ID: 1096678823

View in Genome Browser
Species Human (GRCh38)
Location 12:53241633-53241655
Sequence CAGTGTGAACAAAGGACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096678814_1096678823 23 Left 1096678814 12:53241587-53241609 CCTCGCCAGGTGAAGAAGGGAGC No data
Right 1096678823 12:53241633-53241655 CAGTGTGAACAAAGGACTGGAGG No data
1096678817_1096678823 18 Left 1096678817 12:53241592-53241614 CCAGGTGAAGAAGGGAGCAGGGG No data
Right 1096678823 12:53241633-53241655 CAGTGTGAACAAAGGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096678823 Original CRISPR CAGTGTGAACAAAGGACTGG AGG Intergenic
No off target data available for this crispr