ID: 1096677554

View in Genome Browser
Species Human (GRCh38)
Location 12:53233767-53233789
Sequence CAGCTCTCAGCAGTGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 358}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096677542_1096677554 24 Left 1096677542 12:53233720-53233742 CCCCAGGTGGCCTAGCTGCTGTT 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG 0: 1
1: 0
2: 2
3: 36
4: 358
1096677540_1096677554 29 Left 1096677540 12:53233715-53233737 CCCGTCCCCAGGTGGCCTAGCTG 0: 1
1: 0
2: 1
3: 21
4: 354
Right 1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG 0: 1
1: 0
2: 2
3: 36
4: 358
1096677541_1096677554 28 Left 1096677541 12:53233716-53233738 CCGTCCCCAGGTGGCCTAGCTGC 0: 1
1: 0
2: 2
3: 27
4: 286
Right 1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG 0: 1
1: 0
2: 2
3: 36
4: 358
1096677544_1096677554 22 Left 1096677544 12:53233722-53233744 CCAGGTGGCCTAGCTGCTGTTGA 0: 1
1: 0
2: 3
3: 14
4: 218
Right 1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG 0: 1
1: 0
2: 2
3: 36
4: 358
1096677543_1096677554 23 Left 1096677543 12:53233721-53233743 CCCAGGTGGCCTAGCTGCTGTTG 0: 1
1: 0
2: 1
3: 13
4: 308
Right 1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG 0: 1
1: 0
2: 2
3: 36
4: 358
1096677545_1096677554 14 Left 1096677545 12:53233730-53233752 CCTAGCTGCTGTTGACTTTGCTT 0: 1
1: 0
2: 0
3: 16
4: 265
Right 1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG 0: 1
1: 0
2: 2
3: 36
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096677554 Original CRISPR CAGCTCTCAGCAGTGTGGGA GGG Intergenic
900183263 1:1321717-1321739 TGGCTGTCAGGAGTGTGGGAGGG - Intronic
900185392 1:1330959-1330981 GAGGTCTCAGCTGCGTGGGAGGG - Intergenic
901440179 1:9273022-9273044 CAGCTCCCAGCAGAAGGGGAGGG + Intergenic
901863244 1:12088052-12088074 CAGCACTCAGCTGTGTGGCCGGG + Intronic
903989073 1:27252540-27252562 CACATCTCAGCACTTTGGGAGGG + Intronic
904457584 1:30656884-30656906 CAGGTGACAGCAGTGTGTGACGG - Intergenic
905812920 1:40926153-40926175 CTGATCTCAGCAGTGGGTGAGGG + Intergenic
906789895 1:48650048-48650070 CAGTTCCCTGCAGTGTGAGAAGG - Intronic
906864182 1:49398230-49398252 CTGCCCTCAGCAATGTGGGCAGG + Intronic
906942084 1:50264331-50264353 CTGCTCTCATCAATGTGGGTGGG + Intergenic
907318836 1:53589961-53589983 CTGCTGTCAGTAGGGTGGGAAGG - Intronic
907656010 1:56342521-56342543 CAGGTCACAGCAGGGTGGCAGGG - Intergenic
910051871 1:82984365-82984387 CAGTTCTCAGCACTATGAGAAGG + Intergenic
910498955 1:87866378-87866400 CTGCCCTCACCAGTGTGGGCAGG - Intergenic
910507482 1:87966652-87966674 CAGCTATGGGCAGTGAGGGAAGG + Intergenic
912162998 1:107008917-107008939 CAGCTCCCATCAGTGTGGGTGGG - Intergenic
912620126 1:111147344-111147366 CAACTGAAAGCAGTGTGGGATGG + Intronic
912717605 1:111992920-111992942 CAGCTATAAGCAGTGAGGGTGGG - Intergenic
913134785 1:115877823-115877845 AAGATCTCAGCAATGTGTGATGG - Intergenic
913271691 1:117100373-117100395 CAGGATTCAGCAGAGTGGGAAGG - Intronic
915465582 1:156096002-156096024 GAGCCCTGGGCAGTGTGGGAAGG - Intronic
915795842 1:158732680-158732702 CAGTTCTCAGCAGCTTGGAAAGG - Intergenic
916372260 1:164111742-164111764 CATCTCTGTGCAGTGTTGGAAGG - Intergenic
919422644 1:197389902-197389924 CAGCACGCAGCAGGGTGGCAGGG - Intronic
919983105 1:202654682-202654704 CAGCACTATGGAGTGTGGGACGG + Intronic
920292830 1:204936038-204936060 CAGCTCTGGGGAGAGTGGGAGGG + Intronic
920648323 1:207819094-207819116 GAGCTCTCAGCAGAGTGGCCAGG - Intergenic
921573602 1:216807627-216807649 CAGATCTCAGCTGTGTTAGACGG + Intronic
922167476 1:223128129-223128151 GAGCTCCCAGCTGTGTGGGGAGG - Intronic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922894655 1:229090629-229090651 AAGCTCACAGCAGTTTTGGAAGG - Intergenic
922932934 1:229404106-229404128 CAGCTCTCATAAGGATGGGAAGG - Intergenic
1063461208 10:6216000-6216022 CAGCGCTAAGCAGTGTAGAATGG + Intronic
1064638570 10:17393006-17393028 CTGCCCTCACCAGTGTGGGTGGG + Intronic
1064732191 10:18343794-18343816 CAGCTATCAGCGGGCTGGGAGGG + Intronic
1067091026 10:43265994-43266016 CTGCTCTGAGCAGGGAGGGAGGG + Intronic
1067204621 10:44202205-44202227 CATCTCTCAGCACTGTTGCATGG - Intergenic
1067438330 10:46294283-46294305 CTGCCCTGACCAGTGTGGGAGGG + Intronic
1067831710 10:49614412-49614434 CACCACTCAGGAGTGTGGGCGGG - Exonic
1068183324 10:53551067-53551089 CATCTCCCAGAAGTGGGGGAGGG - Intergenic
1069214103 10:65797783-65797805 CAGCACTCAGCAGCCTGGAAAGG + Intergenic
1070583663 10:77744301-77744323 CACCTCCCAGCACTTTGGGAGGG - Intergenic
1071411401 10:85400308-85400330 CAGATCACAGGAGTGTGGGTTGG + Intergenic
1071457483 10:85861960-85861982 CAACTCTGTGCAGTGTGGAAAGG - Intronic
1072803715 10:98410871-98410893 TGGCTCTCAGCAGCCTGGGAAGG - Intronic
1074393138 10:113074547-113074569 CAGCCGTCAGCAGTGTGCCAAGG - Intronic
1075280209 10:121132475-121132497 CAGCTCTCACCAGTGGCTGATGG - Intergenic
1075823182 10:125331375-125331397 CAGGTATCAGCAGTGTGGAGGGG + Intergenic
1075978379 10:126716495-126716517 CAGCTGACAGTGGTGTGGGAGGG + Intergenic
1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG + Intronic
1076485983 10:130817455-130817477 GAGCTGACAGGAGTGTGGGAAGG + Intergenic
1076594977 10:131619677-131619699 CACCTCTGAGCAGGGTGGGGAGG + Intergenic
1076595204 10:131620791-131620813 CACCTCTGAGCAGGGTGGGGAGG - Intergenic
1077769295 11:5197688-5197710 CAGCTCTCCGGCGTATGGGAGGG + Intergenic
1077895850 11:6452674-6452696 CAGCACTCATCAGTATGAGAAGG + Intronic
1078537915 11:12189837-12189859 CAGCTCCCAGCAGGCTGTGAGGG + Intronic
1078910029 11:15722556-15722578 AAACTCTGAGCAGTGTGAGATGG + Intergenic
1078953833 11:16167159-16167181 CAGATATCAGCAGTGAGTGAGGG - Intronic
1079002649 11:16770719-16770741 CAGTTCTCAGCACCATGGGAAGG + Intergenic
1081538098 11:44010051-44010073 CACCTCTCAGCTGTGTGCAATGG + Intergenic
1083182516 11:60996358-60996380 CTGCTCCCATCAGTGTGGGTTGG + Intronic
1083300731 11:61738496-61738518 CAGCTCCCAGCTCTGTGTGATGG - Intronic
1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG + Intergenic
1086398371 11:86440666-86440688 CAAGTCTCGGCAGTGTGTGAAGG - Intergenic
1087082765 11:94187617-94187639 CTGCTCTCAGCACTGGGTGATGG - Intergenic
1087408560 11:97761434-97761456 CAGCTCTCCAAAGTGGGGGATGG - Intergenic
1087757780 11:102073385-102073407 CAGATGTCAGCAGTGGTGGAGGG + Intronic
1088180432 11:107103523-107103545 CAGCTCTGATGAGGGTGGGATGG - Intergenic
1088235879 11:107721990-107722012 CTGCTCTCACCAGTGTGGGTGGG - Intergenic
1090827590 11:130398712-130398734 GAGCTGTCAGCAGAGAGGGAGGG + Intergenic
1091662030 12:2391465-2391487 CAGCAGTCAGCAGGGTGGGAGGG + Intronic
1091978927 12:4850160-4850182 CTGGACTCAGCATTGTGGGAAGG + Intronic
1094033466 12:26040621-26040643 AAGATGTCAGCAGTGTGGCATGG - Intronic
1095140462 12:38656755-38656777 GAGCTCTCAGCAACGTGGAAAGG + Intronic
1096584946 12:52613943-52613965 CAGCTTCCATCTGTGTGGGATGG - Intronic
1096591061 12:52659506-52659528 GAGATCTTGGCAGTGTGGGAAGG + Intergenic
1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG + Intergenic
1097733030 12:63151023-63151045 CAGCTCTCAGCAGGGTGAGCTGG + Intergenic
1098234535 12:68406146-68406168 CAGATCACAGTACTGTGGGATGG - Intergenic
1098721459 12:73904086-73904108 CAGCACTCTGCAGTCTGAGATGG - Intergenic
1102328530 12:112010652-112010674 CAGCTGTCAGCAGGGAGGGTAGG + Intronic
1102536070 12:113582552-113582574 CAGCTCTGAGGAGAGTGGGAGGG + Intergenic
1103108847 12:118256297-118256319 CAGCTACCAGCAGTGTTGGAGGG - Intronic
1103207986 12:119145342-119145364 CAGCGCTCAGCAGTGTCCAACGG + Intronic
1103945769 12:124525585-124525607 CTGCTCTGGGCAGTGTGGGATGG - Intronic
1104374473 12:128251695-128251717 CAGCTCCCAGGAGAGTGGCAGGG - Intergenic
1104872100 12:132007223-132007245 GGGCTCTCAGCCGTGTGGGGTGG + Intronic
1105291208 13:19054894-19054916 CACCTCTCAGAGATGTGGGAGGG + Intergenic
1105393213 13:20001766-20001788 CAGCTATCAGCATTGAGGCAGGG + Intronic
1105563810 13:21522993-21523015 CTGTTCTCCGCAGTGTGGGTGGG + Intronic
1105893507 13:24699012-24699034 CAGCACCAAGCAGGGTGGGATGG + Intronic
1107017960 13:35723099-35723121 CAACTCTCAGCTGTGTGAGCTGG - Intergenic
1107445607 13:40467933-40467955 CTGCCCTCACCAGTGTGGGCAGG + Intergenic
1107719263 13:43230714-43230736 CAGCCCTGAGCGGTGGGGGAGGG - Intronic
1107942307 13:45385698-45385720 CAGCTCCCAGAACTGGGGGAAGG + Intergenic
1110563742 13:76937257-76937279 CCGCCCTCACCAATGTGGGAGGG + Intergenic
1112917812 13:104572747-104572769 CAGCTGTCAGCTGAGTGTGATGG + Intergenic
1113292085 13:108918550-108918572 CATCTCTCAGCAGAGAGGGAGGG + Intronic
1113338759 13:109401945-109401967 CCGCTGTCAGCAGTTTGGGAGGG + Intergenic
1119586476 14:75840548-75840570 CAGCCCTATTCAGTGTGGGAGGG + Intronic
1119923984 14:78473999-78474021 TAGCTCTCAACATTATGGGAGGG + Intronic
1120754209 14:88226858-88226880 GAGCACTCAGCAGTGAGAGATGG + Intronic
1122424268 14:101596602-101596624 CAGCTCCCTGCAGTGAGGCAGGG - Intergenic
1122931898 14:104936984-104937006 CAGCTGGAGGCAGTGTGGGATGG - Exonic
1124394724 15:29291144-29291166 CAGCTTTCCTCTGTGTGGGAAGG - Intronic
1124596930 15:31098898-31098920 AAGGTCTCAGCAGCGGGGGAGGG + Intronic
1124650628 15:31471140-31471162 TGGCTCTCAGCAATGTGGGTGGG - Intergenic
1124937031 15:34183201-34183223 CTCCTCTCAGCTGTGTGGGCTGG + Intronic
1127579565 15:60325212-60325234 CCGCTCTTAGCAGAGTGGGTAGG - Intergenic
1127780337 15:62307610-62307632 CATCTTTCAGGAGTGTTGGAAGG - Intergenic
1127886547 15:63206585-63206607 CAGGTCCCAGGAGAGTGGGAAGG - Intronic
1128259288 15:66221303-66221325 CAGGATTCAGGAGTGTGGGAGGG - Intronic
1128831294 15:70771828-70771850 CGGCCCTAAGCAGTGTGGTATGG + Intergenic
1129235658 15:74222362-74222384 GAGCTCAGAGCTGTGTGGGAGGG - Intergenic
1129743203 15:78000242-78000264 CAAGGCCCAGCAGTGTGGGAGGG + Intronic
1129842277 15:78751198-78751220 CAAGGCCCAGCAGTGTGGGAGGG - Intergenic
1130705930 15:86232872-86232894 CAGCCCTCAGCGAAGTGGGAAGG + Intronic
1131662445 15:94532355-94532377 CTGCCCTCTCCAGTGTGGGAGGG + Intergenic
1133261933 16:4556530-4556552 CAGCACCCCGCACTGTGGGATGG - Exonic
1133739841 16:8642887-8642909 AAGCTCTCAACAGTGTGTGCTGG - Intronic
1134094835 16:11412464-11412486 CAGGTCTCAGCAGTGAGGGAGGG - Intronic
1134176075 16:12007602-12007624 CAGCTATCAGCGGTGAGGAAGGG - Intronic
1136015659 16:27399160-27399182 CAGCTATCAGCACTGAGGCATGG + Intergenic
1136076420 16:27820401-27820423 CAGCTCTCGGCAGCCTGGCACGG - Intronic
1136566971 16:31076468-31076490 CCGTTGTCAGCAGTGTGGGCGGG + Exonic
1136922642 16:34345058-34345080 CAGCTCTCAGCAGTGGGATTAGG + Intergenic
1136981931 16:35066748-35066770 CAGCTCTCAGCAGTGGGATTAGG - Intergenic
1137546814 16:49410518-49410540 CAGCCCTGGTCAGTGTGGGAGGG + Intergenic
1137591606 16:49697141-49697163 CAGCCCTCACCAAGGTGGGATGG + Intronic
1137719054 16:50617059-50617081 CAGCTGTCAGCAGCTTGGGCTGG + Intronic
1139271697 16:65689824-65689846 CAGCCCTATTCAGTGTGGGAAGG + Intergenic
1139968849 16:70761300-70761322 CCACTCTCTGCAGTGTGGGCAGG + Intronic
1140224715 16:73067978-73068000 CAGCTCTCAGGAGCAAGGGAAGG + Intergenic
1140773356 16:78226813-78226835 CAGCCCTCAGCAGGTAGGGAAGG - Intronic
1142383546 16:89747826-89747848 CTGCTCTCTGTAGAGTGGGAGGG + Intronic
1142570832 17:872961-872983 CTGCTCTCCCCAGTGTGGGTGGG + Intronic
1143854625 17:9839524-9839546 GAGCCCACAGCAGTGAGGGATGG - Intronic
1144392027 17:14802547-14802569 CAGCACTGAGCAGTTTGGCATGG - Intergenic
1144738268 17:17566923-17566945 CTCCTCTCCTCAGTGTGGGAGGG + Intronic
1146254388 17:31381743-31381765 CAACTCTGAGTAGTGGGGGAGGG + Intronic
1146299328 17:31676109-31676131 CACCTCTCAGGAGGGAGGGAGGG + Intergenic
1146460335 17:33041119-33041141 CACCCCTCAGCTGTGTGGGCAGG - Intronic
1146552981 17:33798076-33798098 CAGCTTTCATCAGTGCCGGAGGG + Intronic
1147767228 17:42845115-42845137 CAGCTCTCAGCACCGGGCGACGG - Exonic
1147872687 17:43598646-43598668 CACCTCTCAGGAGTCTTGGAGGG + Intergenic
1147951812 17:44111681-44111703 CACCTCTCAACTCTGTGGGAGGG - Intronic
1148229014 17:45919560-45919582 CTGCGCCCAGCAGTGGGGGAAGG - Intronic
1148671326 17:49412679-49412701 CAGCTTTTAACAGTGTAGGAGGG - Intronic
1148681197 17:49474474-49474496 GAGCCCTGTGCAGTGTGGGAAGG - Intronic
1149584968 17:57780356-57780378 AGGCTCTCAGCAGTGGAGGATGG - Intergenic
1149990406 17:61380028-61380050 CAGCTCTCAGTGGTCGGGGATGG - Intronic
1150296051 17:64008080-64008102 TTGCCCTCAGCAGTGAGGGAAGG - Intronic
1150335685 17:64329044-64329066 CAGTTTCAAGCAGTGTGGGATGG - Intronic
1151160979 17:72165706-72165728 CAGGTCTGATCAGTATGGGAAGG - Intergenic
1151354652 17:73551194-73551216 CATCACCCAACAGTGTGGGAGGG - Intronic
1151595999 17:75078315-75078337 CAGCACTCAGCAGGGTGGAGGGG - Intergenic
1151682556 17:75629565-75629587 GGGCTCTCAGGAGTGTGGGAGGG + Intronic
1152325787 17:79635168-79635190 CAGATCTGAGCAGTGAGGCATGG + Intergenic
1152352401 17:79791074-79791096 CAGCTGTGACCGGTGTGGGAGGG - Intergenic
1152529223 17:80907323-80907345 CAGCTCCCAGCACTGAGGGCAGG + Intronic
1152734273 17:81989462-81989484 CAGGTGTCCGCAGAGTGGGACGG + Intronic
1155317955 18:24591067-24591089 CAGCTCGCACCTGTGTGGCAAGG - Intergenic
1156090379 18:33460863-33460885 TAACTCTCAGCTGTGTGGGTTGG - Intergenic
1156217133 18:35011139-35011161 CAGCACTCAGCACTCTGGAATGG - Intronic
1157000287 18:43514732-43514754 GAGCTCTCAGCAACGTGGGAAGG - Intergenic
1157971335 18:52272738-52272760 CAGCTCTCAGCCGGGTGCGGTGG - Intergenic
1158083755 18:53625936-53625958 CAGCTCTCAGCAGAGAAGGGAGG - Intergenic
1158118556 18:54024093-54024115 CAACTGTCTGCAGTCTGGGACGG - Intergenic
1159584281 18:70268502-70268524 CAGCTCTCCTCACTGTAGGAAGG + Intergenic
1159902776 18:74063618-74063640 CATCTCAGAGCAGTGGGGGAAGG - Intergenic
1160940591 19:1618837-1618859 CAGCGCTCAGCACTGGGGAAGGG - Intronic
1161171438 19:2814216-2814238 CATCTCTGAGCACTGTTGGAGGG - Exonic
1161766943 19:6213423-6213445 CAGGTCTCAGCAGCGTGTGGGGG + Intronic
1161785833 19:6325048-6325070 CAGAAGTCAGCAGTGTGGGAGGG - Intronic
1162248157 19:9420086-9420108 CAGCCATCAGCCCTGTGGGATGG - Exonic
1162336426 19:10063496-10063518 CAGAGCTCAGCAGTGAGGGCTGG + Intergenic
1164437161 19:28240555-28240577 CAGGTCTGAGGAGTGTTGGAAGG + Intergenic
1164498711 19:28793683-28793705 CCGCGCTCCGCAGCGTGGGAAGG + Intergenic
1164806697 19:31122552-31122574 CAGCACGCAGGAGTGTGGGGTGG + Intergenic
1164982211 19:32622610-32622632 CATCTCTTTGCAGTGTGTGAAGG - Exonic
1165026744 19:32968018-32968040 CATCTTTCAGGAGTGAGGGATGG + Intronic
1165820981 19:38675883-38675905 CAGCTCTCGCCTGTGTTGGAAGG + Intronic
1165894254 19:39131898-39131920 CACCTCTCAGGGCTGTGGGAGGG + Intronic
1166592359 19:44011131-44011153 CAGATGTGAGGAGTGTGGGAAGG + Exonic
1166619870 19:44287364-44287386 TACGTGTCAGCAGTGTGGGAAGG - Exonic
1166688689 19:44810402-44810424 CAGGTTTCAGGAATGTGGGAGGG - Intronic
1167289314 19:48615707-48615729 CAGCTCCAAGCAGTGTTGAAGGG + Intronic
925376551 2:3389815-3389837 CAGCTCTCAGCAGAGAGGGGAGG + Intronic
925759917 2:7174657-7174679 CAGCCCTCACCAATGTGGGCAGG + Intergenic
925770582 2:7278824-7278846 CCGCTCTCACCAATGCGGGAGGG + Intergenic
925825630 2:7846112-7846134 GAGAGGTCAGCAGTGTGGGAAGG + Intergenic
925912161 2:8581082-8581104 GGACTCTCAGCAGGGTGGGAGGG + Intergenic
926473017 2:13285058-13285080 CAGCTCTCAGCAGAGAGGGGAGG + Intergenic
927354004 2:22152303-22152325 CAGCTTACAGCAGGGTGGTAGGG + Intergenic
928222439 2:29415741-29415763 CTGCTCTCACCAATGTGGGCGGG + Intronic
928599795 2:32893396-32893418 TACCTCTCATCAGTGTGGGCAGG + Intergenic
928701518 2:33903645-33903667 AAGCTCACAGCGGTGTGGGGAGG + Intergenic
929193562 2:39162745-39162767 GAGCTCTCAGGAGTTTGGGGCGG + Intergenic
929238001 2:39626745-39626767 CAACTCTCAGCAAAGTGAGAGGG + Intergenic
931471321 2:62540440-62540462 CAGCTCTAAGCAGAGGTGGAAGG - Intergenic
932054686 2:68432411-68432433 CAGCTCTCAGCAGAGAGGGTAGG + Intergenic
932845177 2:75127935-75127957 CAGCTAACAGGAGTATGGGAGGG - Intronic
933383766 2:81583931-81583953 CAGCTCTCAGCAGAGAAGGTTGG - Intergenic
935220481 2:101008105-101008127 CTGCTCCCAGGAGTGTGGGGAGG - Exonic
935278045 2:101492637-101492659 CAGCTCTCAGCAGTTGGAGTTGG - Intergenic
935600453 2:104916940-104916962 CAGCTGTCACCAATGTGGGTGGG + Intergenic
936774625 2:115957844-115957866 CTGCTTTCATCAGTATGGGAAGG + Intergenic
936966005 2:118128128-118128150 CTGCTGTCCTCAGTGTGGGAGGG - Intergenic
936979362 2:118249934-118249956 CAGCCCAGAGCAGTCTGGGAAGG + Intergenic
937453613 2:122022838-122022860 CAGCTCTCTGCAGGGAGGGGTGG + Intergenic
938980006 2:136517356-136517378 CAGCTCTCTTCACTTTGGGAGGG - Intergenic
940638201 2:156322514-156322536 CAGTTCTCAGCTCTGAGGGAAGG - Intergenic
942851767 2:180495459-180495481 CAGCTCACAGCAGCGTGGTAGGG + Intergenic
942922994 2:181399467-181399489 CAGCCCTATCCAGTGTGGGAGGG + Intergenic
944755765 2:202760323-202760345 AAGGTCTCAGCAGCGTGGGAAGG + Intronic
945525784 2:210886615-210886637 CTGCTCTCAGCAGGCTGTGATGG - Intergenic
946145302 2:217726018-217726040 GAGCTCTCAGGTGTGGGGGAGGG - Intronic
946197394 2:218043231-218043253 CAGCTCTCAGGAGAGAGGGTAGG + Intronic
946197420 2:218043479-218043501 CAGCTCTCAGCAGAGAGAGTAGG + Intronic
946326549 2:218987396-218987418 CAGCGCTCAGCAGGGTAGGAAGG - Intergenic
947427064 2:229993468-229993490 CAGCCCTATTCAGTGTGGGATGG + Intronic
947740091 2:232480983-232481005 CAGAGCTCAGCAGGGTGGGCAGG + Intronic
948725818 2:239933275-239933297 CATCTCTGAGCAGTGTAAGAGGG - Intronic
948967131 2:241391559-241391581 GTGCTCTCAGAAGTGGGGGAAGG - Intronic
1169189810 20:3651382-3651404 CAGATCTGAGCAGTGAGGTATGG + Intergenic
1169417866 20:5433017-5433039 CTGCTCTCACCCGTGTGGGTGGG - Intergenic
1170776185 20:19376686-19376708 CAGCTCACAGCAGTGTTAAAGGG - Intronic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1171040600 20:21758962-21758984 CAGCTCTAATCAGTGTGGGAAGG - Intergenic
1172360732 20:34311327-34311349 CAGCTTTCAGCGGCGTGGGCGGG - Intronic
1172893781 20:38285318-38285340 CAGCCCTATCCAGTGTGGGAGGG + Intronic
1173573036 20:44090425-44090447 GAGCTCACAGCTCTGTGGGATGG - Intergenic
1173667520 20:44773570-44773592 CAGCGCTCAGCAGAGAGGGAGGG - Intronic
1174253016 20:49233519-49233541 CAGCTCTCTGCAAGGTGGTAGGG - Intronic
1174986822 20:55463460-55463482 CTGATCCCAGCAGTTTGGGAGGG - Intergenic
1175155683 20:56969800-56969822 CACCCCTCCGCAGTGTCGGAAGG + Intergenic
1175567472 20:59991834-59991856 CAGCTCTCAGGAATGCTGGAGGG + Intronic
1175850366 20:62087425-62087447 CTGGTCTCAGCAGGGTTGGATGG - Intergenic
1176115599 20:63430687-63430709 CTGCTCTCAGCAGTGGGGACAGG + Intronic
1177717045 21:24852412-24852434 CAACTCTAAGAAGTGTAGGAAGG - Intergenic
1178286700 21:31331535-31331557 CAGTCCTCAGGAGTGTGGTAGGG - Intronic
1178602162 21:34004077-34004099 GAGCCCTCAGCAGTGTGTGTAGG - Intergenic
1179994560 21:44967992-44968014 CAGCTCTCAGCAGGGGGCGGGGG - Intronic
1180094991 21:45552321-45552343 CAGCTCTCAGGAGTGTCCCAGGG + Intergenic
1180154702 21:45972335-45972357 CAGCTCCCTGCAGAGTGGCAAGG + Intergenic
1181331502 22:22095961-22095983 CCGCTCTGAGTGGTGTGGGATGG - Intergenic
1182469290 22:30537994-30538016 CAGCCCTGCTCAGTGTGGGAGGG - Intronic
1183483616 22:38077873-38077895 CAGCTCTGAGCAGTGGGGCTGGG + Intergenic
1184681101 22:46072412-46072434 CAACTCTTCGCAGGGTGGGACGG - Intronic
949098224 3:112203-112225 AAACTCTCAGCAGAGTGAGAGGG + Intergenic
949861982 3:8513956-8513978 CAGCTCTTAGCTGAGTGAGATGG - Intronic
949892173 3:8741646-8741668 TAGCTCTTAGCAGGGTGGGGAGG - Intronic
950164053 3:10780302-10780324 CAGCTCTTGGCTGTGTGGGTTGG - Intergenic
951264672 3:20552230-20552252 CAGCTCTCAGCTGAGAGGGGAGG + Intergenic
953787333 3:45921143-45921165 CAGAACTCAGCAGTGTTGGAGGG - Exonic
953884715 3:46708707-46708729 TAGCTCTCAGTGGTGTGGGAAGG + Intronic
954314287 3:49792816-49792838 GGGCCCTCAGCAGGGTGGGAAGG - Intronic
955038036 3:55288029-55288051 CAACTCTCAGTAGAATGGGATGG - Intergenic
955923903 3:63987036-63987058 GAGATCTCAGCAGTATGGAATGG + Intronic
956634055 3:71345717-71345739 CTGCTCTCAGCAGTGCTGAAAGG - Intronic
957621790 3:82603885-82603907 CATCTCTCGGCACTGTAGGAGGG + Intergenic
958001398 3:87753831-87753853 CAGCTCTCAGCACTGTGTGCAGG + Intergenic
958761854 3:98318901-98318923 TGGCTCTCCTCAGTGTGGGAGGG - Intergenic
959279160 3:104316279-104316301 CAGCTCTGGGCAGTGAGGGAGGG + Intergenic
961026291 3:123560858-123560880 CAGCCTTCAGCAGTGTGGCTGGG - Intronic
961333142 3:126154689-126154711 CAGATGTCATCAGGGTGGGAGGG - Intronic
962642596 3:137403117-137403139 CAACTCACAGCATTGTGGTAAGG + Intergenic
962677332 3:137766655-137766677 CAGATCTCAGCGGTCTGGGTCGG - Intergenic
964791777 3:160460006-160460028 CAGCTCTCAGCAGAGAGGGTTGG + Intronic
964999738 3:162938580-162938602 CAGATTACAGCAGTGTGGAATGG + Intergenic
965416481 3:168401105-168401127 CTGCCCTCAGCATTTTGGGAAGG - Intergenic
965683537 3:171276994-171277016 CACCTCTCAACAGTGTTGCATGG - Intronic
966878517 3:184336814-184336836 CAGGGGTCAGCACTGTGGGAAGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967523994 3:190471059-190471081 GATATCCCAGCAGTGTGGGAAGG - Intergenic
968923809 4:3536492-3536514 CAGCTCCCAGCATTCAGGGAGGG + Intergenic
969137879 4:5045071-5045093 CTACTCTCAGCAGAGTTGGAGGG + Intergenic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
969711006 4:8843710-8843732 CTACTTTCAGCAGTGTGTGAGGG - Intergenic
971479296 4:27099876-27099898 CAGCTTGCAGCAGTGTGTTATGG - Intergenic
973755923 4:54073339-54073361 CACCTCTATTCAGTGTGGGAGGG - Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976795803 4:88931117-88931139 CAGCTCACAGCAGGGTGGCAGGG + Intronic
977089463 4:92652209-92652231 CTGCCCTCACCAGTGTGGGCAGG - Intronic
980531357 4:134060150-134060172 CAGCTCTCACCAGAGGGGAATGG + Intergenic
980906131 4:138950370-138950392 CAGCTCTCTGCAGGGTGTTAGGG + Intergenic
981015091 4:139965922-139965944 CAGCTCACAGGATTGGGGGAAGG + Intronic
981310298 4:143291448-143291470 TAGCTTTCAGCAGTGTTGTAAGG - Intergenic
983702982 4:170621922-170621944 CTGCTCTCACCATTGTGGGCTGG - Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
985696524 5:1344117-1344139 TAGTTCTCAGCAGAGTGTGATGG - Intronic
985805391 5:2039277-2039299 AAGCTCCCTGCACTGTGGGAAGG - Intergenic
986786969 5:11123467-11123489 CAGTCCTGAGCATTGTGGGATGG - Intronic
987402447 5:17491948-17491970 CAGCTCTCAGGTCTGTGGGTCGG + Intergenic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
989279134 5:39621579-39621601 CAGCTCTCAGCAGAGAGGGCAGG + Intergenic
989329379 5:40238445-40238467 ATGCTCTAAGCAGAGTGGGAAGG - Intergenic
991215439 5:64153947-64153969 AGACTCTCAGCAATGTGGGAAGG + Intergenic
991944333 5:71884913-71884935 CAGCCCTGTTCAGTGTGGGAGGG - Intergenic
993181844 5:84563158-84563180 CGACTCTCAGCAATGTAGGAAGG - Intergenic
993812118 5:92493657-92493679 CACCTGCTAGCAGTGTGGGAGGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
995833592 5:116378891-116378913 CAGTTCTCAGAAGTGGGGGTGGG + Intronic
996873328 5:128215822-128215844 CATCTCTCAGCAGAGGCGGAGGG + Intergenic
997405414 5:133642419-133642441 CAGCTCACAGAAGTGTTGGAGGG - Intergenic
997533557 5:134598058-134598080 CAGCTCCCAGCAGAGTTGAAAGG - Intergenic
1000320082 5:160127539-160127561 TGGCCCTCAGCAGTGTGGGTGGG + Intergenic
1000512982 5:162206680-162206702 CAGCTCTGAGCAGGGAGGTAAGG + Intergenic
1001235296 5:170024187-170024209 CACCTCGCAGCAGTGGGGTAAGG + Intronic
1001324927 5:170716260-170716282 CAGCTCACATTAGTGAGGGATGG + Intronic
1001832739 5:174803232-174803254 CTGCCCTCACCAGTGTGGGGGGG + Intergenic
1005885073 6:30091406-30091428 CAGTTCACAGCACTGTTGGATGG - Intergenic
1006318003 6:33301902-33301924 CAGCACTCAGCAGTGTCTGGAGG - Intronic
1006505507 6:34486273-34486295 CAGCTGTCAGCTGAGAGGGAGGG + Intronic
1006803862 6:36776408-36776430 CAGCTCTGAGGTGTGTGGGGAGG - Intronic
1006940505 6:37748908-37748930 CAGCCCTCATCAGTGATGGATGG + Intergenic
1007126699 6:39431779-39431801 CAGCGCCCAGCAGTGAGGGTTGG - Intronic
1007278192 6:40690986-40691008 GAGCTCTCAACCGTGTGGGTTGG + Intergenic
1008851179 6:56024061-56024083 CTCCACTCAGCAATGTGGGAAGG - Intergenic
1013020954 6:106217582-106217604 CAGGTCACAGCAGTGTGGGTGGG - Intronic
1013184020 6:107741648-107741670 TATATCCCAGCAGTGTGGGAAGG - Intronic
1013392947 6:109704975-109704997 CATCTATCAGGAGTGGGGGAGGG + Intronic
1015905039 6:138107792-138107814 GAGTTTTCAGCAGTGTGAGATGG + Intergenic
1015946891 6:138511991-138512013 CAGCTCTCAGAAGAGTCAGATGG + Intronic
1017743416 6:157426690-157426712 CAGCGGTCAGGTGTGTGGGAGGG + Intronic
1017988147 6:159462715-159462737 AACCTCTCAGCAGGGTGGGTTGG + Intergenic
1018220333 6:161571799-161571821 CCACTCTCAGCAATGTGGGCAGG + Intronic
1019131328 6:169879051-169879073 CATATCCCAGCAGTGTGGGAAGG + Intergenic
1021340593 7:19458456-19458478 CAGCCCACAGCAGGGTGGCAGGG + Intergenic
1021411057 7:20330667-20330689 CAGCTCGGAGCAGCGTGGGCGGG - Intergenic
1021861374 7:24909395-24909417 CAGCTCTCAGGAATGGGGAAAGG - Intronic
1021940706 7:25676265-25676287 CAGCTCTCAGCAGTGTGTCCAGG + Intergenic
1022966431 7:35477721-35477743 CATAACGCAGCAGTGTGGGAAGG - Intergenic
1024418410 7:49134969-49134991 CTGCTCTCATCAGTGTGCTATGG - Intergenic
1025818731 7:64944065-64944087 CACTTCTCAGGAGTGTGTGAGGG - Intergenic
1026978433 7:74512819-74512841 CAGCGCTGAGCACTGTGGGAAGG - Exonic
1028742497 7:94291831-94291853 AATCTCACAGCAGTTTGGGAAGG + Intergenic
1031138822 7:117918835-117918857 CTGCTCCCACCAGTGTGGGCAGG - Intergenic
1031942505 7:127803836-127803858 TACCTCTCATCAGTTTGGGAAGG - Intronic
1036212737 8:6855307-6855329 CCTCTCTCAGCATTGTGAGATGG - Intergenic
1036624889 8:10462005-10462027 CAGCCCTCATCAATGTGGGTGGG + Intergenic
1036784460 8:11676968-11676990 CTGTTCTCAGCCGGGTGGGAGGG - Intronic
1037559735 8:20062152-20062174 CTGGGCTCAGGAGTGTGGGAGGG - Intergenic
1037570601 8:20154834-20154856 CAGCGCTCAGCCGTGGTGGACGG - Intronic
1037802790 8:22044335-22044357 CAGCTGTCTGCAGTGGTGGAAGG + Intronic
1038712167 8:29957615-29957637 CAGTTCTCAGCAGTGCTGTATGG - Intergenic
1040625793 8:49148673-49148695 CAGCTCTCAGAAATTTGGAAAGG - Intergenic
1040955277 8:52973792-52973814 CTGCCATCACCAGTGTGGGATGG + Intergenic
1041331281 8:56728448-56728470 CAACCCTCATCATTGTGGGATGG + Intergenic
1042364303 8:67918854-67918876 CCACTCTCGCCAGTGTGGGAGGG + Intergenic
1042840769 8:73121237-73121259 CAACCCTAAGCAGTGTGGGGAGG + Intronic
1044532329 8:93321451-93321473 TATCTCTCACCAGTGAGGGAAGG - Intergenic
1045108566 8:98917874-98917896 CATCTCTGGGGAGTGTGGGAGGG + Intronic
1046003278 8:108446836-108446858 CAGCACTCAAGAGTGTGGCAGGG + Intronic
1046886013 8:119367951-119367973 CAGCTCTCAGCAAAGCGAGAAGG - Intergenic
1048766285 8:137847945-137847967 AAGCTCTCAGCAGAGTGTGAGGG - Intergenic
1049211485 8:141388502-141388524 CAGCCCTCCGCAGTGTGGCAGGG - Intergenic
1049348539 8:142151966-142151988 CAGCTCACAGCCGTGGGCGAGGG - Intergenic
1049461116 8:142728282-142728304 CAGCTCTAAGCTGTGTGAAAGGG - Intronic
1049592003 8:143466843-143466865 CAGCTCTGAGCAGGCTGGGAAGG - Intronic
1050104724 9:2153417-2153439 CAGCTCTCAGGAGGGTGAGGTGG + Intronic
1052303220 9:26976105-26976127 AAGCTCTCAGCAATGGGGAAAGG - Intronic
1052993507 9:34536799-34536821 CAGTCCTCCGCAGTGGGGGAAGG + Intergenic
1053799521 9:41755515-41755537 CAGCTCCCAGCATTCAGGGAGGG + Intergenic
1054145694 9:61559482-61559504 CAGCTCCCAGCATTCAGGGAGGG - Intergenic
1054187931 9:61967576-61967598 CAGCTCCCAGCATTCAGGGAGGG + Intergenic
1054465434 9:65490586-65490608 CAGCTCCCAGCATTCAGGGAGGG - Intergenic
1054650584 9:67621005-67621027 CAGCTCCCAGCATTCAGGGAGGG - Intergenic
1056462912 9:86825435-86825457 CTGTCCTCACCAGTGTGGGAAGG - Intergenic
1056673014 9:88647577-88647599 CAGGTCTCAGCAGTGAGTAAGGG + Intergenic
1057270420 9:93647273-93647295 CAGCTCTCAGAGCTGTGGAAGGG - Intronic
1060196213 9:121625184-121625206 CAGCTCCCAGCTGTGTGACAGGG - Intronic
1060211217 9:121711756-121711778 CAGCTCTCCTGTGTGTGGGATGG + Intronic
1060477050 9:123994661-123994683 CAGTCCTCAGCAGTCTGGGCAGG - Intergenic
1060972691 9:127747905-127747927 CTGCTCTAAGCTTTGTGGGAGGG - Intronic
1061048111 9:128178310-128178332 CAGAGCCCAGCAGGGTGGGATGG - Intronic
1061290789 9:129649340-129649362 CAGCCCAGAGCAGGGTGGGAAGG + Intergenic
1061502293 9:131010839-131010861 CAGCTCCCTGCAGTGGGGGCAGG - Intronic
1061745077 9:132733690-132733712 TAGCTCTCAGCAGCGTGGCCTGG - Intronic
1062020067 9:134315198-134315220 CGGCCCCCAGCAGTGTGGGGAGG + Intergenic
1062339656 9:136088312-136088334 CTGTACTCAGCAGGGTGGGAGGG + Intronic
1062554881 9:137109476-137109498 CAGCTCCCAGCAGCCTGGCATGG + Intergenic
1062615919 9:137395629-137395651 CAGCTTTCAGCAGGGAGGGCAGG + Intronic
1186207502 X:7215853-7215875 CAGCTAACAGCAGTGTGGACAGG - Intergenic
1186275076 X:7929530-7929552 CAGCTCTCAGCTGGGTGAGGTGG + Intergenic
1187238198 X:17487909-17487931 CTGCTCTCTGCAGTGTGGTGGGG + Intronic
1187409711 X:19039733-19039755 CAGCACTCACCAGAATGGGAAGG - Intronic
1192667463 X:73102544-73102566 CATCTCTCAGCACTGGGGGAAGG - Intergenic
1192759459 X:74081095-74081117 CATCTCTGGGCACTGTGGGAGGG - Intergenic
1193226323 X:78988530-78988552 CTGCTCTCATCAATGTGGGTGGG - Intergenic
1196683858 X:118495051-118495073 CAGCTCTCCCCCGTGGGGGACGG + Intergenic
1196735931 X:118981151-118981173 CAGCTCTCAGTGGTGTGAGCTGG + Intronic
1198509110 X:137331333-137331355 CTGCTCTCACCAATGTGGGTGGG + Intergenic
1198742061 X:139852437-139852459 AAGCTCTCAGCAATGCGGGGGGG + Intronic
1199152432 X:144503460-144503482 CAGCCCTCTACAGTGTGAGAAGG - Intergenic
1200016152 X:153165130-153165152 CAGCACTAATCAGTTTGGGAAGG - Intergenic
1201712182 Y:17004716-17004738 ATTCTATCAGCAGTGTGGGAAGG + Intergenic