ID: 1096686815

View in Genome Browser
Species Human (GRCh38)
Location 12:53293399-53293421
Sequence ACTTGAGTCGGGGAGCTTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096686815_1096686823 8 Left 1096686815 12:53293399-53293421 CCGCCAAGCTCCCCGACTCAAGT 0: 1
1: 0
2: 0
3: 18
4: 226
Right 1096686823 12:53293430-53293452 GGGGCTGCACCTATAGCCTATGG 0: 1
1: 1
2: 2
3: 3
4: 83
1096686815_1096686826 27 Left 1096686815 12:53293399-53293421 CCGCCAAGCTCCCCGACTCAAGT 0: 1
1: 0
2: 0
3: 18
4: 226
Right 1096686826 12:53293449-53293471 ATGGCTTGCCTGTCTCTCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096686815 Original CRISPR ACTTGAGTCGGGGAGCTTGG CGG (reversed) Exonic
901698834 1:11032151-11032173 ACTTGAGCCCGGGAGTTTGAGGG + Intronic
901721463 1:11201888-11201910 ACTTGAGTCCAGGAGTTTAGAGG - Intronic
903104113 1:21060032-21060054 ACTTGAGCCTGGGAGGTAGGTGG - Intronic
903524893 1:23986218-23986240 ACTTGAGCCCAGGAGCTTGAGGG - Intergenic
903782849 1:25833195-25833217 ACTTGAGCCCAGGAGTTTGGAGG - Intronic
905216421 1:36411426-36411448 ACTTGAGCCCAGGAGTTTGGAGG + Intergenic
905412736 1:37782961-37782983 ACTTGAGCCCGGGAGTTTGAGGG - Intergenic
905913186 1:41667870-41667892 GCTTGAGTTGGGGGGCTTGGGGG - Intronic
907297957 1:53467545-53467567 GCCTGAGTTGGGGAGATTGGGGG + Intergenic
909266746 1:73569544-73569566 ATTTGAGCCCAGGAGCTTGGAGG - Intergenic
909727519 1:78853312-78853334 ACTTTAGGTGGGGATCTTGGGGG + Intergenic
910994071 1:93085567-93085589 ACTTGAGCCCGGGAGTTTGAGGG - Intronic
915445372 1:155971494-155971516 GCTTGAACCGGGGAGGTTGGAGG + Intronic
917253473 1:173088666-173088688 ACTTGAGCCTGGGAGGTTGAGGG - Intergenic
922298724 1:224276317-224276339 ACTTGAGCCTGGGGGCGTGGAGG - Intronic
922332831 1:224592762-224592784 GCTTGAGTAGGGGAGCTTCCTGG - Intronic
923635612 1:235692936-235692958 ACTTGAGTCTGGGAGGTGGAGGG + Intronic
924713641 1:246552190-246552212 GCTTGAGTCTAGGAGTTTGGGGG + Intronic
1063693345 10:8308094-8308116 GCTTGAGCCTGGGAGTTTGGAGG + Intergenic
1064143580 10:12810063-12810085 GCTTGAGTCTGGGAGATGGGAGG + Intronic
1064196980 10:13251878-13251900 ACTTGAGCCTGGGAGGTAGGAGG - Intergenic
1064782870 10:18862114-18862136 AATTGAGTTGGGGATGTTGGGGG + Intergenic
1065287381 10:24199137-24199159 ACTTGAGCCCAGGAGTTTGGAGG + Intronic
1065346784 10:24756073-24756095 TCTTGAGTCCGGGAGGCTGGAGG + Intergenic
1067144858 10:43687627-43687649 GCTTGAGCTGGGGAGTTTGGGGG + Intergenic
1071861194 10:89674466-89674488 ACTTGAGCCCGGGAGATAGGAGG - Intergenic
1073215534 10:101834111-101834133 AGGTGAGTAGGGGTGCTTGGGGG - Intronic
1075567650 10:123516163-123516185 ACTGGAGTTGGGGTCCTTGGTGG + Intergenic
1076735837 10:132458591-132458613 ACAGGAGTTGGGGAGCATGGGGG - Intergenic
1077237865 11:1490820-1490842 ACTTGAGCCCAGGAGGTTGGTGG + Intronic
1079774364 11:24505274-24505296 AATGGAGTCGGGGAGTTTAGGGG + Intronic
1080760040 11:35239991-35240013 GCTTGTCTCTGGGAGCTTGGCGG - Intergenic
1081213068 11:40359579-40359601 AATTGAGATGGGGAGATTGGAGG - Intronic
1081537973 11:44009083-44009105 ACTTGAGTCTGGGAGGTCGAGGG + Intergenic
1083749586 11:64753858-64753880 ACGTGAGTCCGGAGGCTTGGGGG - Exonic
1085392108 11:76187566-76187588 ACTTGAGCCGGGGGCCTGGGTGG - Intronic
1088530818 11:110807362-110807384 ACTAGAGGCAGGGACCTTGGTGG - Intergenic
1089681483 11:120121364-120121386 TCCTGAGTCTGGGAGCTTTGAGG - Intronic
1090891873 11:130931055-130931077 ACTTGAGTTTGGGGGCTGGGGGG - Intergenic
1091385425 12:91681-91703 GCTTGAGCCTGGGAGGTTGGAGG + Intronic
1092875517 12:12844159-12844181 ACTTGAGTCTGGGGAATTGGAGG - Intergenic
1093412706 12:18885568-18885590 ACTGGAGTGGGTGAGATTGGTGG + Intergenic
1094797646 12:33994478-33994500 ACATGATTCAGTGAGCTTGGTGG - Intergenic
1095766564 12:45901742-45901764 ACTTGAGCCCAGGAGGTTGGAGG - Intronic
1095869122 12:47006380-47006402 ACTTGAGTCCAGGAGTTTGATGG + Intergenic
1096163502 12:49400953-49400975 ACTTGAGCCTGGGAGGTTGAAGG - Intronic
1096634197 12:52948383-52948405 ACTTGTGGAGGGGATCTTGGGGG - Intronic
1096686815 12:53293399-53293421 ACTTGAGTCGGGGAGCTTGGCGG - Exonic
1097103905 12:56609255-56609277 ACTTGAGCCCAGGAGTTTGGAGG - Intronic
1097876832 12:64651440-64651462 ACTTGAACCCGGGAGGTTGGAGG - Intronic
1098898801 12:76091720-76091742 ACTTGAGCCGGGGGGAGTGGAGG + Intergenic
1099427673 12:82544706-82544728 ACTTGAGTCCAGGAGGTTGAGGG - Intergenic
1100321059 12:93493340-93493362 ACTTGAGCCCAGGAGCTTGAGGG - Intronic
1100321615 12:93498658-93498680 ACTTGAGCCCAGGAGCTTGAGGG + Intronic
1101455178 12:104824432-104824454 CCTGGAGTCGGGCCGCTTGGAGG - Intronic
1103044631 12:117725821-117725843 TCTTGAGTCGGGGGGCTTACAGG - Intronic
1103613803 12:122139754-122139776 ACTTGAGTCTGGGAAGGTGGAGG - Intronic
1105051373 12:133054300-133054322 TCTTGAGCCTGGGAGCCTGGGGG + Intronic
1105265090 13:18808592-18808614 CTTTGAGTGGGGGAGGTTGGTGG + Intergenic
1105399299 13:20074312-20074334 ACTTGAGCCTGGGAGGTTGAGGG - Intronic
1105747431 13:23391349-23391371 ACCTGAGCCGGAGAGCTGGGTGG - Intronic
1105808096 13:23970392-23970414 ACTTGAGCCTGGGAGATAGGAGG - Intergenic
1108994682 13:56713264-56713286 GCTTGAGTCTGGGAGTTTAGGGG + Intergenic
1114059444 14:19006273-19006295 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1114059725 14:19008031-19008053 CCTTGAGTGGGTGAGCTTGGTGG - Intergenic
1114060541 14:19012945-19012967 CCTTGAGTAGGTGAGCTTGGTGG - Intergenic
1114101715 14:19387033-19387055 CCTTGAGTAGGTGAGCTTGGTGG + Intergenic
1114102820 14:19393720-19393742 CCTTGAGTGGGTGAGCTTGGTGG + Intergenic
1114103102 14:19395478-19395500 CCTTGAGTGGGTGAGGTTGGTGG - Intergenic
1114311484 14:21471533-21471555 AGTTGAGCCGGGGAGGTTGAGGG + Intronic
1117746176 14:58871746-58871768 ACCTCACTCGGGGAGGTTGGGGG + Intergenic
1118015280 14:61654168-61654190 ATTTGGGGTGGGGAGCTTGGTGG + Exonic
1118219269 14:63840185-63840207 ACTTGAACCTGGGAGGTTGGAGG + Intergenic
1119340071 14:73869437-73869459 ACTTGAGCCCGGGAGGTGGGAGG + Intronic
1121349828 14:93164529-93164551 GCTTGAGACCGGGAGTTTGGGGG + Intergenic
1122343164 14:101041891-101041913 ACTTGAGCCCGGGAGTTGGGAGG + Intergenic
1122557249 14:102587845-102587867 ACTTGTGTGGGTGAGCATGGTGG - Intergenic
1123552865 15:21399222-21399244 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1123553081 15:21400502-21400524 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1123589111 15:21836610-21836632 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1123589326 15:21837890-21837912 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1125443790 15:39731778-39731800 TATTGAGTCGGGGAGTCTGGTGG - Intronic
1127789711 15:62389477-62389499 GCTTGAGCCCGGGAGCTCGGGGG - Intergenic
1128081715 15:64861025-64861047 CCTTGAGTCTGGGAGCCTGGAGG - Intronic
1128525493 15:68409447-68409469 ACCTAAGTCAGGGAGCTAGGAGG - Intronic
1129410125 15:75346132-75346154 ACTTGAGCCCGGGAGGTCGGAGG + Intergenic
1132048893 15:98590743-98590765 ACTTGAGCCAGGGAGTTTGAGGG - Intergenic
1202961214 15_KI270727v1_random:126442-126464 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1202961429 15_KI270727v1_random:127722-127744 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1135678708 16:24439002-24439024 ACTTGAGCCTGGGAGGTTGAGGG + Intergenic
1136668324 16:31834172-31834194 ACTTGAGTCCAGGAGGTTGAAGG + Intergenic
1138380319 16:56596419-56596441 ACTTGAGCCTGGGAGTTTGAAGG + Intergenic
1139708451 16:68758502-68758524 ACTTGAGCCTGGGAGTTTCGAGG + Intronic
1141110739 16:81268859-81268881 ACTTGAGCCTGGGAGGTTGAGGG - Intronic
1143631047 17:8140603-8140625 TCTGGAGTGGGGGAGGTTGGTGG - Exonic
1145099043 17:20058410-20058432 ACTTGAGTCCAGGAGTTTGAGGG + Intronic
1145101379 17:20080646-20080668 TCTTGAGTCTAGGAGCTTGAGGG + Intronic
1147871143 17:43588496-43588518 ACTTGAGCCTGGGAGATTGAGGG - Intergenic
1148447020 17:47744027-47744049 ACTGGAGTTGGAAAGCTTGGGGG + Intronic
1148546010 17:48519532-48519554 ACTTGAATCCAGGAGGTTGGAGG + Intergenic
1149329813 17:55569188-55569210 GCTTGAGTCCAGGAGTTTGGAGG - Intergenic
1149493918 17:57105208-57105230 GCGTGAGTTGGGGAGCATGGAGG + Intronic
1150037722 17:61821806-61821828 ACTTGAGCCGAGGAGGTTGAGGG - Intronic
1151077394 17:71289088-71289110 ACATGACCCGGGGAGCCTGGGGG + Intergenic
1152565471 17:81098315-81098337 ACTGGAGAGGGGGAGTTTGGGGG - Intronic
1154453773 18:14502619-14502641 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1157266642 18:46229697-46229719 ACTTGAGCCTGGGAGGTTGAGGG - Intronic
1158187852 18:54791913-54791935 CCTGGAGTTGGGCAGCTTGGCGG - Intronic
1158505145 18:58040955-58040977 ACTTGAGTCCTGGAGTTTGAGGG + Intergenic
1158696403 18:59707909-59707931 GCTTGAGCCTGGGAGGTTGGAGG + Intergenic
1161195871 19:2986331-2986353 ACTTGAGCCTGGGAGGTTGAGGG + Intronic
1161359644 19:3840611-3840633 ACTTGAGCCTGGGAGTTTCGAGG - Intronic
1161378988 19:3954647-3954669 ACTTGAACCCGGGAGGTTGGAGG - Intergenic
1163416424 19:17189547-17189569 GCTTGAGTCTGGGAGGTTGAAGG + Intronic
1163800811 19:19364036-19364058 GCTTGAATCCGGGAGGTTGGAGG + Intergenic
1164502043 19:28828344-28828366 ACATGAGAAGGGGATCTTGGTGG + Intergenic
1166641129 19:44496125-44496147 ACTTGAGTGGGTGAGGTGGGAGG - Intronic
1166967352 19:46537314-46537336 GCTTGAGTCCAGGAGTTTGGGGG - Intronic
1167654872 19:50757060-50757082 ACTTGAACCTGGGAGGTTGGAGG - Intergenic
1168639830 19:58023793-58023815 ACTTGAGTCGGGGGGCGGGGGGG - Intergenic
1202649813 1_KI270706v1_random:170067-170089 CCTTGAGTGGGTGAGGTTGGTGG - Intergenic
926179256 2:10626095-10626117 ACTTGAGCCCAGGAGTTTGGAGG + Intronic
930257172 2:49105733-49105755 CCTTGAGTGGGGCAGCTTGCAGG - Intronic
931729750 2:65142402-65142424 GCTTGAGCCCGGGAGTTTGGGGG + Intergenic
932576531 2:72965286-72965308 TCTGGAGTCGGGCTGCTTGGTGG - Intronic
933902886 2:86861950-86861972 GCCTGGGTCGGGGAGCTGGGGGG + Intergenic
934494746 2:94787630-94787652 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
935777659 2:106487320-106487342 GCCTGGGTCGGGGAGCTGGGGGG - Intergenic
935999864 2:108816777-108816799 ACTTGAGGCTAGGAGTTTGGAGG - Intronic
937370258 2:121292671-121292693 GCTTGAGTCGGGGAATTTGAGGG - Intergenic
938281767 2:130068377-130068399 CCTTGAGTGGGTGAGGTTGGTGG - Intergenic
938332388 2:130456926-130456948 CCTTGAGTGGGTGAGGTTGGTGG - Intergenic
938357419 2:130663742-130663764 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
938433855 2:131270529-131270551 CCTTGAGTGGGTGAGGTTGGTGG + Intronic
938477891 2:131633175-131633197 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
939369190 2:141276442-141276464 ACTTGAGGCTGGGAGGTGGGAGG - Intronic
939946771 2:148420808-148420830 ACTTGAGTCTGGGAGGCAGGAGG - Intronic
940850669 2:158685414-158685436 ACTTGAACCTGGGAGGTTGGAGG - Intergenic
943252751 2:185550010-185550032 ACTTGAACCAGGGAGCTTAGAGG - Intergenic
943840273 2:192571865-192571887 ACTTGAGTGGGCCATCTTGGAGG + Intergenic
943846234 2:192652590-192652612 ACTTGAGTCCAGGAGGTTGAGGG + Intergenic
947975084 2:234358355-234358377 ACTTGAGGGTGGGAGGTTGGAGG - Intergenic
1170209472 20:13834376-13834398 ACTTGAGCCCAGGAGCTTGAGGG - Intergenic
1170770297 20:19326798-19326820 ACTTGAGGCCAGGAGCTTGAGGG - Intronic
1171881552 20:30621199-30621221 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1171881804 20:30622654-30622676 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1172060203 20:32182191-32182213 ACTGGAGTCGGTGAACTTTGAGG - Intergenic
1172458542 20:35096680-35096702 GCTTGAGCCCAGGAGCTTGGCGG - Intergenic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1173990322 20:47297528-47297550 ACTTGGGAGGGTGAGCTTGGAGG - Intronic
1174308592 20:49632645-49632667 ACTTGAGTGAGGGGACTTGGGGG - Intergenic
1175087568 20:56472920-56472942 ATTTGAGTCCAGGAGTTTGGGGG + Intronic
1175858480 20:62135688-62135710 TCCTGAGCTGGGGAGCTTGGAGG - Intergenic
1176602006 21:8802480-8802502 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1176820407 21:13650686-13650708 CCTTGAGTGGGTGAGGTTGGTGG - Intergenic
1176951837 21:15056971-15056993 TGTTGAGTGGGGGAGCTTTGTGG - Intronic
1180344290 22:11694031-11694053 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1180477924 22:15728888-15728910 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1180478206 22:15730643-15730665 CCTTGAGTGGGTGAGCTTGGTGG - Intergenic
1180479023 22:15735557-15735579 CCTTGAGTAGGTGAGCTTGGTGG - Intergenic
1180977934 22:19860699-19860721 GCTTGAGTCCGGGAGGTTTGGGG + Intergenic
1182715750 22:32354956-32354978 ACTGGAGTCTGGAAGCTTAGAGG - Intronic
1184846762 22:47092476-47092498 ACTGGAGTGGAGGGGCTTGGTGG + Intronic
949255202 3:2037410-2037432 ACTTGAACCCGGGAGGTTGGAGG - Intergenic
950429252 3:12941449-12941471 ACTTGAGTTGGGGTGCATGTGGG - Intronic
950985937 3:17366206-17366228 CCTTGAGCCTGGGAGGTTGGAGG + Intronic
954933328 3:54303551-54303573 ACTGGAGTCTGTGAGTTTGGTGG + Intronic
955117640 3:56021718-56021740 ACTTGAGTGGGGAAGGTGGGAGG - Intronic
958791309 3:98654327-98654349 ACTTGAGCCCAGGAGTTTGGAGG + Intergenic
959082862 3:101820868-101820890 ACTTGAGTGGGGGAGTTGGGAGG + Intronic
959373471 3:105558752-105558774 AGGTGAGTCAGGGAGCTTGATGG - Intronic
961245144 3:125445147-125445169 ACTTGAACCTGGGAGCTTGAGGG - Intergenic
968152456 3:196347855-196347877 ACTTGAAACGGGGAGGGTGGGGG - Exonic
968324219 3:197798176-197798198 GCTTGAGTCTGGGAGATTGAGGG + Intronic
971242090 4:24898416-24898438 ACTTGAGCCGGGAAGCTGGCCGG + Intronic
972184280 4:36509557-36509579 ACTCGAGTCATGCAGCTTGGAGG + Intergenic
972296313 4:37742712-37742734 ACTTGAGCCTGGGAGGTTGAGGG - Intergenic
973365331 4:49204287-49204309 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
973395260 4:49588167-49588189 CCTTGAGTGGGTGAGGTTGGTGG - Intergenic
973938362 4:55875845-55875867 ACTTGAGCCCAGGAGTTTGGGGG + Intronic
974028441 4:56754794-56754816 ACTTGAGCCCGGGAGTTTGAGGG - Intergenic
977083455 4:92563143-92563165 ACTAGAAACGGGGAGCATGGTGG - Intronic
977729836 4:100338047-100338069 ACTTGAGTGGGGAGGCTGGGAGG + Intergenic
979118226 4:116855788-116855810 ACTGGAGGCAGGGAGCTGGGTGG - Intergenic
980046304 4:127992619-127992641 ACTTGAGCCAGGGAGGTTGAGGG - Intronic
981048251 4:140285840-140285862 AACTGAGTCTGGGAGATTGGAGG - Intronic
983316430 4:166137996-166138018 ACTTGAGTAGGGAAGCTGGGAGG + Intergenic
983721858 4:170864885-170864907 ATCTGAATTGGGGAGCTTGGTGG + Intergenic
986061761 5:4198340-4198362 ACTTGAGTTGGAGAGCATGCAGG + Intergenic
989016319 5:36939083-36939105 ACTTGAGCCAGGGAGGTTGAGGG - Intronic
992535409 5:77696833-77696855 ACTTGAGCCCAGGAGCTGGGAGG + Intronic
994043673 5:95284878-95284900 ACTGGAGCCGCGGAGCTTCGAGG - Intergenic
995561946 5:113391633-113391655 ACTTGAGTCCAGGAGTTTGGAGG + Intronic
999271203 5:150297361-150297383 ACTTTAATGGGGGTGCTTGGGGG - Exonic
1000659280 5:163918559-163918581 ACTTGAGTTTGGGAGATGGGAGG + Intergenic
1004295597 6:14407049-14407071 AATAGGGTGGGGGAGCTTGGTGG - Intergenic
1005296005 6:24427996-24428018 ACTTGAGTGGGGAAGGTGGGAGG + Intronic
1006681805 6:35802481-35802503 ACTTGAATCCGGGAGGTGGGTGG + Intergenic
1007621049 6:43214892-43214914 ACTTGAGTCCAGGAGTTTGAGGG + Intronic
1008449062 6:51628223-51628245 ACTTGAGTGGGGAAGGTGGGAGG - Intronic
1008828028 6:55722418-55722440 ACTTGAACCTGGGAGCTGGGAGG + Intergenic
1011651508 6:89510692-89510714 ACTAGGGCCGGGGAGATTGGGGG - Intronic
1014447645 6:121547109-121547131 CCTGGAGTCGGGCCGCTTGGTGG + Intergenic
1017670940 6:156768960-156768982 ACTTGAGCCTGGGAGGTTGGAGG - Intergenic
1018335236 6:162779615-162779637 AGATGAGTCTTGGAGCTTGGAGG + Intronic
1020218813 7:6218094-6218116 ACTTGAGCCGGGGAGGTGGGAGG + Intronic
1022960880 7:35425154-35425176 CCTTGAGCGGGGGAGCTGGGTGG + Intergenic
1025250996 7:57351350-57351372 ACTTGAGCCGAGGAGTTGGGAGG - Intergenic
1025716414 7:63961451-63961473 ACTTGAACCTGGGAGCTTGGAGG + Intergenic
1026526177 7:71155354-71155376 GCTTGAGCCCGGGAGGTTGGGGG - Intronic
1026816607 7:73517409-73517431 ACTTGAGCCTGGGAAGTTGGAGG + Intronic
1026919623 7:74145583-74145605 ACTTGAGCCTGGGAGGTGGGAGG - Intergenic
1027381444 7:77613972-77613994 GCTTGAGTCCGGGAGGTTGAGGG - Intronic
1030769510 7:113456844-113456866 CCTGGAGTCGGGCAGCTAGGCGG - Intergenic
1031488226 7:122355496-122355518 ACTTGAACCCGGGAGGTTGGAGG + Intronic
1031948500 7:127866734-127866756 AGTTAAGTAGGGGGGCTTGGTGG - Intronic
1034449014 7:151127544-151127566 TCTTGAGTTGGGGATTTTGGAGG + Intronic
1035719848 8:1783792-1783814 ACTTCTGTCGAGGAGCTTCGGGG + Exonic
1039338865 8:36624456-36624478 ACTTGAGGCAGAGAGCTAGGAGG + Intergenic
1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG + Intergenic
1040101917 8:43513247-43513269 CCTTGAGTGGGTGAGGTTGGTGG - Intergenic
1041291372 8:56311330-56311352 GCTTGAATCCGGGAGGTTGGAGG + Intronic
1045552899 8:103188225-103188247 ACTTGAATCTGGGAGCTGTGAGG - Intronic
1045768732 8:105708510-105708532 ACCTGAGTCCAGGAGCTTGAGGG - Intronic
1053498819 9:38568576-38568598 CCTTGAGTGGGTGAGGTTGGTGG + Intronic
1053662372 9:40292729-40292751 CCTTGAGTGGGTGAGGTTGGTGG - Intronic
1053912825 9:42922894-42922916 CCTTGAGTCGGTGAGGTTGGTGG - Intergenic
1054374501 9:64438958-64438980 CCTTGAGTGGGTGAGGTTGGTGG - Intergenic
1054522238 9:66083555-66083577 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1055945759 9:81689637-81689659 ACGTGAGCCCGGGAGGTTGGGGG + Intergenic
1057678273 9:97153069-97153091 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1059196050 9:112372156-112372178 ACTTGAGCCCAGGAGCTTGAGGG - Intergenic
1060710137 9:125854212-125854234 ACTTGAGCCTAGGAGGTTGGGGG - Intronic
1061143537 9:128783396-128783418 ACTTGAGCCTGGGAGGTTGGAGG - Intergenic
1203526843 Un_GL000213v1:98235-98257 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1203526963 Un_GL000213v1:98874-98896 CCTTGAGTGGGTGAGGTTGGTGG + Intergenic
1186770819 X:12816383-12816405 ACTTGAGCCTGGGAGATCGGGGG - Intronic
1188642767 X:32526991-32527013 AGTTAAGTCTGGGAGCTTGGAGG - Intronic
1189186495 X:39059775-39059797 GCTTGAGGCCGGGAGTTTGGTGG + Intergenic
1195665676 X:107428053-107428075 ACATGAGTCAGGAATCTTGGGGG + Intergenic
1196498169 X:116346891-116346913 CCCTGAGTAGGGGTGCTTGGTGG - Intergenic
1197931543 X:131701126-131701148 ACTTGAACCTGGGAGGTTGGAGG + Intergenic
1198111115 X:133503381-133503403 ACTTGAGCCTGGGAGGTTGAGGG - Intergenic
1200086013 X:153605857-153605879 ACTTGAGTCCTGTAGCTTTGTGG - Intergenic
1201894899 Y:18982764-18982786 ACTTGAGTCCAGGAGATTTGAGG + Intergenic