ID: 1096686882

View in Genome Browser
Species Human (GRCh38)
Location 12:53293903-53293925
Sequence CAGGACGGACGGATGGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 39}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096686882_1096686888 1 Left 1096686882 12:53293903-53293925 CCAGGTACCATCCGTCCGTCCTG 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1096686888 12:53293927-53293949 CTTCCTGCCGCAGGTATCTTTGG 0: 1
1: 0
2: 0
3: 1
4: 91
1096686882_1096686886 -8 Left 1096686882 12:53293903-53293925 CCAGGTACCATCCGTCCGTCCTG 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1096686886 12:53293918-53293940 CCGTCCTGTCTTCCTGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 144
1096686882_1096686890 6 Left 1096686882 12:53293903-53293925 CCAGGTACCATCCGTCCGTCCTG 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1096686890 12:53293932-53293954 TGCCGCAGGTATCTTTGGAGTGG 0: 1
1: 0
2: 1
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096686882 Original CRISPR CAGGACGGACGGATGGTACC TGG (reversed) Intergenic
903971873 1:27124124-27124146 CAGGACTTACAGATGGTATCAGG + Intronic
910245593 1:85135064-85135086 GAGGAAGGAGGGATGGGACCAGG - Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
1065593433 10:27289020-27289042 CAGGAGAGAGGGTTGGTACCAGG - Intergenic
1075341408 10:121649344-121649366 CAGGATGGAAGGATGGAAGCTGG + Intergenic
1090273593 11:125404521-125404543 CAGAACGGAGGGATGCTGCCGGG + Intronic
1096686882 12:53293903-53293925 CAGGACGGACGGATGGTACCTGG - Intergenic
1097152701 12:56991330-56991352 CAGAAAGGAAGGAAGGTACCAGG - Intergenic
1107589781 13:41890863-41890885 CAGGAAGGAAGGATGGAAGCAGG + Intronic
1113834887 13:113322255-113322277 CAAGACAGACGGATGGTGTCAGG - Intronic
1131796262 15:96019838-96019860 CAGGTCAGAAGGATGGTAGCAGG - Intergenic
1132631524 16:919916-919938 GAGGCCGGAAGGATGGTGCCGGG - Intronic
1136110710 16:28062610-28062632 CAGGAGGGGCGGCTGGTAGCAGG + Intronic
1137730681 16:50687387-50687409 CAGGACGGACACATGGAACTTGG + Intergenic
1142384905 16:89757696-89757718 AAGGATGGACGGAGTGTACCTGG - Intronic
1142424329 16:89992967-89992989 CAGGACGGACGGCAGCAACCTGG - Intergenic
1142968274 17:3594531-3594553 CAGGACGGACGGCTGGCTACTGG + Intronic
1147769138 17:42855835-42855857 CAGGAGGGATGGAAGTTACCAGG + Intronic
1152618054 17:81346719-81346741 CGGGAAGGAAGGAGGGTACCTGG + Intergenic
1160079021 18:75704883-75704905 CAGGAAGGACGGATGGCAGGAGG + Intergenic
1160343529 18:78110423-78110445 CAGGAGGGTCGGAGGGAACCGGG - Intergenic
938063791 2:128270437-128270459 CAGCATGGATGGGTGGTACCAGG - Intronic
943728970 2:191281569-191281591 CAGGCCAGATGGATGGTAGCAGG + Intronic
1173256118 20:41395266-41395288 CAGGCGGGAGGGATGGTAGCTGG + Intergenic
958966400 3:100563505-100563527 CAGGACTGATGGATGGGATCTGG + Intronic
960138183 3:114126433-114126455 CAGGACTGATGGGTGGCACCAGG - Intergenic
967823990 3:193864034-193864056 CAGGAGGGACTGATGGTAATTGG - Intergenic
970358166 4:15278896-15278918 AAGGGGGGACGGACGGTACCTGG + Intergenic
981811828 4:148784265-148784287 CAGGATGGACTGATGGTGGCGGG + Intergenic
993077994 5:83259419-83259441 CAGGATGGAATGAGGGTACCTGG + Intronic
997532305 5:134589268-134589290 CAGGACGGGAGGGTGGTTCCAGG + Intergenic
999019050 5:148143006-148143028 CAGGAAGGAAGGATGATAGCTGG - Intergenic
1007133219 6:39496262-39496284 CAGGACGGATGGATGTCAACAGG + Intronic
1012359827 6:98363342-98363364 GAGGACGGACAGATGGTGTCAGG - Intergenic
1014158093 6:118135499-118135521 CAGCACAGATGGCTGGTACCCGG - Intronic
1035665775 8:1378632-1378654 CAGGACGGACAGATGAGGCCAGG - Intergenic
1059755322 9:117288297-117288319 CAGGAGGCATGGATGGTAGCAGG + Intronic
1061573395 9:131491543-131491565 CAGGACTGGCGGCTGGGACCCGG - Exonic
1062483659 9:136763764-136763786 CAGGGCGGACGGCTGTAACCAGG - Exonic
1062725352 9:138070233-138070255 CAGGAAGGACGGAAGCTACAGGG - Intronic