTTCCTGCAGG - Intronic
990942655 5:61218830-61218852 TTTGTGTTGTTTGTTTCTGCTGG + Intergenic
991381280 5:66030566-66030588 TTTTTTTTTTTTTTTGCGGCGGG + Intronic
991384769 5:66073881-66073903 TTTTTGTTGTTGTTTAGAGATGG + Intronic
991454693 5:66790004-66790026 TTTTTTTTTTTTTTTGCTGGTGG + Intronic
992057791 5:73009540-73009562 TTTTTGTTGTTTTTTGAGACAGG + Intronic
992278085 5:75141794-75141816 TTGTTGTTGTTGTTTGAGACAGG - Intronic
992426947 5:76667626-76667648 TCTTTGTTGTTTTTTGCTCATGG + Intronic
992525418 5:77605407-77605429 ATTTTGTTGTTGTTTCCCTCTGG + Intronic
992878679 5:81083272-81083294 TTTTTTTTTTTTTTTGCTGGAGG + Intronic
993233143 5:85265856-85265878 TTTTTTTTTTTTTTTGCTGTGGG + Intergenic
993289403 5:86045598-86045620 CTTTTGTTGTTGTTTTCTGATGG - Intergenic
993505592 5:88705146-88705168 TTTTTGTTGTTGTTTGTTTTTGG - Intergenic
993623619 5:90196424-90196446 TTTTTCTTCTTTTTTGATGCAGG - Intergenic
993720574 5:91317795-91317817 TTGTTGTTGTTGTTTGAAGCAGG + Intergenic
993891448 5:93479518-93479540 TTGTTGTTGTTGTTTGATGAAGG - Intergenic
994646937 5:102481991-102482013 TTTTATATGTTGTTTCCTGCTGG - Intronic
994689980 5:103005938-103005960 TTGTTGTTGTTGTTTGAGACAGG + Intronic
994748980 5:103715321-103715343 TTTTTTTTTTTTTTTGCTGGGGG + Intergenic
994890462 5:105627346-105627368 ATTTTCTAGTTGTTTGCTTCTGG + Intergenic
995087029 5:108123106-108123128 TTTTTCTTGTTGTGTGATGGTGG + Intronic
995642197 5:114269495-114269517 TTTTTTTTTTTTTTTGGTGCTGG + Intergenic
995642895 5:114278113-114278135 TGTCTGTTGGAGTTTGCTGCAGG + Intergenic
995918422 5:117279553-117279575 GTTTTGATGTTTTTTGCTGGTGG + Intergenic
996062529 5:119047924-119047946 TTGTTGTTGTTGTTCGAGGCAGG - Intronic
996599712 5:125248079-125248101 TTTTTGTTCTTGTTGCCTGTGGG + Intergenic
996750275 5:126881221-126881243 CTCTTTGTGTTGTTTGCTGCTGG + Intronic
996801649 5:127410167-127410189 GTTTTGTTTTTGTTTTCTACAGG + Intronic
996829429 5:127723247-127723269 TTTTTCAGGTTGTTTGCTGTTGG + Intergenic
997069517 5:130604034-130604056 TTCTTGTTGGTGTTTTCTTCAGG - Intergenic
997388919 5:133497453-133497475 TTTTTGCTGTTGTTTGCCTGAGG + Intronic
997598960 5:135126586-135126608 GTTTTGTTTTTGTTTCATGCTGG + Intronic
998307175 5:141090273-141090295 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
998685954 5:144525291-144525313 TTTTTTTTTTTTTTTGCAGCTGG + Intergenic
999288462 5:150408047-150408069 GTTTTGTTTTTTTTTTCTGCTGG + Intronic
999504809 5:152183713-152183735 TTATTTTTTTTTTTTGCTGCTGG + Intergenic
999513415 5:152276622-152276644 TTTTTTTTTTTTTTTGCTCCTGG + Intergenic
999652651 5:153782866-153782888 TTGTTGTTGCTGTTTTCAGCAGG + Intronic
999760932 5:154700627-154700649 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
999785204 5:154884200-154884222 GTTTTGTTGTTGTTTGTTTGAGG - Intergenic
999786560 5:154895856-154895878 TTTTTTTAGTTGTTTGAAGCTGG - Intronic
999971219 5:156865522-156865544 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
999999560 5:157124752-157124774 TTTTTGTTGTTGTTTTTTGGGGG + Intronic
1000000090 5:157129687-157129709 TTTAAGTTATTGTTTGTTGCTGG + Intronic
1000100876 5:158015062-158015084 TTTTTGTTATTGTTTTATGGGGG - Intergenic
1000205747 5:159056918-159056940 TTTTTGTTTTTGTTTGCCAGAGG - Intronic
1000649473 5:163798551-163798573 TTTTTGTTGTTTTTTGCTTTTGG + Intergenic
1000730006 5:164822666-164822688 TTTTTTTTTTTTTTTGTTGCGGG - Intergenic
1000824284 5:166024930-166024952 GTTTTGTTATTGTTTGGTGATGG - Intergenic
1000879083 5:166676540-166676562 TTTTTGTTGTTGCTTTCTCTGGG + Intergenic
1000925084 5:167184450-167184472 TTTTTGTTTTTGTTTTTTGTTGG + Intergenic
1001183345 5:169541890-169541912 TTTTTTTTTTTTTTTGCAGCAGG - Intergenic
1001377475 5:171275778-171275800 TTTTTGTTGTTGTTTTTGGTGGG + Intronic
1001403004 5:171457250-171457272 TTTTTGTTGGAGTTTGGGGCAGG - Exonic
1001618759 5:173064388-173064410 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1002029720 5:176418863-176418885 TTTTTGTTGTTGTTGTTTGTTGG - Intergenic
1002112354 5:176926629-176926651 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1002492801 5:179591182-179591204 TTTTTGTTTTTTTTTGGTGGGGG + Intronic
1002503343 5:179661751-179661773 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1002654993 5:180738984-180739006 TTTTTGTTTTTGTTTTTTGGTGG - Intergenic
1002722171 5:181268418-181268440 TTTTTGTTTTTGTTTGAGACAGG - Intergenic
1003077639 6:2997380-2997402 TTTTTGTTTTTGTTTGAGACAGG + Intronic
1003185195 6:3824336-3824358 TTGTTGTTGTTTTTTTCTGGAGG - Intergenic
1003639268 6:7862994-7863016 TTGTTGTTGTTGTTTGTTTTTGG + Intronic
1004076018 6:12344864-12344886 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1004140606 6:13014031-13014053 TTGTTGTTGTTGTTGGGGGCGGG - Intronic
1004170265 6:13290514-13290536 TTTTTGGTGGTTTCTGCTGCTGG - Intronic
1004345033 6:14841498-14841520 TTTTTGTTTTTGTTTTCTTGAGG + Intergenic
1004577533 6:16911854-16911876 TTGTTGTTGTTGTTTGTTTTGGG - Intergenic
1004679016 6:17874272-17874294 TTTTTGTTTTTGTTTTTTGGTGG + Intronic
1004703768 6:18103857-18103879 TTTCTGTAGTTGTTTTCTGTAGG - Intergenic
1004770712 6:18777946-18777968 TTTTTGTTTTTGTTTGAGACAGG - Intergenic
1004990308 6:21130053-21130075 TTTTTGTTGTTGTTGGTTTTGGG + Intronic
1005229329 6:23682087-23682109 ATTTTGTTGTGGTTTGGTGGTGG + Intergenic
1005252673 6:23965321-23965343 TTTTTGTTGTTGTTTGTTTTTGG + Intergenic
1005460672 6:26066771-26066793 TTGTTGTTGTTGTTTGGAGACGG - Intergenic
1005634898 6:27744092-27744114 TTTTTGTTTTTGTTTGTTTTTGG + Intergenic
1005754862 6:28917133-28917155 TTATTGTTGTTGTTTGAGACAGG - Intronic
1005787545 6:29261782-29261804 TATTTGTAGCTATTTGCTGCAGG - Intergenic
1005820201 6:29592346-29592368 TTTTTGTTTTTGTTTGAGACAGG + Intronic
1005936959 6:30530461-30530483 GTTTTGTTGTTTTTTGGTTCTGG + Intergenic
1006467990 6:34207455-34207477 TTGTTGTTGTTGTTTGAAACAGG + Intergenic
1006551951 6:34831644-34831666 TTGTTGTTGTTGTTTGATGAAGG + Intronic
1006631624 6:35434380-35434402 TTTTTGTTTTTGTTTGAGACAGG + Intergenic
1006736987 6:36280793-36280815 TTGTTGTTGTTGTTTGAGGCAGG + Intronic
1006848554 6:37080627-37080649 TTGTTGTTGTTGTTTTCAGACGG - Intergenic
1007016376 6:38471549-38471571 TTGTTGTTGTTGTTTTAAGCAGG + Intronic
1007036247 6:38676922-38676944 TTTTTGTTGTAGTTATCTTCTGG - Exonic
1007356247 6:41319810-41319832 TTTTTGTTTTTGTTTTTTGTGGG + Intergenic
1007490410 6:42216805-42216827 TTTTTGTTTTTGTTTGGAGACGG - Intronic
1007567842 6:42866399-42866421 TGTATGTTTTTGTTTGTTGCTGG + Exonic
1007613997 6:43169996-43170018 TTTTTTTTTTTTTTTTCTGCTGG + Intergenic
1008053529 6:46923620-46923642 TTTTGGTTGTTGGGTGCAGCAGG + Intronic
1008193015 6:48482914-48482936 TTTTTGTTTTTGTTTGGAGATGG - Intergenic
1008221050 6:48853780-48853802 TTGTTGTTGTTGTTTGCTTTTGG - Intergenic
1008227523 6:48938674-48938696 TTTTTGTTTTTGTTTCTGGCTGG - Intergenic
1008349526 6:50473472-50473494 TTTTTGTTGTTGTTTTTAGATGG - Intergenic
1008464032 6:51810360-51810382 TTTTTGTTGTTGTTTTCTTTTGG - Intronic
1008807797 6:55453159-55453181 TTGTTGTTGTTGTTTGTTGTTGG + Intronic
1008810529 6:55492365-55492387 TTTTTGTTGTTGTTGGAAGAGGG + Intronic
1009293730 6:61916975-61916997 TTTTTTTTTTTTTTTGCTGGTGG + Intronic
1009371534 6:62909388-62909410 TTTTTCTTCTTTTTTGATGCAGG - Intergenic
1009669309 6:66726330-66726352 TTTGTTTTGTTGTTTGGTGGGGG - Intergenic
1009692347 6:67052081-67052103 TTTTGTTTGTTGTTTGCTGTTGG + Intergenic
1010044439 6:71424810-71424832 TTGTTGTTGTTGTTTGAGTCAGG + Intergenic
1010204251 6:73308799-73308821 TTTTTGCTGTTGTTTTTTGTTGG + Intronic
1010237761 6:73589513-73589535 TTTTTGTTTTTGTTTTTTGACGG + Intergenic
1010550010 6:77210355-77210377 CTTTTTGGGTTGTTTGCTGCTGG + Intergenic
1011059838 6:83252297-83252319 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1011269113 6:85558469-85558491 TTTTTGTTGTTTTTTGAGACAGG + Intronic
1011572097 6:88748751-88748773 TTTTTTTTCTTCTTTGCTTCCGG - Intronic
1011648207 6:89480778-89480800 TTTTTTTTGTTTTTTTTTGCTGG + Intronic
1011844693 6:91549027-91549049 TTTTTGTTGAAGTTTGCAACTGG + Intergenic
1012033885 6:94107342-94107364 TTTTTGTGTTTGTTTTCTGGAGG - Intergenic
1012144934 6:95669645-95669667 TTTTTGTTGTTGTTGTTTGTAGG + Intergenic
1012218683 6:96621179-96621201 TTTTTGTTTTTGTGTGTAGCAGG - Intergenic
1012249874 6:96968351-96968373 TGTTTTTTGTTTTTTGCTGTAGG - Intronic
1012461997 6:99474202-99474224 TTTTTGTTGTTTTTTGAGGTAGG + Intronic
1012548122 6:100443006-100443028 TTTTTGTTGTTGTTTGCATATGG - Intronic
1012687044 6:102264201-102264223 TTGTTGTTGTTGTTTTCTTTTGG - Intergenic
1012732682 6:102901845-102901867 TTTTTCCTGTTGTTTTCTCCAGG + Intergenic
1012742301 6:103033486-103033508 TTTTTTTTTTTTTTTGCTTCAGG - Intergenic
1012805854 6:103891747-103891769 GTTTTGTTTTTGTTTGCTGGTGG + Intergenic
1012812994 6:103984583-103984605 TTGTTGTTGTTTTTTAATGCTGG - Intergenic
1012884692 6:104832397-104832419 TTGTTGTTGTTGTTTGATACAGG + Intronic
1012977409 6:105794852-105794874 TTTTTTTTTTTTTTTGGTGCTGG + Intergenic
1013114872 6:107095164-107095186 TTATTGTTGTTGTTTGAGACAGG - Intronic
1013191602 6:107808431-107808453 TTTTTGTTTTTGTTTTTTCCTGG + Intronic
1013200020 6:107885359-107885381 TTTTATTTGGTGTTTGTTGCTGG - Intronic
1013208140 6:107963029-107963051 TTTTGTTTGTTGTTTGTTGTGGG + Intergenic
1013257197 6:108399565-108399587 TTTTTCATATTGTTTACTGCTGG + Intronic
1013336612 6:109169219-109169241 TTTTTTTTTTTTTTTGCTGATGG - Intergenic
1013461632 6:110379514-110379536 TTGTTGTTGTGGCTTTCTGCTGG - Intergenic
1013477187 6:110519495-110519517 TTGTTTTTTTTTTTTGCTGCAGG - Intergenic
1013529425 6:111005281-111005303 TTTTTGTTTTCTTTTGTTGCTGG + Intronic
1013730493 6:113158828-113158850 TTTTTGTTGTTGTTGCTTGTTGG - Intergenic
1013880848 6:114898526-114898548 TTTTTTTTTTTATGTGCTGCTGG - Intergenic
1013981989 6:116141767-116141789 TTTTTGTTTTGGTTTCCAGCAGG + Intronic
1014315448 6:119858533-119858555 TTTTTGTTTTTGTTTGTGACAGG - Intergenic
1014358875 6:120449654-120449676 TGTTTGTTTATTTTTGCTGCTGG - Intergenic
1014816521 6:125941897-125941919 TTGTTGTTGTTGTTTGTTTTTGG + Intergenic
1014826667 6:126054968-126054990 TTTTTGTTGTTTTTTGAGACAGG + Intergenic
1014928725 6:127307201-127307223 TTTTTCTTGTTTTTTGATGTAGG - Intronic
1014990067 6:128063959-128063981 TTCTTGGGGTGGTTTGCTGCCGG - Intronic
1015103634 6:129510310-129510332 TTTTTCTGATTGTTTGCTGTTGG - Intronic
1015148556 6:130014986-130015008 TTTTTGTTGTTGTGTTTTGGAGG - Intronic
1015464557 6:133534285-133534307 TTTTTGTTGTTGTTTGTTTCAGG - Intergenic
1015467975 6:133568827-133568849 TTTTTGTTGTTGTTTTGAGACGG - Intergenic
1015813587 6:137185544-137185566 TTTTTGTTGTTGTCTGCCTCTGG + Intergenic
1015941076 6:138452833-138452855 TTTCTGTTGTTGTTGGCGCCAGG - Intronic
1016646650 6:146417296-146417318 TTTTTCTTGTTGTTTTCAGTGGG + Intronic
1016983179 6:149872086-149872108 TTTTTGCTTTTGTGTGCTTCTGG + Intergenic
1017086393 6:150716855-150716877 TTTTTGTTTTTGTTTGAGACAGG + Intronic
1017185488 6:151596594-151596616 ATTTTGTTGTTGCTTTTTGCTGG + Intronic
1017230715 6:152070378-152070400 ATTTTGTTGTTGTTTCCTTAAGG - Intronic
1017463712 6:154675084-154675106 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1017859457 6:158381924-158381946 TTGTTGTTGTTGTTTTTTCCAGG + Intronic
1018102060 6:160449217-160449239 TTTTTGTTTTTGTTTGTTTTTGG + Intronic
1018146510 6:160895547-160895569 TTCTTATTGTTGTATGCTGCTGG - Intergenic
1018275060 6:162121647-162121669 GTTCTGTTGTGGTTAGCTGCTGG + Intronic
1018565884 6:165152863-165152885 ATTTTGTTATTGTTTGTTGCTGG - Intergenic
1018600017 6:165528436-165528458 TTAGTGTTGGTGTCTGCTGCTGG - Intronic
1018617531 6:165702200-165702222 CTTTTGTAGTTCTTTGCAGCTGG - Intronic
1018671011 6:166177554-166177576 TTTTTGATGTGATTTGATGCAGG + Intergenic
1018794185 6:167173055-167173077 TTTTTGTTTTTGTTTTTTGGAGG - Intronic
1019089884 6:169519711-169519733 TTTTTGTTTTTGTTGGTTGGGGG - Intronic
1019108101 6:169685280-169685302 TTGTTGTTGTTGTTTGTTTTTGG - Intronic
1019673649 7:2297543-2297565 TTTTTTTTTTTTTTTGCGGCGGG - Intronic
1019886166 7:3907961-3907983 TTGTTGTTGTTGTTGGCTTGGGG + Intronic
1019954069 7:4399174-4399196 TTTTTGTTGTTGTTTTGAGATGG - Intergenic
1020064843 7:5179910-5179932 TTGTTGTTGCTTGTTGCTGCTGG + Intergenic
1020377894 7:7508685-7508707 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1020415105 7:7936413-7936435 ATTTTCTTGTTGTCTGCTGTGGG - Intronic
1020510252 7:9047539-9047561 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1020702630 7:11502142-11502164 TTTTTGTTGTTGTTTTTAGTAGG - Intronic
1020714126 7:11648437-11648459 TTTTTGTTGTTGTTCTGTGTGGG + Intronic
1020822793 7:12991161-12991183 TTTTTGTTGTTGTTTTGAGATGG + Intergenic
1021182752 7:17527397-17527419 TTTTAGTTATTTTGTGCTGCTGG + Intergenic
1021547287 7:21828822-21828844 TTGTTGTTGTTGTTTAATTCTGG + Intronic
1021742813 7:23704713-23704735 TCTTTGTTGTTGTTTGAGACAGG - Intergenic
1021856087 7:24857795-24857817 TTTGTGTTGTTTTTTGCTGCAGG + Intronic
1021962647 7:25887755-25887777 TACTTGTTTTTGTTTTCTGCTGG - Intergenic
1022049716 7:26654125-26654147 CTTTTGTTGTTGGTTTTTGCTGG - Intergenic
1022124904 7:27346993-27347015 TTTTTATTGCTGTTTGCTTAGGG + Intergenic
1022462134 7:30619654-30619676 CTTTTGTTGTTGTTTTGTGTTGG + Intronic
1022462682 7:30626365-30626387 CTTTTGTTGTTGTTTGAGACAGG + Intronic
1022661456 7:32371177-32371199 TTTTTGTTTTTGTTTTTTGGTGG - Intergenic
1022747117 7:33183817-33183839 TTTTTTTGTTTGTTTGCTTCAGG + Intronic
1022759086 7:33327525-33327547 TTTTTGTTGTTGTTAGATATAGG - Intronic
1022819290 7:33943317-33943339 TTTTTGATGTTGTGGGGTGCGGG - Intronic
1023022612 7:36023841-36023863 TTTTTTTTGATGTTTGAGGCGGG + Intergenic
1023086620 7:36576377-36576399 TTTTTGTTCTCCTTTGCTGTGGG + Intronic
1023371098 7:39512878-39512900 TTTTTGTTTTTGTTTGAGGCAGG + Intergenic
1023475575 7:40574435-40574457 TTGTTGTTGTTGTTTGAGCCAGG + Intronic
1023493256 7:40767192-40767214 TTTTTGTTTTTCTTTAATGCAGG - Intronic
1023693495 7:42819385-42819407 TTTTATTTGTTGTTAGCTTCAGG - Intergenic
1023766243 7:43513684-43513706 TTTTTTTTGTTTTTTGCTTTTGG + Intronic
1024085337 7:45887929-45887951 TTTTTGTTTTGTTTTGTTGCAGG + Intergenic
1024390713 7:48808683-48808705 TTGTGGTTGTTGTTTGCTCAGGG + Intergenic
1024425205 7:49216805-49216827 TTTTGTTTGTGTTTTGCTGCAGG + Intergenic
1024468444 7:49739755-49739777 GTTTTGTTGTTGTTTGTTTGTGG - Intergenic
1024869796 7:53950790-53950812 TTTTTGTTTTGGTTAGATGCAGG + Intergenic
1024921250 7:54557332-54557354 TTTTTGTTGTTGTTTTGAGATGG + Intronic
1024934829 7:54701563-54701585 TTTTAGTTTTTGTTTTATGCAGG - Intergenic
1025004959 7:55346171-55346193 TGTTTGTAATTGTTTGTTGCTGG - Intergenic
1025223502 7:57136421-57136443 CTGTTGTTGTTGTTTGTTTCAGG - Intronic
1025634305 7:63308045-63308067 TTGTTGTTGTTGTTTGTTTCAGG - Intergenic
1025637331 7:63334151-63334173 TTGTTGTTGTTGTTTGGTTTTGG + Intergenic
1025645364 7:63413948-63413970 TTGTTGTTGTTGTTTGGTTTTGG - Intergenic
1025648393 7:63440121-63440143 TTGTTGTTGTTGTTTGTTTCAGG + Intergenic
1025741705 7:64203061-64203083 ATTTTGTTGTTGTTTGTTTCAGG + Intronic
1025746166 7:64244990-64245012 ATTTTGTTGTTGTTTGTTTCAGG + Intronic
1026091465 7:67303963-67303985 TTTTTGTTGTTTTTTTCAGACGG + Intergenic
1026321928 7:69275793-69275815 TTTTTTTTTTTTTTTGCTGGGGG - Intergenic
1026423887 7:70270258-70270280 TTGTTGTTGTTGTTATTTGCTGG - Intronic
1026561344 7:71452825-71452847 TTTTTGTTGTTGTTGTTTTCTGG + Intronic
1026581905 7:71625539-71625561 TTTTTGGTGTTTTTTGTTGGGGG + Intronic
1026610035 7:71850212-71850234 TTTTTGTTGTTGTTTTTTCTTGG + Intronic
1026648565 7:72194522-72194544 TTTTTGTTTTTGTTTGAGACAGG - Intronic
1026655678 7:72254638-72254660 TTTTTATTTTTTTTTGCTGAGGG + Intronic
1026748916 7:73034416-73034438 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1026752564 7:73062561-73062583 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1026756215 7:73090692-73090714 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1027035113 7:74919711-74919733 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1027091190 7:75302732-75302754 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1027094835 7:75330705-75330727 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1027324505 7:77036980-77037002 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1027370464 7:77504485-77504507 TTTGTGTTTTTATTTGCTACAGG - Intergenic
1027388425 7:77681055-77681077 TTATTGTTGTTGTTTGAGACAGG - Intergenic
1027397851 7:77774736-77774758 TTTTTGTTGTTGTTGGTGGTGGG - Intronic
1027399047 7:77788558-77788580 TTTTTGTTTTTGTTTGAGACAGG - Intergenic
1027527032 7:79282452-79282474 TTTTTGTTGTTGTTTTCTGCAGG + Intronic
1027605539 7:80294117-80294139 TTGTTGTTGTTGTTAGATACAGG + Intergenic
1028098144 7:86787402-86787424 TCTTTGTTGATGTTGGCTGCAGG + Intronic
1028307844 7:89289354-89289376 TTTTTGTTGTTGTTGTTTGTTGG - Intronic
1028417382 7:90595609-90595631 TTTTTGTTGTTGTTTGCGGTGGG - Intronic
1028454999 7:91028785-91028807 TTTTTGTTTTTGTTTTTTGCTGG + Intronic
1028664741 7:93328507-93328529 ATTTTATAGTTGTTTTCTGCAGG - Intronic
1028865573 7:95707462-95707484 TTTTTGTTGTTGTTGAATGTGGG - Intergenic
1028902007 7:96112209-96112231 TTGTTGTTGTTGTTAGATCCTGG + Intergenic
1028935653 7:96461202-96461224 TTGTTGTTGTTGTTTGTGACAGG + Intergenic
1029260686 7:99300837-99300859 TTTTTGTTGCTGTCTGCTTGGGG - Intergenic
1029294839 7:99532002-99532024 TTTTTGATGTTGTTTGGTGTGGG - Exonic
1029394943 7:100301428-100301450 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1029800753 7:102945343-102945365 TTTTTGTTTTTGTTTTGAGCAGG + Intronic
1029821978 7:103155464-103155486 TTTTTTTTTTTTTTTGCTGTAGG - Intergenic
1029994505 7:104993877-104993899 ATTAAGTTGATGTTTGCTGCAGG - Intergenic
1030192772 7:106825879-106825901 TTTTTGTTGTTGTTCTATCCAGG - Intergenic
1030217899 7:107065292-107065314 TTTTTATTTTTGTTTGCTCGGGG + Intronic
1030485770 7:110165340-110165362 TTGTTGTTGTTGTTTACAGTTGG + Intergenic
1030579509 7:111336053-111336075 TTTTTGTTGTTGTTTGAGAAGGG + Intronic
1030828578 7:114191809-114191831 TTTGTGTTGTTTTTTTCCGCGGG + Intronic
1030845706 7:114407619-114407641 TTTTTCTTGTTCTCTGCTGAAGG - Intronic
1030852378 7:114506025-114506047 TTTTTGTTGTTTTTTAATGTGGG - Intronic
1031044557 7:116873299-116873321 TTTTTGTTGTTGTTTTTTGGTGG + Intronic
1031145390 7:117992043-117992065 TTTTTGTTGTCTTTTGCTTCAGG + Intergenic
1031179866 7:118400281-118400303 TTTTTTTTGTTGTTTTTTGGGGG - Intergenic
1031305013 7:120115171-120115193 TTTTTGTGTTTGTTTGTTTCAGG - Intergenic
1031386257 7:121155069-121155091 TTTTTCAGGTTGTTTGCTGTTGG - Intronic
1031456182 7:121982657-121982679 TATTTTCTGTTGTTTGATGCTGG + Intronic
1031552123 7:123127852-123127874 TTTTTTTTTTTTTTTGCTGGGGG + Intronic
1031612973 7:123848137-123848159 CCTTTGCTTTTGTTTGCTGCTGG - Exonic
1031638695 7:124135071-124135093 TTTTTGCTGAGGTTTGCTGTGGG + Intergenic
1031717725 7:125129581-125129603 TTTTTGTTTTTGTTTTTTGATGG + Intergenic
1031746945 7:125511039-125511061 TTTTTGTTGTTGTTCTCTATAGG + Intergenic
1031817563 7:126456919-126456941 TTTTTGTTGTTGTTTGCCCACGG - Intronic
1031858560 7:126951426-126951448 TTTTAGTTGTTGATTGCTTAGGG - Intronic
1031956659 7:127949503-127949525 TTTTTGTTCTTAAATGCTGCTGG - Intronic
1032377622 7:131438166-131438188 TTTTTTCTCTTGTTTGTTGCAGG + Intronic
1032574869 7:133042848-133042870 TTTTTTTGTTTGTTTGCTTCGGG + Intronic
1032602029 7:133307862-133307884 TTTTGGTGGTTGGTTGATGCAGG - Intronic
1032703298 7:134400566-134400588 TTTTTGTTGTTGTTTTGTTTTGG - Intergenic
1032788760 7:135225432-135225454 TTTTTCATGTTGTTTATTGCTGG - Intergenic
1032954114 7:136950639-136950661 TTTTTGTTGTTTTTAGCTTGAGG - Intronic
1033069057 7:138185354-138185376 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1033094176 7:138415310-138415332 TTGTTGTTGTTGTTTGTTTTTGG - Intergenic
1033107639 7:138543838-138543860 TTGTTGTTGTTGTTTGAAACAGG + Intronic
1033134070 7:138770043-138770065 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1033298820 7:140166954-140166976 TGTTGGTTATTGTTTGCTGTTGG - Intronic
1033329791 7:140408475-140408497 TTTTTGTTTTTGTTTTCTTGAGG + Intronic
1033754070 7:144383569-144383591 TTGTTGTTGTTGTTTTTTGGGGG - Intergenic
1033886064 7:145947350-145947372 TTGTTGTTGTTGTTGTTTGCTGG - Intergenic
1033938639 7:146622351-146622373 TTTTTGTTGTTGTTGGGTAATGG + Intronic
1034057041 7:148046084-148046106 TTTTTGTTTTTGTTTGAGGCAGG + Intronic
1034160158 7:148987991-148988013 TTTTTGCTGTTCTTTGCTTTCGG - Intergenic
1034207206 7:149328172-149328194 TTGTTGTTGTTGTTTGGAGATGG - Intergenic
1034288065 7:149903882-149903904 TTGTTGTTGTTTGTTGTTGCTGG + Intergenic
1034587348 7:152106435-152106457 TTTTTTTTGTTAATTGCTTCAGG - Intronic
1034596662 7:152201593-152201615 TCTTTGTTGTTGTTTTCTCCTGG - Intronic
1035330556 7:158094312-158094334 TTTTTGTTTTTGTTTTCAGACGG + Intronic
1035348064 7:158220521-158220543 TTTTTGTTTTGGTTTGCTAAGGG - Intronic
1036397299 8:8380088-8380110 TTTTTGTTTTTGTTTTTTGGTGG - Intronic
1036415187 8:8540276-8540298 TTTTTGTTGTTGGTGGCGGTGGG + Intergenic
1036480866 8:9138495-9138517 TTTTTGTTGTTGTTTTGTTTTGG - Exonic
1036647353 8:10619781-10619803 TTGTTGTTGTTGTTTGTTTTGGG - Intronic
1036857393 8:12308825-12308847 TTTTTTTTTTTTTTTGCTGTGGG - Intergenic
1036911155 8:12758225-12758247 TTTTTTTTTTTTTTTGCTGTGGG + Intergenic
1036929561 8:12941673-12941695 TTGTTGTTTTTGTTTCCTGATGG + Intergenic
1037075649 8:14713971-14713993 TTTTTGTTTTTGTTTTCAGATGG + Intronic
1037179758 8:15991781-15991803 TTTTTGTTGTAATCTGTTGCTGG + Intergenic
1037285118 8:17291016-17291038 TTGTTGTTGTTGTTTTGTGATGG + Intronic
1037382992 8:18308203-18308225 TTGTTGTTGTTGTTTGTTTTCGG - Intergenic
1037650101 8:20828653-20828675 ATTTTGCTGTTGTTTTCTACTGG - Intergenic
1037700287 8:21267627-21267649 TGTCTGTTTTTGTTTGTTGCAGG - Intergenic
1037746023 8:21645071-21645093 TTTTTTTTTTTTTTTGCTGTAGG - Intergenic
1037829254 8:22178293-22178315 TTTTTGTTTTTGTTTGAGACAGG + Intronic
1037840727 8:22243697-22243719 TTTTTGTTTTTGTTTTCTTTTGG - Intergenic
1038077313 8:24090982-24091004 TTGTTGTTGTTGTTTGTTTTTGG - Intergenic
1038184921 8:25264366-25264388 TTTTTGTTGTTTTTTTCTTGTGG - Intronic
1038243231 8:25830354-25830376 TTTTTGTTGTTGCCTTCTGTTGG + Intergenic
1038635002 8:29278951-29278973 ATGTTGTTGTTTTTTGTTGCTGG - Intergenic
1038689074 8:29744699-29744721 TTTTTGTTTTTGTTTGGGGGTGG + Intergenic
1038725313 8:30076964-30076986 CTTTTGTTGTTGTTTTGTCCTGG - Intronic
1038793175 8:30686806-30686828 TTGTTGTTGTTGTTTTCTTTTGG + Intronic
1039051323 8:33497331-33497353 TTTTTTTTTTTTTTTGCTGCAGG - Intronic
1039132768 8:34286247-34286269 GTTTTGTTGTTGTTTGAGGTTGG - Intergenic
1039307969 8:36284393-36284415 TTTTTCATGTTGTTTGCTGCTGG + Intergenic
1039345889 8:36704776-36704798 TTTTTGTTGTTGTTTTGAGACGG - Intergenic
1039477660 8:37848925-37848947 ATTTTGTTGTTGTTTGTTTAAGG + Intronic
1039591349 8:38752509-38752531 TTTTTGTTGTTTTTTGGTTTTGG - Intronic
1040420689 8:47237905-47237927 TTTTTGTTGTTTTTTGGTTTTGG + Intergenic
1040424901 8:47275844-47275866 TTTTTGTTTTTGTTTTTTGTTGG + Intronic
1040463076 8:47668806-47668828 TGTTTGTTGTTGTGTGTTGCTGG - Intronic
1040547217 8:48408013-48408035 TTTATGTTGGTGTGTGCAGCTGG + Intergenic
1040659459 8:49553591-49553613 TTTTTTTTTTTTTTTTCTGCAGG + Intronic
1041045733 8:53884199-53884221 TTTTTTTTTTTTTTTGATGCTGG + Intronic
1041139465 8:54800917-54800939 TTGTTGTTGTTGTTAGAAGCTGG + Intergenic
1041139849 8:54805723-54805745 TTTTTTTTGTCATTTTCTGCAGG + Intergenic
1041263586 8:56042996-56043018 TTTTTGTTTTTGTTTGAGACAGG + Intergenic
1041526264 8:58809989-58810011 TTTTTGTTGTTGTTAGAGACCGG + Intronic
1041679781 8:60577049-60577071 TTTTTCTTGTTTTTTGAGGCAGG + Intronic
1041764645 8:61405708-61405730 TTTTTTTTTTTTTTTGCTCCTGG + Intronic
1041822116 8:62048370-62048392 TTTTTGTTGTTGTTTTTTGATGG + Intergenic
1041905078 8:63023581-63023603 TTTATTTTGTTGTTGGCTGGAGG + Intronic
1041963563 8:63648351-63648373 TTTGTTGTGTTGTTTCCTGCAGG + Intergenic
1042341295 8:67682880-67682902 TTTTTGGTGATTCTTGCTGCAGG + Intronic
1042479925 8:69291460-69291482 TTTTTTTTTTTTTTTGCAGCAGG - Intergenic
1042569927 8:70152672-70152694 TTTCTGTTACTGTTTCCTGCTGG + Intronic
1042789185 8:72584446-72584468 TTTTTGTTTTTGTTTGATTATGG + Intronic
1042816937 8:72888106-72888128 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1043024735 8:75051761-75051783 TTGTTGTTGTTGTTAAGTGCTGG - Intergenic
1043030217 8:75124933-75124955 TTTTTGTTGTTGTTTTCTGGGGG - Intergenic
1043231889 8:77813703-77813725 GTATTTTTATTGTTTGCTGCAGG + Intergenic
1043249027 8:78046325-78046347 TTTTTCAGGTTGTTTGCTGTTGG - Intergenic
1043267539 8:78285602-78285624 TTTTTGTTGTTGTTGCTTGCGGG + Intergenic
1043308272 8:78824430-78824452 TTTTTGCTGTTGTTTCATACTGG + Intergenic
1043336807 8:79186150-79186172 TTTTTGTTGGTTTCTGCTGCTGG + Intergenic
1043341033 8:79239956-79239978 TTTTTTTTTTTTTTTCCTGCTGG - Intergenic
1043421469 8:80102900-80102922 TTGTTGTTGTTGTTTGTTTGTGG - Intronic
1043435752 8:80235178-80235200 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1043458817 8:80438937-80438959 TTGTTGTTGTTGTTTGAGACAGG - Intergenic
1043724875 8:83598450-83598472 TTTTTATTGTTGTTGGCTTTTGG + Intergenic
1043739438 8:83791795-83791817 TTTTTGTTGTTGCTTTCTGTTGG + Intergenic
1043768077 8:84162775-84162797 TTGTTGTTGTTTTTTGTTGTTGG + Intergenic
1043794550 8:84520110-84520132 TTTTTGTTTTGTTTTACTGCGGG - Intronic
1043796159 8:84543259-84543281 TTTTTATTGTTTTTTTTTGCTGG + Intronic
1043828284 8:84955861-84955883 TTGTTGTTGTTGTTTGGTGTGGG + Intergenic
1043947273 8:86268688-86268710 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1044065836 8:87699330-87699352 TTTTTGTTTTTGTTTGTTTAGGG + Intergenic
1044082915 8:87907233-87907255 TCTTTATTATTGTTTGCTGGGGG - Intergenic
1044104525 8:88186595-88186617 TTTTTTTTTTTTTTTGCAGCTGG - Exonic
1044163011 8:88944420-88944442 ATTTTGGTGTTGTTTGCTGTGGG + Intergenic
1044308297 8:90663816-90663838 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1044364939 8:91333890-91333912 TCTGTGTTCTTGTTTGCTTCTGG + Intronic
1044415086 8:91929452-91929474 TTTTTGTTTTTGTTTGAGGCAGG + Intergenic
1044423050 8:92020984-92021006 TTGTTGTTGTTGTTTTATACTGG - Intronic
1044473880 8:92604130-92604152 TCTCTGAAGTTGTTTGCTGCAGG + Intergenic
1044653159 8:94520178-94520200 TTTTTTTTTTTTTTTGATGCAGG - Intronic
1044736061 8:95279421-95279443 TCTTTCTTGTTTTTTACTGCAGG + Intergenic
1044775282 8:95680319-95680341 TTTTTGTTGTTGTTTTGTTTTGG - Intergenic
1044783707 8:95772198-95772220 TTGTTGTTGTTGTTTGAAGGGGG - Intergenic
1045005982 8:97917148-97917170 ATTTTGTTGTTGTTTTATGAAGG - Intronic
1045080795 8:98623776-98623798 TTTTTGTTTTTGTTTGAGGCAGG - Intronic
1045090266 8:98734853-98734875 TTTTTGTTGTTGTTTGTGTAAGG - Intronic
1045150382 8:99400674-99400696 TTTTTGTTTTTGTTTTGTGGCGG + Intronic
1045400089 8:101806195-101806217 TTTCTGTTGCTGTTTGCTTGGGG - Intronic
1045418304 8:101988896-101988918 TTTTTTTTTTTTTTTTCTGCTGG - Intronic
1045473700 8:102535839-102535861 TTGTTGCTGTTGTGTGTTGCCGG - Intronic
1045499455 8:102733923-102733945 TGTTTGTTGTTGTTTGAAACAGG + Intergenic
1045590930 8:103596390-103596412 TTTTTGTTGTTTTTTGGTAGAGG + Intronic
1045718144 8:105073149-105073171 TTTTTTTTTTTTTTTGCTGCAGG - Intronic
1045748442 8:105452744-105452766 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1045880475 8:107032403-107032425 TTTTTGTTCTTGTGTGATGTAGG - Intergenic
1046131748 8:109974930-109974952 TTTTTGTTTTGGTCTCCTGCGGG - Exonic
1046292161 8:112177300-112177322 TTTGTGTTGTTGTTTTTTCCTGG + Intergenic
1046294616 8:112201590-112201612 TTTTTATTGTTGTTTTTTGTTGG + Intergenic
1046300431 8:112279005-112279027 TTGTTGTTGTTGTTTTTTGGGGG - Intronic
1046424435 8:114028086-114028108 TTTTTGTTGTCGTTTGCTTTTGG + Intergenic
1046686732 8:117236123-117236145 TTGTTGTTGTTGTTTTTTGAAGG + Intergenic
1046760508 8:118015516-118015538 TTTTTGTTTTTCTTCTCTGCCGG - Intronic
1046851635 8:118980876-118980898 TTTTTGTTTTTGTTTGCAGGGGG + Intergenic
1046928390 8:119817873-119817895 TTTTTGTTTTTGTTTTCTGGGGG + Intronic
1046936564 8:119890306-119890328 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1047241885 8:123098304-123098326 TTTTTGTTGTTGTTTTGAGATGG + Intronic
1047755396 8:127914253-127914275 TTTTTTTTTTTTTTTGCTGTTGG - Intergenic
1047795693 8:128253277-128253299 TTTTTGTTGTTGTTGTTTGACGG + Intergenic
1047898478 8:129393641-129393663 TTTTTCATGTTGTTTGGTTCTGG - Intergenic
1048095060 8:131283332-131283354 TTTTTGTTGTTGTTAGTTCCTGG + Intergenic
1048353216 8:133632676-133632698 TTTTTGTTTTTGTTTTTTGGGGG - Intergenic
1048472036 8:134712624-134712646 TTTTTTTTTTTTTTTGCGGCGGG + Intronic
1048569724 8:135641890-135641912 CTTTTGTTGTTAGTTTCTGCTGG + Intronic
1048776907 8:137956814-137956836 TTTTTTTTTTTTTTTTCTGCTGG + Intergenic
1049054134 8:140221642-140221664 TTGTTGTTGTTGTTTGGGACGGG + Intronic
1049491028 8:142902383-142902405 TATCTGTTGGTGTATGCTGCTGG - Intronic
1049629676 8:143646668-143646690 TTTTTGTTGTTGTTTGAGACAGG + Intronic
1049648088 8:143745735-143745757 TTATTGTTGTTGTTTGAGACAGG + Intergenic
1049706359 8:144044942-144044964 TTTTTGTTGTTGTTTTGAGACGG - Intronic
1050185587 9:2969441-2969463 TTTTTTTTTTTTTTTGCTGTAGG + Intergenic
1050284746 9:4089810-4089832 TTTTTGTTGTTGTTTTTGTCAGG - Intronic
1050373041 9:4942054-4942076 TTTTTGTTGTTGTTTATTCTTGG + Intergenic
1050427307 9:5524629-5524651 TTTTTGTTGTTTTCTTTTGCAGG - Intronic
1050763138 9:9098279-9098301 TTTTTGTTGTTGTTGTTTCCCGG + Intronic
1050868742 9:10539187-10539209 TTTTTGTTGTTGTTTTGAGGTGG + Intronic
1051007088 9:12358370-12358392 TTTTTGTTCTTGTTTGAGACTGG - Intergenic
1051151003 9:14079069-14079091 TTGTTGTTTTTGTTTGCTGTAGG - Intergenic
1051253513 9:15187464-15187486 TCTTTGTTGTTGTTTGAGACAGG + Intronic
1051269457 9:15341157-15341179 TTTTTTTTCTTGCTTACTGCAGG + Intergenic
1051439412 9:17068260-17068282 TTGTTGTTGTTGTTTGAGACAGG + Intergenic
1051541853 9:18228849-18228871 TTTTTTTTGTAGTTTGCTTGGGG + Intergenic
1051686716 9:19665629-19665651 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1051746652 9:20301114-20301136 TTTTTGCTCTTGTTTGCTTGGGG - Intergenic
1051749701 9:20328299-20328321 TTTTTGTTTTTGTTTGAGACAGG - Intergenic
1052686063 9:31757691-31757713 TTTTTCTTTTTGTTTTCTTCTGG + Intergenic
1052739248 9:32377555-32377577 TTTTTGTTGTTGTTTTTTTCAGG + Intergenic
1052843692 9:33315713-33315735 TTTTTGTTGTTGTTAGAGACTGG - Intronic
1053107619 9:35425479-35425501 TTTTGGTTGTTGTTAGAGGCAGG + Intergenic
1053590498 9:39509659-39509681 TTGTTGTTGTTGTTTGTTGAGGG - Intergenic
1053910136 9:42891091-42891113 TTTTTTTTGTTGTTTGGTTTTGG + Intergenic
1054575805 9:66855630-66855652 TTGTTGTTGTTGTTTGTTGAGGG + Intergenic
1054766039 9:69043419-69043441 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1054776639 9:69129502-69129524 TTTTTTTTGTTTTTTGCGACAGG - Intronic
1054829695 9:69609802-69609824 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1054844408 9:69777799-69777821 TTTATGTTTTTCTTTGCTGTTGG + Intergenic
1054950381 9:70844463-70844485 GTTTTGTTGTTTTTTGGTTCGGG - Intronic
1055021928 9:71679348-71679370 TTTTTGTTGTTGTTGTCTTGAGG - Intergenic
1055141898 9:72885903-72885925 TTTTTATTGTTGTTTACTTCCGG + Intergenic
1055251462 9:74312249-74312271 TTTTTGTTGTAATTTTCTTCTGG - Intergenic
1055641664 9:78323572-78323594 TTTTTGTTTTTGTTTGAGACAGG - Intronic
1055659588 9:78489729-78489751 TTGTTGTTGTTGTTTTTTGAGGG + Intergenic
1055709965 9:79049972-79049994 TTTTTGTTTTTGTTTTTTGGAGG + Intergenic
1055769929 9:79706048-79706070 TTGTTGTTGTTTTTTGAGGCAGG + Intronic
1055859945 9:80737470-80737492 TTTTTGTTGTTGTTTTACACAGG - Intergenic
1055998024 9:82182912-82182934 TTCATGTTGTTGATTGCTACAGG + Intergenic
1056008513 9:82301286-82301308 TTTTTGTTGTTGTCTGCTACTGG + Intergenic
1056059211 9:82865497-82865519 TCTTTCTTGTTGTTTACTGTTGG - Intergenic
1056099873 9:83291117-83291139 TTTTTGTTTTTGTTTGTTGGTGG - Intronic
1056137134 9:83641526-83641548 TTTTTGTTTTTGTTTTTTTCAGG + Exonic
1056527065 9:87453447-87453469 TTTTTGTTGTTGTTAGTTAAGGG - Intergenic
1056602842 9:88059894-88059916 TTTTTTTTTTTTTTTGATGCAGG - Intergenic
1057122241 9:92586851-92586873 TTGCTGTTGTTGATTGCTGAGGG - Intronic
1057418672 9:94889484-94889506 TTTTTGTTGTTGTTTGTTTTTGG + Intronic
1057532363 9:95861944-95861966 CTTTTGTTGTTTTTGGCTGGAGG + Intergenic
1057666002 9:97045986-97046008 TTGTTGTTGTTGTTTGGGGAGGG - Intergenic
1057788060 9:98103184-98103206 TTGTTGTTGTTGTTTGTTTTTGG - Intronic
1057832600 9:98418527-98418549 TTGTTGTTGTTGTTTGAGACAGG - Intronic
1057912969 9:99034527-99034549 TTTTTGTTTTTGTTTTTTTCAGG + Exonic
1058268891 9:102943933-102943955 TTTTTGTTGTTGTTTGGTAGGGG + Intergenic
1058314654 9:103550130-103550152 ATTATGTTGTTGCTTTCTGCTGG - Intergenic
1058506792 9:105674414-105674436 TTTTTTTTCTTTTTTGCTGAAGG + Intergenic
1058522662 9:105827812-105827834 TTTTTGTTTTTGTTTCAGGCAGG + Intergenic
1058646270 9:107134297-107134319 TTTTTGTTTTTGTTTGAGACAGG + Intergenic
1058683471 9:107460264-107460286 TTTTGTTTGTTCTTAGCTGCCGG - Intergenic
1059047731 9:110888559-110888581 TTTTTTTTTTTTTTTTCTGCTGG - Intronic
1059076411 9:111197825-111197847 TTGTTGTTGTTGTTTTCTGTTGG - Intergenic
1059624414 9:116046393-116046415 TGTTTGTTTTTGTTTGTTTCCGG - Intergenic
1059808584 9:117831041-117831063 TTATTGTTTTTGTTTGCTTTGGG - Intergenic
1060288463 9:122276872-122276894 TTTTTGTTGTTTTTTGAGACGGG + Intronic
1060502064 9:124165804-124165826 TGTTTGTTGTTTTTTGAGGCAGG - Intergenic
1060571863 9:124648800-124648822 GTTTTCTTATTGTTTGCTGTTGG - Intronic
1060592239 9:124824951-124824973 TTTTTGTTTTTGTTTTTTGTTGG + Intergenic
1060714144 9:125905839-125905861 TTGTTTGTGTTATTTGCTGCTGG + Intronic
1060846829 9:126843985-126844007 ATTTTGTTGTTAATTTCTGCTGG + Intergenic
1061021959 9:128021721-128021743 TTGTTGTTGTTGTTTAAGGCAGG + Intergenic
1061040117 9:128136649-128136671 TTTTTTTTTTTTTTTGCTGTGGG - Intergenic
1061105348 9:128526013-128526035 TTGTTGTTGTTGTTTTTTGCGGG + Intronic
1061323243 9:129845519-129845541 TTTTTGTTGTTTTTTGATTTTGG + Intronic
1061692317 9:132343313-132343335 TTTTTGTTGTTGTTTTGAGATGG - Intronic
1061827383 9:133268343-133268365 ATTTTGTTAGTGTTTGCTCCAGG - Intronic
1061896997 9:133653413-133653435 TTTTGCTTGTTGTTAGCAGCAGG - Intronic
1062066835 9:134532912-134532934 TTCTTGTTGTTGTTTGAGGAAGG - Intergenic
1062307600 9:135918129-135918151 TTTTTCTTTTTTTTTGCTACAGG - Intergenic
1062608778 9:137362812-137362834 TTTTTGTTGTTGTTTTGAGATGG + Intronic
1062728174 9:138090694-138090716 TTTTTTTTTTTTTTTGCTGATGG - Intronic
1203460057 Un_GL000220v1:26719-26741 TTTTTGTTGTTGTTTTGAGATGG + Intergenic
1203716019 Un_KI270742v1:148275-148297 ATTTAGCTGTTGTTTTCTGCTGG + Intergenic
1203535192 Un_KI270743v1:29961-29983 ATTTAGCTGTTGTTTTCTGCTGG - Intergenic
1185659435 X:1715042-1715064 TTTTTGTTGTTGTTTTGAGATGG - Intergenic
1185663178 X:1743176-1743198 TTTTTGTGGTTGTTTCTTGATGG + Intergenic
1185802716 X:3028095-3028117 TTTTTGTTTTTGTTTGAAACAGG - Intronic
1185977967 X:4742566-4742588 TTTTTGTTTTTGTTTTCTTTTGG + Intergenic
1186020760 X:5252529-5252551 TTTTTGTTGTTGTTTCTTAAAGG - Intergenic
1186394847 X:9197428-9197450 TGTTTATTGTTGTTGGCTGCTGG - Intergenic
1186656963 X:11623285-11623307 TTTTTGAGATTGTTTGCTGTTGG - Intronic
1186970242 X:14833987-14834009 TTTTTGTTTTTGTTTGAGACAGG - Intergenic
1187353048 X:18540173-18540195 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1187644051 X:21327721-21327743 TTTTTCTTCTTTTTTGATGCAGG - Intergenic
1187804937 X:23109267-23109289 TTTTTTTTTTTCTTTTCTGCTGG + Intergenic
1187914141 X:24137675-24137697 TTTTTGTTGTTTTTTGAGACAGG + Intergenic
1187949283 X:24456058-24456080 TTTTTGTTTTTGTTTTTTGTAGG + Intergenic
1187963537 X:24588362-24588384 TTTTTGTTTTTGTTTTTTTCTGG + Intronic
1187983313 X:24782930-24782952 TTGTTGTTGTTGTTTAATGAGGG + Intronic
1188081499 X:25847211-25847233 TTTTTGTTTTTGTTTGTTGGGGG + Intergenic
1188415256 X:29925431-29925453 TTTTTTTTTTTTTTTGCTGGGGG + Intronic
1188686098 X:33072424-33072446 TTTTTGTCGTTGTTTGTTTTTGG - Intronic
1188692797 X:33150901-33150923 TCTCTGTTGTGGTTTGCTTCAGG - Intronic
1188737668 X:33738588-33738610 TTTTTGTTTTTGTTTTGAGCTGG - Intergenic
1188938912 X:36213330-36213352 TTTTGGTTGTTGTTTGCCAGTGG + Intergenic
1188971247 X:36618090-36618112 TTTTTGTTTTTGTTTATTTCTGG + Intergenic
1189029094 X:37431764-37431786 TTGTTGTTGTTGTTTGTTTTTGG + Intronic
1189080508 X:37967048-37967070 TTTTTGTTGTTGTTGTTTTCTGG + Intronic
1189273789 X:39770338-39770360 TTTTTGTTTTTGTTTGAAACAGG - Intergenic
1189288891 X:39871355-39871377 TATTTGTTGTTGTTTGAGACAGG + Intergenic
1189392738 X:40590382-40590404 TTTGTTTTGTTTTTTGCTACAGG + Intronic
1189572586 X:42314858-42314880 GTTGTTTTGTTGTTTGCTGTGGG + Intergenic
1189581599 X:42413278-42413300 TTGTTGTTGTTGTTTTCTGTTGG + Intergenic
1189675244 X:43454741-43454763 TTTTATTTGTTGTTTGTTTCAGG - Intergenic
1190096588 X:47486084-47486106 TTTTTGTTTTTTTTTGCGGGGGG - Intergenic
1190459811 X:50661222-50661244 TTTTTGTTTTTGTTTGAGACAGG + Intronic
1190532200 X:51390411-51390433 TTTTTCTGATTGTTTGCTGTTGG - Intergenic
1190996373 X:55614422-55614444 GATTTGTTATTGTTTCCTGCTGG - Intergenic
1191081512 X:56515568-56515590 TTTTTCTGATTGTTTGCTGTTGG - Intergenic
1191800200 X:65070830-65070852 TTTTTTTTTTAGTTTGCTGAGGG + Intergenic
1191826257 X:65367829-65367851 TTTGTGTTGTTTCTTGGTGCCGG - Intronic
1191829789 X:65404209-65404231 TTTTTTTTGTTGTTTGTTTGAGG - Intronic
1191946478 X:66539953-66539975 TCAGTGTTGGTGTTTGCTGCAGG - Intergenic
1192409250 X:70918430-70918452 TTGTTGTTGTTGTTTGAGGCAGG + Intergenic
1192422475 X:71045771-71045793 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1192504733 X:71674893-71674915 TTTTTGTTCTTTTTTGATGTGGG + Intergenic
1192813952 X:74572240-74572262 TTGTTGTTGTTGTTTTCAGACGG + Intergenic
1192970314 X:76221515-76221537 TTTTTTTTTTTTTTTGCAGCTGG - Intergenic
1193173136 X:78359711-78359733 TTTTTGTTTTTGTTTTTGGCTGG - Intergenic
1193183485 X:78485256-78485278 TTTTTGTTGTTATTAGCAGGAGG - Intergenic
1193188027 X:78536657-78536679 ATCTTTTTGTTGTTTGATGCAGG + Intergenic
1193575438 X:83189927-83189949 TTGTTGTTCTTGATTGCTGTTGG + Intergenic
1193854535 X:86582892-86582914 TTTTTGTTGTTGTTTCTGCCAGG - Intronic
1193947292 X:87754407-87754429 TTTTTGTTGTTGTTTCTTAATGG - Intergenic
1194016951 X:88634534-88634556 CTTTTTTTGTTGTTTGCTGTTGG - Intergenic
1194160863 X:90450901-90450923 ATTTTCTTATTGTTTGCTGGGGG + Intergenic
1194225068 X:91246107-91246129 TTTCTGTGGTTCTTTGCAGCTGG + Intergenic
1194465399 X:94228920-94228942 TTGCTGTTGTTGTTTTCTGTTGG - Intergenic
1194726117 X:97399239-97399261 TTTTTGTTGTTGTTTGAGATGGG + Intronic
1194786051 X:98085635-98085657 TTTTTCTTGTTGTCTGCCACAGG - Intergenic
1194803333 X:98298045-98298067 TTTTTTTTTTTTTTTCCTGCTGG + Intergenic
1195047982 X:101071388-101071410 TTTTTGTTGTTGTTTTTTGTTGG - Intergenic
1195161692 X:102177942-102177964 TTTTTTTTTTTTTTTGCTGCAGG + Intergenic
1195214438 X:102684682-102684704 TTTTTGTTGCTATTTGTTGTAGG + Intergenic
1195260291 X:103125150-103125172 TTGTTGTTGTTGTTTTCAGACGG + Intergenic
1195420049 X:104664565-104664587 CTTTTGTTGTTGCTTACTGTGGG + Intronic
1195590209 X:106615901-106615923 TTTTTATTTTTGTTTTTTGCAGG + Intronic
1195768418 X:108321357-108321379 TTTTTGTTGTTGTTTTTTATTGG + Intronic
1195795751 X:108644893-108644915 TTGTTGTTGTTGTTTGGAGACGG - Intronic
1195804755 X:108751914-108751936 TTGTTGTTGTTGTTTGCACATGG - Intergenic
1195982953 X:110599673-110599695 TTTTTTATATTGTTTGCTGATGG + Intergenic
1196496395 X:116329098-116329120 TTGTGGTTGTTGTGTGCTGAGGG - Intergenic
1196592211 X:117498858-117498880 TTTTTTTTCTTTTTTGCTGTAGG - Intergenic
1196758072 X:119175556-119175578 TTTTTTTTTTTTTTTGCTTCTGG - Intergenic
1196789091 X:119448008-119448030 TTTTTGTTTTTGTTTTTTGAGGG - Intronic
1196907425 X:120451459-120451481 TTTTTGTTGTTGTTGGGGGTGGG + Intronic
1197025283 X:121740415-121740437 TTTTGGCTGGTTTTTGCTGCTGG + Intergenic
1197360748 X:125500125-125500147 TTTTTTATATTGTTTGCTGTTGG + Intergenic
1197412101 X:126129835-126129857 TGTTTGTTGTTTTTTGTTTCAGG + Intergenic
1197425006 X:126285733-126285755 TTTTTTTTTTTTTTTGATGCTGG - Intergenic
1197508867 X:127345855-127345877 TTTTTTTTCTTTTTTGATGCAGG + Intergenic
1198100733 X:133419531-133419553 TTTTTTTTTTTTTTTGATGCAGG + Intergenic
1198469058 X:136929355-136929377 ATTTTGTTTTTGTTTGATACAGG + Intergenic
1198508660 X:137327143-137327165 TTCTTTTAGTTGTTTTCTGCTGG - Intergenic
1198514914 X:137397004-137397026 TTTGTCTTCTTGTTTGCTGTGGG + Intergenic
1198665311 X:139015420-139015442 TTTTTCTGATTGTTTGCTGTTGG - Intronic
1198827539 X:140714855-140714877 TTTTTGTTTGTTTTTGTTGCTGG - Intergenic
1198881742 X:141288702-141288724 TTGTTGTTGTTGTTTGGAGGAGG + Intergenic
1199050868 X:143235309-143235331 GTTTTGTTTTTGTTTTTTGCAGG - Intergenic
1199139789 X:144296586-144296608 CATTTGTTGTTGTGTGCTGGCGG - Intergenic
1199267785 X:145848491-145848513 TTTTTTTTTTTTTTTGCTACTGG - Intergenic
1199732347 X:150648318-150648340 TTTTTGTTTTTGTTTTTTCCTGG - Intronic
1199733459 X:150661027-150661049 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1199784980 X:151097112-151097134 TTTTTCTATTTGTTTGTTGCTGG - Intergenic
1200098521 X:153675533-153675555 TTGTTGTTGTTGTTTGAGACAGG + Intronic
1200174461 X:154103314-154103336 TTTTTGTTTTTGTTTTCTTCAGG - Intergenic
1200507153 Y:4027835-4027857 ATTTTCTTATTGTTTGCTGGGGG + Intergenic
1200548865 Y:4553823-4553845 TGTCTGTTGTAGTTTGCTGGAGG + Intergenic
1200561532 Y:4709414-4709436 TTTCTGTGGTTCTTTGCAGCTGG + Intergenic
1200758861 Y:7017330-7017352 TTGTTGTTGTTGTTTTCAGCTGG - Intronic
1200875106 Y:8146329-8146351 TTTTTGTTTTTGTTTTTGGCAGG - Intergenic
1201170235 Y:11253236-11253258 ATTTAGCTGTTGTTTTCTGCTGG + Intergenic
1201480581 Y:14434662-14434684 TTTTGGTTGTTGTTTGTTTTGGG + Intergenic
1201541902 Y:15114005-15114027 TTTCTGTTGGAGTTTGCTGGAGG - Intergenic
1201544952 Y:15151575-15151597 ATTTTGTTGTTGTTTGTGACGGG - Intergenic
1201549557 Y:15205692-15205714 TTTTTGTTTTTGTTTGGAGATGG - Intergenic
1201610625 Y:15839430-15839452 TTTTTTTTTTTTTTTGCTGTAGG + Intergenic
1201758086 Y:17511689-17511711 TGTTTGTTTTAGTTTGCTGCTGG - Intergenic
1201843469 Y:18394301-18394323 TGTTTGTTTTAGTTTGCTGCTGG + Intergenic
1201971532 Y:19802476-19802498 TGTTTGTTGGAGTTTGCTGGAGG - Intergenic
1202046341 Y:20740059-20740081 TTTTTGTTTTTGTTTTCTTGAGG - Intergenic
1202332206 Y:23766575-23766597 TTGTTGTTCTTGTTTGAGGCAGG - Intergenic
1202538563 Y:25903488-25903510 TTGTTGTTCTTGTTTGAGGCAGG + Intergenic