ID: 1096684286

View in Genome Browser
Species Human (GRCh38)
Location 12:53277592-53277614
Sequence CCTCACCAGCATCTGCAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 355}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096684286_1096684291 -7 Left 1096684286 12:53277592-53277614 CCTGGCTGCAGATGCTGGTGAGG 0: 1
1: 0
2: 4
3: 33
4: 355
Right 1096684291 12:53277608-53277630 GGTGAGGGGTAAATGGAGTGTGG 0: 1
1: 0
2: 4
3: 33
4: 416
1096684286_1096684295 24 Left 1096684286 12:53277592-53277614 CCTGGCTGCAGATGCTGGTGAGG 0: 1
1: 0
2: 4
3: 33
4: 355
Right 1096684295 12:53277639-53277661 TCTCCATGGCTTCCTAAGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 149
1096684286_1096684294 10 Left 1096684286 12:53277592-53277614 CCTGGCTGCAGATGCTGGTGAGG 0: 1
1: 0
2: 4
3: 33
4: 355
Right 1096684294 12:53277625-53277647 GTGTGGCATGGGCATCTCCATGG 0: 1
1: 0
2: 0
3: 19
4: 188
1096684286_1096684293 -1 Left 1096684286 12:53277592-53277614 CCTGGCTGCAGATGCTGGTGAGG 0: 1
1: 0
2: 4
3: 33
4: 355
Right 1096684293 12:53277614-53277636 GGGTAAATGGAGTGTGGCATGGG 0: 1
1: 0
2: 1
3: 19
4: 169
1096684286_1096684292 -2 Left 1096684286 12:53277592-53277614 CCTGGCTGCAGATGCTGGTGAGG 0: 1
1: 0
2: 4
3: 33
4: 355
Right 1096684292 12:53277613-53277635 GGGGTAAATGGAGTGTGGCATGG 0: 1
1: 0
2: 0
3: 19
4: 242
1096684286_1096684297 30 Left 1096684286 12:53277592-53277614 CCTGGCTGCAGATGCTGGTGAGG 0: 1
1: 0
2: 4
3: 33
4: 355
Right 1096684297 12:53277645-53277667 TGGCTTCCTAAGAGTGGAACAGG 0: 1
1: 0
2: 1
3: 19
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096684286 Original CRISPR CCTCACCAGCATCTGCAGCC AGG (reversed) Exonic
900326169 1:2109744-2109766 CCTCACCTGCCTCTACAGGCTGG - Intronic
900551318 1:3257370-3257392 CCACACCAGCAGCTGGTGCCCGG - Intronic
900603415 1:3512993-3513015 CCACACCATCCTCTGCAGCATGG - Intronic
900945919 1:5831395-5831417 CCTCACCAGCTCCAGGAGCCAGG - Intergenic
901138162 1:7010939-7010961 CCTCACCAGCACCTGCACCTGGG - Intronic
902234322 1:15047961-15047983 CAGCACCAGCAGCTACAGCCAGG - Intronic
902260980 1:15224700-15224722 CCACACCAGAATATGCAGCATGG - Intergenic
902518890 1:17004817-17004839 CCTCACCTGCTTCCCCAGCCTGG - Exonic
902556033 1:17247348-17247370 GCTCCCCAGCATCTCCAGCTGGG - Intergenic
903835763 1:26202391-26202413 TCTCACCAGCTTCCCCAGCCAGG - Intronic
904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG + Exonic
904659273 1:32072788-32072810 CTTCACCAGCAGCTGCAGGAAGG + Intronic
906113552 1:43340110-43340132 ACTCACCTGCATCTCCAGGCAGG - Exonic
906248385 1:44293063-44293085 GCTCACCCCCATCTGAAGCCTGG - Intronic
906315696 1:44785199-44785221 CCTCAGAAGCTTCTGAAGCCAGG - Exonic
907777928 1:57536910-57536932 CATCCCCAGCATCTGGTGCCAGG - Intronic
909466575 1:75980128-75980150 CCTCATCAGCAGCTGCTGCTTGG - Intergenic
911059877 1:93738672-93738694 CCCCACCAGCATCTCCCACCAGG - Intronic
915168581 1:153962577-153962599 GCTCACCCTCCTCTGCAGCCTGG - Exonic
916166135 1:161968851-161968873 CCACCCCAACATCAGCAGCCAGG - Intergenic
916528857 1:165636840-165636862 CCTCAAAACCATCTCCAGCCAGG - Intronic
916809857 1:168295911-168295933 ACTGTCCAGCACCTGCAGCCAGG - Intronic
917744749 1:177996539-177996561 CATCACCAGCTTCTCCAACCTGG + Intergenic
917789445 1:178490172-178490194 CATCATCGGCACCTGCAGCCAGG + Intergenic
919787424 1:201268702-201268724 CCTCAGCAGCAGCTGCTGCAGGG + Intergenic
920600780 1:207321821-207321843 CAGCACCAGCAGCAGCAGCCGGG - Exonic
920651981 1:207844570-207844592 CCTCACCACCATCTGTCTCCAGG - Intergenic
920950326 1:210566519-210566541 CCTCATCTGCTTCTGGAGCCTGG - Intronic
922575559 1:226658855-226658877 CCTTACCAGCCCCTGCAGACCGG + Intronic
922785948 1:228282296-228282318 CCCCACCAGCTTCTGTAGCCAGG - Intronic
924117307 1:240761146-240761168 CCACACCAGTCACTGCAGCCTGG + Intergenic
1062793738 10:326433-326455 CCTCACCAGCACCTGCTGAGAGG + Intronic
1063278467 10:4597819-4597841 CCACACCAGATTCTGTAGCCTGG - Intergenic
1064011964 10:11742654-11742676 CCCCGCCCGCTTCTGCAGCCGGG + Exonic
1064791125 10:18958964-18958986 CCACTCCAACATTTGCAGCCTGG + Intergenic
1066259051 10:33711265-33711287 CCTCAACAGCAACTGCACACAGG + Intergenic
1066287535 10:33982663-33982685 GCTCATCAGCTTCTGGAGCCTGG + Intergenic
1067432042 10:46251339-46251361 CCACACCTGCATCCGGAGCCTGG + Intergenic
1067945786 10:50687164-50687186 CCCCACCAGCCTCTGCTGCTGGG - Intergenic
1068656064 10:59577578-59577600 CCTCATCTGCTTCTGGAGCCTGG + Intergenic
1069438518 10:68407264-68407286 CCACCACCGCATCTGCAGCCAGG + Intronic
1069556226 10:69400315-69400337 CACCACAAGCATCTTCAGCCTGG + Intronic
1069705254 10:70455464-70455486 CCTCACCTGCCTTTGAAGCCTGG - Intergenic
1069894574 10:71672567-71672589 CCTGATCAGCATCCGCAGCCTGG + Intronic
1069908638 10:71746778-71746800 CCTCACCAGCCTGAGAAGCCAGG - Intronic
1070867302 10:79714037-79714059 CCCCACCAGCCTCTGCTGCTGGG - Intronic
1070881094 10:79852161-79852183 CCCCACCAGCCTCTGCTGCTGGG - Intergenic
1071242565 10:83724225-83724247 GCTCACCTGGCTCTGCAGCCAGG - Intergenic
1071471093 10:85984492-85984514 GCTCCCCAGCACCTGCAGGCAGG + Intronic
1071562442 10:86654879-86654901 CCAGAGCAGCATCTCCAGCCTGG + Exonic
1071634217 10:87236260-87236282 CCCCACCAGCCTCTGCTGCTGGG - Intronic
1071647667 10:87368477-87368499 CCCCACCAGCCTCTGCTGCTGGG - Intronic
1072621164 10:97080365-97080387 CCTCACTAGCATCCCCAGCGGGG + Intronic
1072835875 10:98711251-98711273 TCTCACCAGGCTCTACAGCCAGG - Intronic
1073512272 10:104050237-104050259 CCTCACCAACATCCGCTGACAGG - Intronic
1074086188 10:110210187-110210209 CTTCACCAGCCTCTGGAGCCCGG - Intronic
1074468493 10:113705760-113705782 CCTGACCATCATCTCCACCCTGG - Intronic
1075200254 10:120396384-120396406 CTTCACCAGCAGCAGCAGCATGG - Intergenic
1075619081 10:123912478-123912500 CCACCCCTGCATCTGCAGACTGG + Intronic
1076361812 10:129894917-129894939 ACTCACCCACATCTGCAGACAGG - Intronic
1077021647 11:419704-419726 GGTCTCCAGCACCTGCAGCCAGG + Exonic
1077074095 11:692219-692241 CTTCAGCAGCATCTGCACACAGG + Intronic
1077422302 11:2458508-2458530 CCTCACCAGGAGCTGGAGCCTGG - Intronic
1077494802 11:2881781-2881803 CCACAGCTGCATCTGCTGCCAGG - Intergenic
1077890926 11:6418111-6418133 CCTCACCAGCATCTAAAGAGAGG + Intronic
1078087808 11:8244693-8244715 CCTCTCAGGCATCTGCAGGCTGG + Intronic
1078426088 11:11252599-11252621 CATCACCAGCAGGTGCAGACGGG - Intergenic
1078427250 11:11261871-11261893 CCCTACCTGCATCTGCAGCTGGG - Intergenic
1078801094 11:14644392-14644414 GCTCAGCAGCGTCCGCAGCCAGG - Exonic
1078830070 11:14970124-14970146 CCTCCCCAGGATAAGCAGCCAGG + Intronic
1078840938 11:15074990-15075012 CCTCCCCAGGATAGGCAGCCAGG - Intronic
1081609980 11:44556070-44556092 CCTCACCTGGCCCTGCAGCCAGG + Intergenic
1082176523 11:49066385-49066407 CTTCTCCAGAATCTGCAGCATGG + Intergenic
1082988553 11:59187813-59187835 TCTCCCCAGCAACTCCAGCCAGG - Intronic
1083408454 11:62474907-62474929 CCTCACCAGCCTCTGAGGTCAGG - Intronic
1084275102 11:68047375-68047397 ACACACCAGCATCTGCCTCCCGG - Intronic
1084483117 11:69433412-69433434 CCTCACCCCCATCAGCACCCCGG - Intergenic
1084630665 11:70346553-70346575 CCTCTGCAGCATCTGTTGCCAGG + Intronic
1084709082 11:70832841-70832863 CCCCACGAGCAGGTGCAGCCAGG + Intronic
1084948252 11:72650602-72650624 CCCCTCCAGGTTCTGCAGCCTGG - Intronic
1085735480 11:79035199-79035221 CCTCCCCAGCCTCTGCTGCTCGG + Intronic
1086312406 11:85549388-85549410 TCTCACCAGGAGCTGCAGACCGG + Intronic
1087670127 11:101096582-101096604 CTTCACCTGCATATACAGCCAGG - Intronic
1087933684 11:104006620-104006642 CCTCATCTGCTTCTGGAGCCTGG - Intronic
1089163490 11:116457475-116457497 CCTCACCAGCTTCTGGAGGCTGG + Intergenic
1090136492 11:124204472-124204494 CACCCCCAGCAGCTGCAGCCTGG - Intergenic
1091215152 11:133896827-133896849 GATCACCATCATCAGCAGCCAGG + Intergenic
1093027834 12:14260724-14260746 CCGCACCCGCAAATGCAGCCAGG + Intergenic
1094783334 12:33818251-33818273 CCTCACCACCCACTGCTGCCAGG - Intergenic
1094829137 12:34291882-34291904 CCTCCCCAGCATCCCCTGCCTGG - Intergenic
1095945157 12:47749525-47749547 GGTCACCAGCCCCTGCAGCCAGG + Exonic
1096223525 12:49848363-49848385 CTTCTCCCTCATCTGCAGCCAGG - Intergenic
1096649352 12:53054261-53054283 CCTCCCCAGGAGCTTCAGCCTGG + Exonic
1096684286 12:53277592-53277614 CCTCACCAGCATCTGCAGCCAGG - Exonic
1099238463 12:80110900-80110922 CCTCTCCAGCATCTGTTTCCAGG + Intergenic
1099883930 12:88503625-88503647 CCGCAACAGTATCTGCAGCAAGG + Intronic
1102929686 12:116852639-116852661 CTTCAACAGCATCTGCAGGCAGG - Intronic
1103018320 12:117513489-117513511 CCACCCCAGCATCTGCCGCTGGG + Intronic
1103715769 12:122944593-122944615 CCTCACCTCCCCCTGCAGCCTGG - Intronic
1105202551 13:18192551-18192573 CCTCACCAACATCTGCAGAATGG - Intergenic
1105605950 13:21926677-21926699 TCTCACCAGCACCCCCAGCCAGG - Intergenic
1106704418 13:32265446-32265468 CCTCACGAACAGCTTCAGCCTGG - Exonic
1107401174 13:40070770-40070792 CACCACCAGCCTCCGCAGCCTGG + Intergenic
1107471110 13:40692104-40692126 TCTCAACAGCAATTGCAGCCTGG + Intergenic
1109183973 13:59247418-59247440 CCTTTGCAGCCTCTGCAGCCTGG - Intergenic
1109541436 13:63782845-63782867 TCTCACCAGGAGCTGCAGACTGG + Intergenic
1110137880 13:72090699-72090721 ATACACCAGCATCTGCACCCAGG + Intergenic
1111397099 13:87677819-87677841 CCGCAGCTGCAGCTGCAGCCCGG + Exonic
1111716729 13:91887743-91887765 CCTCATCTCCATCTCCAGCCTGG + Intronic
1112793633 13:103030265-103030287 CCTCTCCAGCCTGTGCTGCCTGG + Intergenic
1113482271 13:110629960-110629982 GCTCAACAGCATCAGCTGCCAGG - Intronic
1118893315 14:69926484-69926506 CCTCTCCTGCATCTGCCGCCTGG - Intronic
1119659730 14:76441709-76441731 TATCACCAGCACCTACAGCCTGG - Intronic
1120685340 14:87530942-87530964 CCTCATCTGCTTCTGGAGCCTGG - Intergenic
1120713292 14:87815349-87815371 GCTCATCTGCTTCTGCAGCCTGG - Intergenic
1120735146 14:88044424-88044446 CATCACCAGCATCTGGGGCTTGG + Intergenic
1121666495 14:95676453-95676475 CCTCATCTGCTTCTGGAGCCTGG - Intergenic
1122136490 14:99635785-99635807 CATCACCAGCCTCTGGAGGCAGG + Intergenic
1122663896 14:103315900-103315922 CCTCTCCTTCATCTGCATCCAGG + Intergenic
1124841276 15:33244384-33244406 AGTAACCACCATCTGCAGCCTGG - Intergenic
1125373197 15:39000242-39000264 TCTCACCATCATCTCCAGCCAGG + Intergenic
1125482840 15:40092499-40092521 CCTCCCCAGCATCTCCAGCTCGG + Intronic
1126297379 15:47155424-47155446 CCTCCACAGAATTTGCAGCCAGG - Intergenic
1127013225 15:54653243-54653265 CCTCACCAGCATTTGTTGCCTGG - Intergenic
1127755957 15:62092266-62092288 CCTCTTCAGCATCTGAAGACGGG + Intergenic
1128058338 15:64717601-64717623 CCTTGCCAGGATCAGCAGCCAGG - Intergenic
1128214802 15:65926937-65926959 CCTCTGCAGTATCTCCAGCCTGG - Intronic
1128803140 15:70509886-70509908 GCACACCAGCATCCCCAGCCAGG + Intergenic
1128846924 15:70907131-70907153 CTTTACCAGCATCCTCAGCCAGG - Intronic
1129331951 15:74832338-74832360 CCTCCGCAGCATCAGCAGCAAGG + Intergenic
1130957967 15:88640328-88640350 CATCCCCAGCACCTGGAGCCTGG - Intronic
1131230881 15:90658461-90658483 CCACATCAGCCTCTCCAGCCAGG - Intergenic
1131231231 15:90660985-90661007 CCACATCAGCCTCTCCAGCCAGG + Intergenic
1131938775 15:97537523-97537545 CCTGGCCAGCATCTGGACCCTGG + Intergenic
1132185910 15:99801496-99801518 CCTGCCAGGCATCTGCAGCCTGG - Intergenic
1132429768 15:101751202-101751224 CCTGCCAGGCATCTGCAGCCTGG + Intergenic
1132633109 16:929260-929282 CCTCACCAAACTCTGCAGACGGG + Intronic
1132650181 16:1017700-1017722 CCTCACCAACACCTACAGCCTGG + Intergenic
1132906543 16:2285436-2285458 GCTCACCAGCAGCAGCAGACTGG + Exonic
1133177260 16:4024855-4024877 TGTCACCAGCATCTTCAGCTTGG - Intronic
1133239331 16:4405118-4405140 CCTCCCCAGCAACTGGGGCCTGG + Intronic
1133442801 16:5835171-5835193 CCTCACCAGCCTCTTAAGGCTGG - Intergenic
1136275393 16:29176764-29176786 CCCCACCTGGATGTGCAGCCTGG + Intergenic
1136653900 16:31697578-31697600 CTTCACCATCAACTGCACCCCGG + Intergenic
1136676623 16:31914221-31914243 CCTCAGCAGCATCTGCATGGCGG - Intronic
1137231524 16:46571466-46571488 CCTCATCAGCATCTCCCGCCTGG - Intergenic
1138387703 16:56647679-56647701 CCTCACCTGCATTGCCAGCCAGG - Intronic
1138505282 16:57475396-57475418 CCACACCACCATCTCCACCCAGG + Intronic
1138537317 16:57666933-57666955 CCTCACCCTCACCTGCAGCTGGG + Intergenic
1138577770 16:57919439-57919461 CCTCAACAGCAACAGCAACCTGG + Intronic
1139561097 16:67742920-67742942 GGTCACTAGCAACTGCAGCCAGG + Intronic
1141560674 16:84865761-84865783 GCTCACCAGAATCTGCAATCAGG - Intronic
1141615556 16:85207617-85207639 CCTCATCTGGCTCTGCAGCCCGG - Intergenic
1142079753 16:88142829-88142851 CCCCACCTGGATGTGCAGCCTGG + Intergenic
1142302559 16:89267012-89267034 CCTCACCAGCTGCAGCTGCCAGG + Intergenic
1142509344 17:384788-384810 CCCCTCCATCCTCTGCAGCCTGG - Intronic
1143223756 17:5282693-5282715 CCTCCCCAGCGACGGCAGCCGGG - Intronic
1143323828 17:6085582-6085604 CCTCAGAAGCATGTACAGCCTGG + Intronic
1143862964 17:9904717-9904739 CCTCTGCAGCAGCTGCAGCAGGG + Intronic
1144728730 17:17514763-17514785 CCACTCCACCATCTGCAGGCAGG - Intronic
1144853697 17:18256903-18256925 CCTTACCAGCTTCTGCAGGGCGG + Exonic
1145283914 17:21489566-21489588 CCTGACCAGGACCTGCACCCAGG - Intergenic
1145846557 17:28043018-28043040 CCTCAACACCATCTTCATCCGGG + Exonic
1146022914 17:29293878-29293900 CCTCACCAATACCTGCAGCATGG - Exonic
1147427408 17:40352491-40352513 CCTCACCAGGATGTCCAGGCAGG - Exonic
1147511722 17:41075310-41075332 TCTCACCAACATCTGGAGCATGG + Intergenic
1147861084 17:43523868-43523890 CCTCTCCAGCAGCAGTAGCCAGG + Exonic
1148485209 17:47986528-47986550 CCCCACCAGCCTTTTCAGCCTGG + Intergenic
1149102968 17:52928187-52928209 CCTCATCTGCTTCTGGAGCCTGG + Intergenic
1149989211 17:61371749-61371771 CCACAGCAGCATCCGTAGCCAGG + Intronic
1150077074 17:62201679-62201701 CCCCACTAGCATTAGCAGCCTGG + Intergenic
1151578380 17:74963988-74964010 CCTGACCCTCCTCTGCAGCCTGG - Intronic
1151964884 17:77426069-77426091 CCACACCAGGAAATGCAGCCAGG + Intronic
1151979344 17:77499397-77499419 CATCAGCAGCACCTGCAGCCCGG - Exonic
1152037425 17:77881747-77881769 GCTCAGCAGCAGCTGCGGCCAGG + Intergenic
1152132524 17:78485668-78485690 CCCCACCAGCATCACCGGCCAGG + Exonic
1152417442 17:80171751-80171773 CCTCACCAGCAGCTGAAGACAGG - Intronic
1152580668 17:81164356-81164378 CCTCACCAGCACCAGCACCTTGG + Intronic
1152643770 17:81459677-81459699 CCTCGCCAGCCTCGGAAGCCAGG - Intronic
1154068596 18:11131984-11132006 ACTCAGCAGCGGCTGCAGCCAGG - Intronic
1156016247 18:32550525-32550547 CCTCGCCAACCTCTGCCGCCCGG + Intergenic
1157369816 18:47100408-47100430 TCTCACCAGCAGATGGAGCCTGG + Intronic
1157621777 18:49021106-49021128 CCTCACAGGCAATTGCAGCCAGG - Intergenic
1157733958 18:50030121-50030143 GTTCAACAGAATCTGCAGCCTGG + Intronic
1160317376 18:77860067-77860089 GCTCACCTGCATCAGAAGCCAGG - Intergenic
1160985292 19:1835851-1835873 CTTCCCCAGCCTCTCCAGCCAGG + Intronic
1161036927 19:2090136-2090158 TGAAACCAGCATCTGCAGCCCGG + Intronic
1161106177 19:2445170-2445192 CCCCACCAGCCTTTGCAACCTGG + Intronic
1161164963 19:2781801-2781823 CTTCACCAGCATGGGCAGCTGGG - Intronic
1161220972 19:3117994-3118016 CCGCACCAGCAGCTGTGGCCAGG - Intronic
1162084533 19:8240547-8240569 ACTCACCCGCCCCTGCAGCCTGG - Intronic
1162943808 19:14030720-14030742 CTTCATCAGCATCTGCATCCGGG - Exonic
1165911291 19:39229926-39229948 TCTCACCACTACCTGCAGCCTGG + Intergenic
1166124389 19:40705090-40705112 ACTCACCAGCATCTGCCAGCGGG + Exonic
1166458703 19:42967123-42967145 CCTCATCTGCTTCTGGAGCCTGG + Intronic
1166475652 19:43122394-43122416 CCTCATCTGCTTCTGGAGCCTGG + Intronic
1166559628 19:43723589-43723611 CAACACCATGATCTGCAGCCTGG - Intergenic
1167694795 19:51009151-51009173 CCTCCCCAGCATGGCCAGCCTGG + Intronic
1168149285 19:54436187-54436209 CCACCCCAGCTCCTGCAGCCGGG + Intronic
925860791 2:8173258-8173280 CCTCCCCAGCCCCAGCAGCCAGG - Intergenic
926144105 2:10386446-10386468 CCTGCCCAGCATCTGCAGCCAGG - Intronic
927211342 2:20640868-20640890 CCACAGCTGCCTCTGCAGCCTGG - Intronic
927319287 2:21723532-21723554 CCCCACCCCCATCTTCAGCCAGG - Intergenic
927809933 2:26175232-26175254 CCTCCCCACCAGCTGCAGCCCGG + Intronic
927915550 2:26933871-26933893 CCTCACCAGCACCTGGGGCGGGG - Intronic
927930637 2:27041344-27041366 CCTCACCTCCACCTGAAGCCTGG + Exonic
928170210 2:28998574-28998596 CTTGTCCAGCATCTGCAGCCTGG + Intronic
928320908 2:30282256-30282278 CCTGCCCAGCTGCTGCAGCCGGG - Intronic
929321583 2:40550260-40550282 CCCCACCAGCATCTGCATATTGG - Intronic
929770265 2:44885865-44885887 CCTCACCAGCATTCCCAGGCTGG - Intergenic
929958590 2:46479501-46479523 CCTCACCAGATTCCACAGCCTGG - Intronic
930063433 2:47309802-47309824 CCTGCTCAGCATCTGCAGCATGG + Intergenic
930921100 2:56754740-56754762 CCTCACCAGCAGCTGATGCCAGG - Intergenic
932405600 2:71511069-71511091 CCTCAGCAGGATCTGCAGCCTGG - Intronic
932595280 2:73089469-73089491 TCTCAGCTGCATCTGAAGCCTGG - Intronic
933926420 2:87094307-87094329 TCTCAGCAGCAGCCGCAGCCTGG - Intergenic
934593143 2:95576744-95576766 CCTCACCCTAATCTGCAGCATGG - Intergenic
934616207 2:95772809-95772831 CCTCAGCAGCCTCTCCTGCCTGG - Intergenic
934644688 2:96051751-96051773 CCTCAGCAGCCTCTCCTGCCTGG + Intergenic
934838103 2:97607841-97607863 CCTCAGCAGCCTCTCCTGCCTGG + Intergenic
935200645 2:100853739-100853761 CCCCAGGGGCATCTGCAGCCAGG + Intronic
936247698 2:110842968-110842990 CCTCAGCAGCTGCAGCAGCCTGG - Intronic
936907778 2:117556719-117556741 ACTCCCCTGCACCTGCAGCCTGG - Intergenic
936928829 2:117765614-117765636 CCTCACCACCACCTCCAACCTGG + Intergenic
938228489 2:129637757-129637779 CCTCAGCAGCCTCTGCTGCCTGG + Intergenic
938377293 2:130816322-130816344 CCTCACCAGCCTCGGCAACATGG + Intergenic
938648321 2:133353648-133353670 CCTCATCTGCTTCTGGAGCCTGG - Intronic
944212070 2:197216771-197216793 CCTCACAAGCATCAGCGTCCAGG + Intronic
944692793 2:202172801-202172823 ACTCACCAGAATCTACAGCCTGG + Intronic
945056572 2:205874478-205874500 CCCTACCAGCAGCGGCAGCCAGG - Intergenic
945117868 2:206426919-206426941 CCTCCCCACCATCAGCAGCATGG - Intergenic
946279383 2:218655792-218655814 CCTACCCAGGAACTGCAGCCAGG - Intronic
946308665 2:218871054-218871076 CCCTACCAGCATCTGCAGGAAGG + Exonic
946483566 2:220079288-220079310 CATCACCAGCAGGTACAGCCTGG - Intergenic
947371189 2:229447427-229447449 CTTTACCTGCAACTGCAGCCCGG - Exonic
948454421 2:238098164-238098186 CCTCAGCAGCAGCTGCAGCTCGG + Intronic
948576493 2:238955058-238955080 CCTCGCTGGCCTCTGCAGCCTGG - Intergenic
948819917 2:240537178-240537200 CCCCACCCTCACCTGCAGCCAGG + Intronic
1168980978 20:2003230-2003252 CATCACCCCCATCTCCAGCCAGG - Intergenic
1169278856 20:4250392-4250414 CCTCTCCCACATCTGCACCCGGG - Intergenic
1170525010 20:17228142-17228164 CCTCTCCAGCTCCTGTAGCCGGG - Intronic
1171296217 20:24019311-24019333 CCTTCCCAGCATCTGCTTCCAGG - Intergenic
1172096925 20:32465064-32465086 CCTGAACATCATCTGCAGCTTGG - Intronic
1172483500 20:35285305-35285327 TCTCTCCAGCACCTGCAGCCTGG - Intergenic
1172882890 20:38213230-38213252 CGTCTTCAGCCTCTGCAGCCTGG + Exonic
1173923895 20:46766147-46766169 CCACACCTGCACCTGCAACCTGG + Intergenic
1174275732 20:49402658-49402680 CCTAACCAGCTACTGCAGCTAGG + Intronic
1174404699 20:50295809-50295831 CCCCAGCATCATGTGCAGCCTGG + Intergenic
1175270230 20:57728685-57728707 CCTCCCCAGCACCTGCACACAGG + Intergenic
1175338824 20:58214574-58214596 CTCCAGCAGCCTCTGCAGCCGGG - Intergenic
1176370434 21:6058915-6058937 CCCCAGCTCCATCTGCAGCCTGG - Intergenic
1176715401 21:10345460-10345482 CCTCACCAACATCTGCAGAATGG + Intergenic
1179022552 21:37653419-37653441 CCCCATCTGCTTCTGCAGCCTGG - Intronic
1179565572 21:42245825-42245847 CCTCATCAGAGTCTGCTGCCTGG - Intronic
1179565582 21:42245861-42245883 CCTCATCAGAGTCTGCTGCCTGG - Intronic
1179632892 21:42689425-42689447 CCTCAGCACCAGCTCCAGCCTGG + Intronic
1179674720 21:42974035-42974057 CCTCCCCAGGCTCTGGAGCCCGG - Intergenic
1179753085 21:43479626-43479648 CCCCAGCTCCATCTGCAGCCTGG + Intergenic
1180232560 21:46436116-46436138 TCTCACCAGCTTCACCAGCCAGG + Exonic
1180602950 22:17034492-17034514 CCTCACCAACATCTGCAGAATGG - Intergenic
1181166078 22:20983758-20983780 CCCCACCAGGATCTGCATACTGG + Intronic
1182919992 22:34070361-34070383 CATCCCCAGCATCTCCAGCTTGG + Intergenic
1183472490 22:38017010-38017032 CCACCCCAGCCTCTGCTGCCTGG + Intronic
1183948320 22:41339110-41339132 CCTCCCCAGCACCGACAGCCTGG + Exonic
1184692403 22:46123228-46123250 CCACACGACCTTCTGCAGCCGGG - Intergenic
1185310390 22:50151044-50151066 CGTCAGCAGAAACTGCAGCCTGG + Intronic
1185327493 22:50234198-50234220 CCACAGCAGCATCTACACCCAGG + Intronic
1185327594 22:50234669-50234691 CCACAGCAGCATCTACACCCAGG + Intronic
1185389113 22:50549306-50549328 TCTGACCAACATCTGGAGCCAGG + Exonic
949873273 3:8607342-8607364 CCACACTGGCTTCTGCAGCCCGG + Intergenic
950990875 3:17435750-17435772 CCTCACCAGCTTTTGCTCCCAGG - Intronic
953043035 3:39271919-39271941 CCACACTCGCATCTGCTGCCAGG - Intronic
953081700 3:39625722-39625744 CCTCCACAGCATCTGGAGCTTGG - Intergenic
953832314 3:46310905-46310927 CATCTCCAGCAGCTGCAGCCTGG + Intergenic
954040664 3:47884912-47884934 CATCACCAGCAACTGCAGGGAGG - Intronic
954286932 3:49625810-49625832 CCTCACCAGCATCCCCATCTAGG - Intronic
954429936 3:50465149-50465171 CCTCCCGGGCAGCTGCAGCCTGG - Intronic
954456998 3:50605084-50605106 CCTCACCTGGTGCTGCAGCCTGG - Intergenic
954925900 3:54234350-54234372 CCTCACCAGCATCTGCTTTTTGG - Intronic
955971064 3:64439040-64439062 CCTCTGCAGCAACTGCATCCCGG + Intronic
956806196 3:72814456-72814478 CCTGACCAGCAGCTTCAGCTGGG - Intronic
958920544 3:100100790-100100812 CTTCACCAGAATATGCAGCAAGG - Intronic
961528376 3:127523681-127523703 CCTCAGCACCCTCTGCATCCAGG - Intergenic
966421559 3:179739310-179739332 CCTTTCTAGCAGCTGCAGCCAGG + Intronic
967304496 3:188047465-188047487 CCTCCCAAGCAACAGCAGCCTGG - Intergenic
967915266 3:194573729-194573751 CCTCACCAGCACAGGGAGCCAGG - Intergenic
968605292 4:1532480-1532502 CCCCACCAGCATCTGTAGGTAGG + Intergenic
968615559 4:1576017-1576039 TCCCAGCAGCATCTGCAGCTGGG + Intergenic
968899044 4:3422272-3422294 CCTCCCCAGCACGTGCGGCCTGG + Intronic
969062763 4:4451196-4451218 CCTGGCCAGCATCTGCTTCCAGG + Intronic
969346473 4:6573722-6573744 ACTCTCCAGCCTCTGCAACCAGG - Intergenic
970582831 4:17489115-17489137 CTTCACCCTCATCTGCAGCGTGG + Intronic
971100889 4:23465519-23465541 ACTCAGCAGTAGCTGCAGCCAGG + Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
972591185 4:40488623-40488645 CCTCACCTGCATTTGCTACCAGG - Intronic
972784367 4:42313359-42313381 CCTCACCAGCATTTGGTGCTGGG + Intergenic
977303628 4:95297016-95297038 CCCCACCAGCATGTGTAACCAGG - Intronic
977910024 4:102523621-102523643 CACCACCAGCATGAGCAGCCTGG + Intronic
980816844 4:137958832-137958854 GGTCACCAGCATCTGTTGCCTGG + Intergenic
983141496 4:164155083-164155105 CCTCATCTGCTTCTGGAGCCTGG + Intronic
983546128 4:168966550-168966572 CCTCTCCAGCATCTGTTTCCTGG - Intronic
983999839 4:174226530-174226552 GCTCCTCAGCCTCTGCAGCCAGG - Intergenic
984130155 4:175864925-175864947 CCTCCCCAGCAGCTGCAGCTGGG + Intronic
985315965 4:188659226-188659248 CCTGCCCAGCGCCTGCAGCCCGG - Intergenic
985493838 5:193591-193613 CCCCACCAGGATCTACTGCCTGG - Intronic
985672123 5:1212502-1212524 CCTCTGGAGCACCTGCAGCCTGG - Intronic
985780419 5:1868005-1868027 CCTCCCCATCCTCTGCAGCGGGG + Intergenic
986000817 5:3629380-3629402 CCTTCCCAGCATCTGCTTCCCGG - Intergenic
986457226 5:7931594-7931616 TCTCACCTGCTTCTGGAGCCTGG - Intergenic
988702018 5:33685128-33685150 CCTCTCCCTCATCTGCACCCTGG + Intronic
992742312 5:79785957-79785979 CCTCACAAGCATCAGCTGCTGGG + Intronic
993173532 5:84452163-84452185 CCTGACCAGCCACTGCAGGCAGG + Intergenic
993496191 5:88611721-88611743 CCTCACCAGATGCTGCAGCCTGG + Intergenic
995289847 5:110439431-110439453 CCCCTCCAACATCTACAGCCTGG + Intronic
996536774 5:124585703-124585725 CCTCATCAGCTTCTGGAGCCTGG + Intergenic
997526335 5:134555400-134555422 CCTCACCCTCAGCTGTAGCCAGG - Intronic
997733131 5:136194930-136194952 CCTCACCAGGACTTTCAGCCAGG + Intergenic
999104475 5:149058708-149058730 CCTCCCCAGCATGCGCAGGCTGG - Intronic
999811478 5:155131504-155131526 CCTCTCCTGCTTCTGGAGCCTGG + Intergenic
999861623 5:155653747-155653769 CCTCACCAGCATCTGTTGTGTGG + Intergenic
1001313498 5:170627375-170627397 CCTCACCAGGACCAGCACCCTGG + Intronic
1001588244 5:172847966-172847988 TCTCACGAGCATCTGGTGCCTGG + Intronic
1002065954 5:176651726-176651748 CCACACCTGCCTCTGCTGCCCGG + Intronic
1002160183 5:177310420-177310442 CCTCACCTGGATGTGCATCCTGG + Exonic
1002417204 5:179126805-179126827 CCTCCCCAGCCTCTGCTTCCTGG - Intronic
1002787276 6:412026-412048 TAGCACCAGCAGCTGCAGCCTGG - Intergenic
1003079749 6:3012402-3012424 CCTGACCAGAAGCTGCACCCTGG - Intronic
1004285431 6:14316709-14316731 CCTCAGCATCCTCTGCAGTCCGG + Intergenic
1004358417 6:14949810-14949832 CCTCACCAGTAGGTGAAGCCGGG + Intergenic
1006411951 6:33878869-33878891 CCTGACCAACATCTGCCTCCTGG - Intergenic
1006609848 6:35287776-35287798 CCTCATCATCCTCTGCTGCCAGG - Exonic
1006611687 6:35297993-35298015 CCACACCAGCCCCTGCCGCCTGG + Intronic
1006635325 6:35457566-35457588 CTTCAGCAGCTGCTGCAGCCTGG - Exonic
1006908385 6:37548138-37548160 GCTCAGCTGCATCTGGAGCCAGG + Intergenic
1010098857 6:72079350-72079372 CCTACCCAGCATCTGAAACCTGG - Intronic
1011728425 6:90234513-90234535 CTTCTCCAGAATTTGCAGCCAGG + Intronic
1014434394 6:121405485-121405507 CCGAACCAGCCACTGCAGCCAGG - Intergenic
1015768490 6:136744643-136744665 CCTCACCAGCACCTACACCAGGG + Intronic
1015952638 6:138569087-138569109 CCCCTCCAGCAGCTGCTGCCAGG - Intronic
1016826812 6:148396024-148396046 ACTCATCAGCAGCTGAAGCCTGG + Intronic
1017881394 6:158565051-158565073 CAACACCAGCATCCGCAGCAGGG - Intronic
1019504390 7:1383586-1383608 TCTCACCACCATCTGCAAACTGG - Intergenic
1019765630 7:2848038-2848060 CCTTACCAGTATCTGAATCCAGG + Intergenic
1020987777 7:15157525-15157547 TATCACCAGGACCTGCAGCCTGG - Intergenic
1022209177 7:28191948-28191970 CCTCCCCAGCCTCTGCAGCTGGG - Intergenic
1024136335 7:46412655-46412677 CCTCAGCAGCATCTGGAGTGGGG + Intergenic
1024185811 7:46946741-46946763 TCTCACCAGCACCTGCCTCCTGG + Intergenic
1024539948 7:50468097-50468119 CCTCCCCAGCACCTGCAACATGG - Intronic
1026482433 7:70790315-70790337 CATGAACAGCATCAGCAGCCTGG + Exonic
1035666031 8:1380010-1380032 CCATCCCAGCATCTGCACCCTGG + Intergenic
1036986675 8:13539614-13539636 CCTCACCAGCAACTGATGTCAGG + Intergenic
1037948398 8:23003664-23003686 CCTCACCCGCATCTGAAAGCTGG + Intronic
1038384514 8:27129699-27129721 CATCACCAGCAACTCCACCCTGG - Intergenic
1041098696 8:54374735-54374757 CATCAGCAGCATCTCCTGCCTGG - Intergenic
1043136612 8:76535197-76535219 CTTGACCAACATCTGCACCCAGG - Intergenic
1047381891 8:124372131-124372153 CCTCAGCAGCGGCAGCAGCCGGG + Exonic
1048615085 8:136065339-136065361 CCTCACAAGCAACTGCAACTGGG + Intergenic
1049191033 8:141287770-141287792 AATCTCCAGCATCTGCAGACGGG + Intronic
1049251328 8:141590761-141590783 CCTCCCCAGCATCTGCAGTACGG + Intergenic
1049348879 8:142153512-142153534 CCTCCCCAGCATCTGCAGAACGG - Intergenic
1049378420 8:142300480-142300502 CCTCACCTCCATCTGCAGGATGG + Exonic
1049649615 8:143759426-143759448 CCTCAGCAGCACCTTCAGGCAGG - Intergenic
1051270099 9:15347164-15347186 CCTCACCCTAAACTGCAGCCTGG - Intergenic
1051983773 9:23057458-23057480 CCTCATCTGCTTCTGGAGCCTGG - Intergenic
1055391505 9:75826772-75826794 CCTCAGCAGCATCAGTAGCAAGG + Intergenic
1055583784 9:77734599-77734621 ACTCAAGAGCATCTGCACCCTGG - Intronic
1056778926 9:89534728-89534750 CCACACCCTCATCTGCAGGCAGG - Intergenic
1057704235 9:97386370-97386392 CCTGCCCAGCACCTGCAGTCTGG + Intergenic
1060151885 9:121294221-121294243 CGGTCCCAGCATCTGCAGCCAGG + Intronic
1060934391 9:127506975-127506997 CCCCTCCAGCATCTCCTGCCTGG - Exonic
1061060515 9:128247959-128247981 CCTGCCAGGCATCTGCAGCCTGG + Intronic
1061559772 9:131394600-131394622 CCCCTCCGGCCTCTGCAGCCCGG - Intronic
1061993529 9:134172908-134172930 CCTCTCCACCATCAGAAGCCCGG + Intergenic
1062129156 9:134883402-134883424 CCTCACGTTCCTCTGCAGCCAGG - Intronic
1062277087 9:135736297-135736319 CCTCTCCAGCATCTGCCGCCCGG + Intronic
1062434563 9:136541164-136541186 GCCCACCAGCATGTGCTGCCAGG + Intronic
1185533305 X:839097-839119 CTTCAGCAGGATCTGCACCCTGG - Intergenic
1185533381 X:839437-839459 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1185533420 X:839607-839629 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1185533495 X:839947-839969 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1185533533 X:840117-840139 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1185533572 X:840287-840309 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1185622893 X:1464404-1464426 CCACACCTGCATCTGCTGCTTGG + Exonic
1186185251 X:7014193-7014215 CCTCATCTGCTTCTGGAGCCTGG + Intergenic
1188980319 X:36721257-36721279 TCTCTCCAGCATCTGCAGGTAGG + Intergenic
1190527776 X:51345420-51345442 ACTCAGCAGCAGCTGTAGCCAGG + Intergenic
1193278336 X:79618200-79618222 TTTCAGCAGCATCTGCAGCAGGG - Intergenic
1193969336 X:88032489-88032511 CCTCACCAGCATCTGTTGTAAGG - Intergenic
1196010315 X:110880041-110880063 CCTCACCAGCATCTGTTGATTGG + Intergenic
1197872853 X:131075783-131075805 CACCACCAACATCTGCTGCCTGG - Intronic
1199300209 X:146204642-146204664 CCTGGGCCGCATCTGCAGCCAGG + Intergenic
1199544724 X:148995861-148995883 GCTCACCAGCAACTGCTGGCAGG - Exonic
1200141642 X:153905560-153905582 CCTGCCCAGCAACAGCAGCCAGG + Exonic