ID: 1096677319

View in Genome Browser
Species Human (GRCh38)
Location 12:53232608-53232630
Sequence CCCCATTGCCTACCCTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096677319_1096677328 8 Left 1096677319 12:53232608-53232630 CCTCCCCAGGGTAGGCAATGGGG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1096677328 12:53232639-53232661 ACTCCCTCCCAGTGCTGGATTGG 0: 1
1: 0
2: 1
3: 14
4: 132
1096677319_1096677331 12 Left 1096677319 12:53232608-53232630 CCTCCCCAGGGTAGGCAATGGGG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1096677331 12:53232643-53232665 CCTCCCAGTGCTGGATTGGCCGG 0: 1
1: 0
2: 2
3: 31
4: 435
1096677319_1096677332 13 Left 1096677319 12:53232608-53232630 CCTCCCCAGGGTAGGCAATGGGG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1096677332 12:53232644-53232666 CTCCCAGTGCTGGATTGGCCGGG 0: 1
1: 0
2: 1
3: 9
4: 148
1096677319_1096677325 3 Left 1096677319 12:53232608-53232630 CCTCCCCAGGGTAGGCAATGGGG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1096677325 12:53232634-53232656 TACCCACTCCCTCCCAGTGCTGG 0: 1
1: 0
2: 1
3: 20
4: 224
1096677319_1096677335 17 Left 1096677319 12:53232608-53232630 CCTCCCCAGGGTAGGCAATGGGG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1096677335 12:53232648-53232670 CAGTGCTGGATTGGCCGGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096677319 Original CRISPR CCCCATTGCCTACCCTGGGG AGG (reversed) Intronic
900715022 1:4138683-4138705 CCCAATTTCCTACCCTGGGAAGG + Intergenic
900929742 1:5729030-5729052 CCCCCTTGCCCATCCAGGGGTGG - Intergenic
900996741 1:6127026-6127048 CCCCCTTGCCTGCCCTCAGGAGG + Intronic
901702666 1:11053894-11053916 CCCCTTTCCCCACCCTGGGCAGG - Intergenic
902978236 1:20104849-20104871 CTCCATTGCCAACCCAGGGATGG - Intergenic
903743721 1:25573148-25573170 CCACCTTGGCTACCCTGGGTGGG - Intergenic
905449255 1:38046511-38046533 CCCCAGTGGCTACCCACGGGAGG - Exonic
911063797 1:93769987-93770009 CCCCTCTGTCTTCCCTGGGGAGG + Intronic
912498833 1:110108452-110108474 CCCCATTGCCTTTCCTAAGGGGG - Intergenic
915543125 1:156581478-156581500 CCCCATGGCCAGCCCTGGTGAGG - Exonic
916558380 1:165911932-165911954 CCCCATTGCCTTCCTTAGGCTGG + Intergenic
917753576 1:178076913-178076935 CCACTGTGCCTACCCAGGGGTGG + Intergenic
918024735 1:180732554-180732576 CCCCATTGCACACCCTGTGAGGG - Intronic
918063895 1:181086503-181086525 CCCCACATACTACCCTGGGGTGG - Intergenic
918423656 1:184387378-184387400 AGCCATTGCCTGCTCTGGGGCGG + Intronic
919901243 1:202045874-202045896 CCACATGGCCCACTCTGGGGAGG - Intergenic
919907087 1:202085567-202085589 CCCCCTTCCCTACCCGGGGTGGG - Intergenic
921403596 1:214753828-214753850 CTCCATTGCATGCCCTGGGAGGG + Intergenic
922729430 1:227942109-227942131 CCCCAGTGCCTGCCCTGGCCTGG - Intronic
923109866 1:230882175-230882197 CCCCATTGCATGCCCTGTGAGGG - Intergenic
1063449129 10:6139808-6139830 TCCTATTCACTACCCTGGGGCGG + Intergenic
1064106197 10:12502712-12502734 CCCCACTGCCAGCCCTGGGCAGG - Intronic
1065343085 10:24723986-24724008 CCCCAGAGCCTCCCCTGGGGAGG - Intergenic
1067382205 10:45785181-45785203 GACCATTGCATACACTGGGGTGG + Intronic
1067529964 10:47063158-47063180 CCCCTTTGCCTTCCCTGCGCTGG + Intergenic
1068669373 10:59709001-59709023 CCCCATTCCCAACCCTCCGGGGG + Intronic
1069737533 10:70666976-70666998 CCCCAGTGGCTACCCTGTGTTGG - Intergenic
1072925083 10:99610268-99610290 CCCCACTGTCTTCCCTAGGGCGG - Intergenic
1073541038 10:104316237-104316259 CCCAAAGGCCTACCCTGGGGTGG + Intronic
1074362249 10:112832883-112832905 CCCCACTGCCTACCCTGCAAGGG - Intergenic
1076686009 10:132198781-132198803 CCCCATTGCCCACACTGGTCTGG + Intronic
1076991980 11:280204-280226 CCCCATCGCCTCCTCCGGGGCGG - Exonic
1077317410 11:1925603-1925625 CTGGACTGCCTACCCTGGGGTGG - Intronic
1077502604 11:2916161-2916183 CACCCTTGCCCACGCTGGGGAGG + Intronic
1077577889 11:3398285-3398307 ACCCATTTCCTAAGCTGGGGTGG - Intergenic
1078461427 11:11517985-11518007 CGCCAGTGCCTACCCTGGCCTGG + Intronic
1078468500 11:11568570-11568592 CCCCTTTTCCTCTCCTGGGGAGG + Intronic
1079095021 11:17504481-17504503 CTCCATTGCCTGCGCAGGGGTGG - Intronic
1083355305 11:62061816-62061838 TCCCACTGCCTTCTCTGGGGAGG + Intergenic
1083741956 11:64715949-64715971 CCCCCTTCCCTGCCCTGGGCTGG - Intronic
1085016658 11:73178320-73178342 CCCCAGCGCCTAGCATGGGGTGG - Intergenic
1085181601 11:74541293-74541315 CCCCCTTTCCTCCCATGGGGGGG - Intronic
1085259566 11:75196508-75196530 CACCAGTGCCCACCCTGGGCTGG + Exonic
1085684131 11:78606179-78606201 CCCCATCGCATGCCCTGGGAGGG + Intergenic
1087760895 11:102103519-102103541 GCCCCTTGCCTACTCTGGGGTGG + Intergenic
1088771824 11:113043102-113043124 CCCCATTTACCACCCTGGGGAGG - Intronic
1089584864 11:119503841-119503863 CCCCATGAACTACCCTGGGCTGG - Intergenic
1093845949 12:23971491-23971513 CCCCATTGCCTACAGTGGAGAGG + Intergenic
1094406532 12:30121911-30121933 CCCCATTGCATGCCCTGTGAGGG + Intergenic
1095349240 12:41189094-41189116 CCCCTTTGCTTACCCTGCGGTGG - Exonic
1096477348 12:51916246-51916268 CCCCTTTCCCTACCCTGTGTAGG - Intronic
1096496374 12:52041647-52041669 CTCCAATGCCTAACCCGGGGAGG + Intronic
1096677319 12:53232608-53232630 CCCCATTGCCTACCCTGGGGAGG - Intronic
1096868361 12:54578298-54578320 CCCCTTTTCCTCCCCTGGGAAGG + Exonic
1102050539 12:109858566-109858588 CTCCATTCCCTTCCTTGGGGTGG + Intronic
1102623022 12:114211767-114211789 GCTCATTTCCTACCCTGGGTTGG - Intergenic
1102772980 12:115494710-115494732 TACCATTGCCTACCATGCGGTGG - Intergenic
1102866585 12:116379701-116379723 CCCCATTTACTACCATGGGCTGG - Intergenic
1102943267 12:116962470-116962492 CCCCACTGTGTCCCCTGGGGGGG + Intronic
1103929249 12:124440427-124440449 CCCCATGGCCCACCCTGGCCGGG - Intronic
1104962229 12:132493708-132493730 CCCCTTTGTGTACCCTGGGTGGG + Intronic
1111564403 13:89995734-89995756 TCTCATTGCCTACCCTCAGGTGG + Intergenic
1117988207 14:61409126-61409148 CCGCATTGCCTCTCCTGGTGAGG + Intronic
1120179448 14:81328723-81328745 CCCCCTTGCCTCCCCAGGGAGGG - Intronic
1120966643 14:90173576-90173598 CCCCATTTCAAACCCTGGTGTGG - Intronic
1123995858 15:25717646-25717668 CCCCCTTGCTTACTCTGTGGTGG - Intronic
1127811874 15:62572194-62572216 CCCCTGTGCCTGCCCTTGGGAGG + Intronic
1131716791 15:95120491-95120513 GCTCAGTGCCTACCATGGGGAGG + Intergenic
1131800089 15:96059585-96059607 CTCCATTTCCAACCCTTGGGAGG + Intergenic
1131979159 15:97979094-97979116 ACCCATTGCCTCCCCTGGGCTGG + Intergenic
1132970098 16:2682960-2682982 CCCGATCCCCTACCCTGGGAGGG + Intronic
1132976167 16:2712170-2712192 CCCCAGTGCCAACCCTGGGGCGG + Intergenic
1135113998 16:19710766-19710788 CCCCTTGGCCTACACTGGGCAGG + Intronic
1137567620 16:49543337-49543359 CCCCACAGCCTCCCCAGGGGTGG + Intronic
1138346754 16:56324832-56324854 TCCCATTGCCTGTCCTGGGAAGG - Intronic
1138507910 16:57487191-57487213 GCCCAGTGCCTCCTCTGGGGAGG + Intronic
1141696819 16:85624167-85624189 CCTCAGTGCCCGCCCTGGGGTGG + Intronic
1141909753 16:87050557-87050579 CCCCATTGCCCAGGCTGGGCAGG + Intergenic
1142474120 17:179903-179925 CCCCATCGCCCCACCTGGGGAGG - Intronic
1143616273 17:8051890-8051912 CCCCATTGCCTATCCCTCGGAGG + Intergenic
1143723398 17:8828977-8828999 CACCAGTTCCTTCCCTGGGGTGG + Exonic
1145304980 17:21669025-21669047 CCCCATTGCATAGCATGGGCGGG - Intergenic
1146679358 17:34796039-34796061 CCCCACTGCCTAGACCGGGGAGG + Intergenic
1146907850 17:36629562-36629584 CCCCTTGGCCTACCCTAGGTCGG - Intergenic
1147167848 17:38602922-38602944 CCCCAAAACCTAACCTGGGGTGG + Intronic
1147543080 17:41377480-41377502 CTGCATGGCCTACCCTGGGTGGG + Intronic
1147882256 17:43661441-43661463 CCCCATTGCCTTCCGAGTGGGGG + Exonic
1149775463 17:59353546-59353568 CTTCCTTGCCTACCCCGGGGAGG + Intronic
1151310849 17:73291667-73291689 CCCCATAGCCTGCCTTGGGCGGG + Intronic
1152008723 17:77697749-77697771 CCACACTTCCTGCCCTGGGGTGG + Intergenic
1152559021 17:81068652-81068674 CCCGCTTCCCTGCCCTGGGGAGG + Intronic
1156272220 18:35546046-35546068 CACCACTGCCTTCCCTGGGTTGG - Intergenic
1157286933 18:46383197-46383219 ACCCACTGCCTCCCCTGGGTGGG - Intronic
1157584846 18:48794444-48794466 ACCCTTCGCCCACCCTGGGGAGG - Intronic
1160167692 18:76528772-76528794 CCCCATTTCCTGCCCAGGGCGGG + Intergenic
1160242035 18:77131784-77131806 CCCCACTGCCTGTCCTGGGCCGG - Intronic
1161165691 19:2785917-2785939 CCCCGTGGCGGACCCTGGGGAGG + Intronic
1161433370 19:4247323-4247345 CCCCATCGCCTTCCGTCGGGGGG + Intronic
1161508937 19:4659869-4659891 CCCGATTGCCCACCCTTGGATGG + Intronic
1161723247 19:5915056-5915078 CCCCACTGCGCACCTTGGGGTGG - Exonic
1161957374 19:7504102-7504124 CCCCCTTGCCTATCCTAAGGGGG + Exonic
1162927684 19:13938353-13938375 CCCCCTTCCCCGCCCTGGGGAGG + Exonic
1163281887 19:16323580-16323602 CCCCAGTGCCTACCCAGGGCTGG + Intergenic
1163617201 19:18336453-18336475 CCCCATCGCCCACCCTGCGAGGG + Intergenic
1163720168 19:18894979-18895001 CCCCACTCACTTCCCTGGGGAGG - Intronic
1165472418 19:36011041-36011063 CCCCATTGCCTTCCCCAGGTGGG - Exonic
1167302031 19:48683547-48683569 CCCCAGTTCCTCCCTTGGGGTGG - Intergenic
1168239868 19:55083653-55083675 CCCCTTGCCCTGCCCTGGGGCGG - Intronic
1168686032 19:58350232-58350254 CCCCATCGCCTACCCCGGCGGGG - Intronic
925806713 2:7658213-7658235 CCCCATTGCATGCCCTGTGAGGG - Intergenic
928055993 2:28055247-28055269 CACCAAGGCCTACCCTAGGGTGG + Intronic
928573096 2:32627987-32628009 CCCTATTGCCCGCCCCGGGGTGG + Intergenic
930968280 2:57359494-57359516 CACCAGAGCCTACACTGGGGTGG - Intergenic
933760518 2:85668847-85668869 CCCCAGCCCCTACCCTGGAGGGG - Intergenic
934817247 2:97338230-97338252 CCCCATGGCCTGCTCTGTGGAGG - Intergenic
934820449 2:97370254-97370276 CCCCATGGCCTGCTCTGTGGAGG + Intergenic
937289800 2:120775517-120775539 CCCCAGTGCCTGCCTCGGGGTGG + Intronic
940445931 2:153777639-153777661 CCCCATTGCACACCCTGCGAGGG - Intergenic
942947328 2:181684316-181684338 CCCAACTGCCTCCCCCGGGGCGG - Intergenic
947150677 2:227112071-227112093 CCCCCTTGACTACCCTAGAGTGG + Intronic
947711453 2:232318697-232318719 CTCACTTGCCTCCCCTGGGGTGG - Intronic
947826155 2:233107339-233107361 CCCCATTGGCTATCTTGGGTGGG + Intronic
947864719 2:233388412-233388434 CCCCAGTTCCTCCCCTGGGACGG - Intronic
948275942 2:236708748-236708770 TCCCATCGCCTCGCCTGGGGAGG + Intergenic
949006148 2:241649598-241649620 GCCCATTGCGTATTCTGGGGCGG - Intronic
1168954677 20:1826591-1826613 CCCCATTGCAGAGCCTGGTGCGG + Intergenic
1170300665 20:14881054-14881076 CTACATGGCCTACCCTGAGGAGG + Intronic
1170567013 20:17613226-17613248 GCCCACTGCCTGCCCTCGGGAGG - Intergenic
1171530244 20:25848459-25848481 CCCCATTGCATAGCATGGGTGGG - Intronic
1175539054 20:59736839-59736861 CCCCTCTGCCTTCCCTGGGGTGG - Intronic
1175746348 20:61459858-61459880 TCCCTTTTCCTGCCCTGGGGTGG - Intronic
1176241072 20:64076207-64076229 CCCCAGGGCCTAGCCTGGGCTGG + Intronic
1176656298 21:9591475-9591497 CCCCATTGCATAGCATGGGCGGG - Intergenic
1177814503 21:25961106-25961128 CCTGATTGTCTACCCTGGAGAGG + Intronic
1179105725 21:38398597-38398619 CACCCTTGCCTTCCCTGGGTTGG + Intronic
1179504695 21:41832776-41832798 CACCATTGCCTTCCACGGGGCGG - Intronic
1180589443 22:16923881-16923903 CCCCATGGCCTGCTCTGTGGAGG - Intergenic
1180930325 22:19586225-19586247 CCCCATCGCCTGCCCTGCGAGGG - Intergenic
1181040668 22:20191143-20191165 CCCCATTGCATGCCCTGCGAAGG + Intergenic
1181053086 22:20246823-20246845 CCCCAATGCCGCCCCTGGGCTGG + Intronic
1181451606 22:23026438-23026460 CCCCATTGCATGCCCTGAGAGGG - Intergenic
1181540800 22:23572276-23572298 CCCCATCTCCAACTCTGGGGAGG + Intergenic
1181952905 22:26567314-26567336 GCCCATTTCCTACCCTTGGAGGG - Intronic
1182278033 22:29202592-29202614 TCCCATGGCCTGCCCTGGGAGGG + Intergenic
1182426777 22:30277791-30277813 CCCCCTTGGCTTTCCTGGGGTGG - Intergenic
1183237313 22:36629309-36629331 ACCCAGTGCCTTCCCTGGGCAGG + Intronic
1185207422 22:49548078-49548100 CCGCATCACCTCCCCTGGGGTGG + Intronic
949321830 3:2820080-2820102 CCCCATTAACTACTCTGGGATGG + Intronic
950783149 3:15409683-15409705 CCACATTGTTTGCCCTGGGGGGG - Intronic
953386055 3:42506184-42506206 CCCCATTGCCTACCTAGGCCTGG - Intronic
953411122 3:42691012-42691034 CCCCCTTGCCTCCCCAGGGTGGG - Intronic
956002063 3:64740129-64740151 CCCCATTCCCTTCCCAAGGGTGG - Intergenic
957379134 3:79402361-79402383 CCCCATTGCATACTGTGAGGTGG + Intronic
962837467 3:139202204-139202226 GCTCATTTCCTACCCTGGGGTGG - Intronic
968521718 4:1037284-1037306 CCCCTTTGCCCTCCCTGGGCAGG - Intergenic
968599152 4:1500980-1501002 CCCCATTACCTTCCCGGGGTTGG - Intergenic
969209370 4:5674809-5674831 GCCCATTGTCCACGCTGGGGTGG - Intronic
969220080 4:5753540-5753562 CCCCAAGGCTGACCCTGGGGTGG + Intronic
969832361 4:9808054-9808076 CCCCATTGCCATCTCTGGGCTGG + Intronic
972408129 4:38765864-38765886 ACCCCTTGCCTACCCTTGTGTGG - Intergenic
972918492 4:43907509-43907531 CCCCATTGCATGCCCTGCGAGGG + Intergenic
976088548 4:81430631-81430653 CCCCATCGCATGCCCTGGGAGGG + Intronic
981317149 4:143350944-143350966 CCCCATTGCATGCCCTGCGAGGG - Intronic
982011211 4:151107906-151107928 CCTCTTTTTCTACCCTGGGGAGG - Intronic
985171045 4:187150481-187150503 CCCCACTTCCAACGCTGGGGGGG + Intergenic
985589787 5:758499-758521 ACCCATTGACTTCCCTGTGGAGG + Intronic
985732382 5:1556531-1556553 CCCCACTGCTGGCCCTGGGGAGG - Intergenic
987871136 5:23618263-23618285 CCCCTTGCCCTTCCCTGGGGTGG + Intergenic
988206863 5:28148359-28148381 CCACATTGCCTACCATAGAGAGG + Intergenic
992432411 5:76722197-76722219 CCCCATCCCCAGCCCTGGGGAGG + Intronic
992591103 5:78295905-78295927 CCCCACCGCCTTCCCTGGGGCGG - Intergenic
994484913 5:100379405-100379427 GCCCACTGCCTGCCCTGGGCTGG - Intergenic
995007983 5:107224814-107224836 GTCCATTGCCAACCCTGGTGGGG - Intergenic
997301260 5:132807372-132807394 CCCCTTTGCTTCCCCTGGGCTGG + Intergenic
997585824 5:135042712-135042734 ATCCCTTGCCCACCCTGGGGAGG - Intronic
998107432 5:139477323-139477345 CCTCATTGCCTACCAGGGTGAGG - Exonic
998153014 5:139768061-139768083 CCCCTTTGCCCTCCCTGGCGGGG - Intergenic
1001763120 5:174223787-174223809 CCCCATCACCTACTTTGGGGGGG + Intronic
1001986157 5:176075686-176075708 CCCCACAGTCTACCCTGGGAAGG + Intronic
1002230712 5:177762438-177762460 CCCCACAGTCTACCCTGGGAAGG - Intronic
1002264624 5:178021310-178021332 CCCCACAGTCTACCCTGGGAAGG + Intronic
1002782386 6:377356-377378 CCCCAAAGCCCACACTGGGGAGG + Intergenic
1002921307 6:1575277-1575299 CCCCAGTGCCTGCCCTGGCCAGG + Intergenic
1003181896 6:3799365-3799387 GCCCATGCCCTGCCCTGGGGTGG + Intergenic
1004340987 6:14807141-14807163 CCCTAGGGCCTACCCCGGGGGGG - Intergenic
1008816867 6:55579050-55579072 CCCCATGGCGGAGCCTGGGGCGG + Exonic
1011745872 6:90407296-90407318 CCCCACTGCCTCCCCTGCAGAGG + Intergenic
1012606870 6:101168286-101168308 CCCCATTGCATGCCCTGTGAGGG + Intergenic
1018182343 6:161235074-161235096 GCCCATTTCCTAGCCTGGTGTGG + Intronic
1018704134 6:166450521-166450543 CCCCATGGTGTTCCCTGGGGTGG - Intronic
1018704200 6:166450707-166450729 CCCCATGGTGTTCCCTGGGGTGG - Intronic
1019344384 7:522269-522291 CCTCATTGCAGCCCCTGGGGAGG + Intergenic
1019717060 7:2543957-2543979 CCCCATCCCCTACCCAGGTGCGG - Exonic
1019918745 7:4149784-4149806 CCCCATTGCCAGCCTTGGGAGGG - Intronic
1022386630 7:29905554-29905576 CCCAGTTGCCTGCCATGGGGTGG - Intronic
1025282982 7:57641702-57641724 CCCCATTGCATAGCATGGGAGGG - Intergenic
1026817006 7:73521518-73521540 CCCCATTACCTTCCCCGGGTTGG - Intronic
1028892037 7:95999198-95999220 CTGCATTGCTTACCCTGGTGTGG + Intronic
1031618277 7:123905870-123905892 CCCCACTACCTACCCTGTGCAGG - Intergenic
1034202634 7:149291988-149292010 TCCCAGTGGCTACCCTGGGAGGG - Intronic
1034225161 7:149475804-149475826 CCCCATTCCCTGCACTGTGGTGG - Intronic
1037765237 8:21768598-21768620 GCCCCTTGCCTTCCCTGGGTCGG - Intronic
1046714533 8:117553079-117553101 CACCATTGGCTACCCAGGGATGG - Intergenic
1047439281 8:124862079-124862101 CCTCATTGCCTGTGCTGGGGAGG - Intergenic
1048158283 8:131984556-131984578 CCACACTTCCTACACTGGGGGGG + Intronic
1048875145 8:138831331-138831353 CCTCATTCCCTACTCTGGGCAGG + Intronic
1049685209 8:143936682-143936704 CCCCGGTGCCTGCCCTGGGGAGG - Intronic
1050405459 9:5304311-5304333 TCCCATTGGTTACTCTGGGGCGG - Intronic
1050408761 9:5339477-5339499 TCCCATTGGTTACTCTGGGGCGG - Intronic
1050479357 9:6073747-6073769 CCCCATTGCATGCCCTGCGAGGG + Intergenic
1051461086 9:17316810-17316832 CCTTAGTGCTTACCCTGGGGGGG + Intronic
1054878395 9:70120462-70120484 TCCCCTTGCCTTCCCTGGAGAGG + Intronic
1056377512 9:86028808-86028830 CCCCATTGCATGCCCTGTGAAGG + Intronic
1056675523 9:88673588-88673610 CCCCATGGCCTATCCTGGCTGGG + Intergenic
1056994514 9:91443627-91443649 TCCCAGTGCCCACTCTGGGGTGG - Intergenic
1058584412 9:106491890-106491912 CCCCATTGCACACCCTGTGAGGG - Intergenic
1060877851 9:127096081-127096103 CCCCATCTGCTACCCTGGGGTGG - Intronic
1061919718 9:133776172-133776194 CCACATTGGCTGCCCTGGAGGGG + Intronic
1062033370 9:134372016-134372038 CCCCACTTCCCTCCCTGGGGAGG + Intronic
1062550489 9:137083878-137083900 CCCCATTGGTTTCCCAGGGGAGG + Exonic
1203634014 Un_KI270750v1:94957-94979 CCCCATTGCATAGCATGGGCGGG - Intergenic
1185942813 X:4340479-4340501 CCCCATTGCACACCCTGTGAGGG - Intergenic
1190074370 X:47305392-47305414 TCCCTTTGCCTTCCTTGGGGTGG + Intergenic
1190272682 X:48878622-48878644 TCCCTTTGCCTTCCTTGGGGTGG - Intergenic
1193358380 X:80550823-80550845 CCCCATTGCACACCCTGCAGAGG - Intergenic
1194211217 X:91072014-91072036 CCCCATTGCATGCCCTGTGAGGG - Intergenic
1196044610 X:111244651-111244673 CCCCTTTGCCTACCCTAAGATGG + Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1198271057 X:135056273-135056295 CCCCATTGCATGCCCTGCGAGGG + Intergenic