ID: 1096691555

View in Genome Browser
Species Human (GRCh38)
Location 12:53325090-53325112
Sequence GAGCCCGGCGTCCCGACCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 95}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096691549_1096691555 -10 Left 1096691549 12:53325077-53325099 CCCGGGCCCGCTGGAGCCCGGCG 0: 1
1: 0
2: 2
3: 27
4: 243
Right 1096691555 12:53325090-53325112 GAGCCCGGCGTCCCGACCCGGGG 0: 1
1: 1
2: 0
3: 6
4: 95
1096691537_1096691555 15 Left 1096691537 12:53325052-53325074 CCCGGAGCTCCGCCCGCTACCCC 0: 1
1: 0
2: 1
3: 25
4: 226
Right 1096691555 12:53325090-53325112 GAGCCCGGCGTCCCGACCCGGGG 0: 1
1: 1
2: 0
3: 6
4: 95
1096691542_1096691555 3 Left 1096691542 12:53325064-53325086 CCCGCTACCCCTTCCCGGGCCCG 0: 1
1: 0
2: 0
3: 20
4: 277
Right 1096691555 12:53325090-53325112 GAGCCCGGCGTCCCGACCCGGGG 0: 1
1: 1
2: 0
3: 6
4: 95
1096691541_1096691555 6 Left 1096691541 12:53325061-53325083 CCGCCCGCTACCCCTTCCCGGGC 0: 1
1: 0
2: 1
3: 32
4: 354
Right 1096691555 12:53325090-53325112 GAGCCCGGCGTCCCGACCCGGGG 0: 1
1: 1
2: 0
3: 6
4: 95
1096691545_1096691555 -4 Left 1096691545 12:53325071-53325093 CCCCTTCCCGGGCCCGCTGGAGC 0: 1
1: 0
2: 3
3: 16
4: 216
Right 1096691555 12:53325090-53325112 GAGCCCGGCGTCCCGACCCGGGG 0: 1
1: 1
2: 0
3: 6
4: 95
1096691536_1096691555 23 Left 1096691536 12:53325044-53325066 CCTGGGTGCCCGGAGCTCCGCCC 0: 1
1: 0
2: 0
3: 21
4: 272
Right 1096691555 12:53325090-53325112 GAGCCCGGCGTCCCGACCCGGGG 0: 1
1: 1
2: 0
3: 6
4: 95
1096691547_1096691555 -6 Left 1096691547 12:53325073-53325095 CCTTCCCGGGCCCGCTGGAGCCC 0: 1
1: 0
2: 5
3: 48
4: 301
Right 1096691555 12:53325090-53325112 GAGCCCGGCGTCCCGACCCGGGG 0: 1
1: 1
2: 0
3: 6
4: 95
1096691535_1096691555 29 Left 1096691535 12:53325038-53325060 CCGGAGCCTGGGTGCCCGGAGCT 0: 1
1: 0
2: 3
3: 37
4: 343
Right 1096691555 12:53325090-53325112 GAGCCCGGCGTCCCGACCCGGGG 0: 1
1: 1
2: 0
3: 6
4: 95
1096691543_1096691555 2 Left 1096691543 12:53325065-53325087 CCGCTACCCCTTCCCGGGCCCGC 0: 1
1: 0
2: 3
3: 25
4: 422
Right 1096691555 12:53325090-53325112 GAGCCCGGCGTCCCGACCCGGGG 0: 1
1: 1
2: 0
3: 6
4: 95
1096691546_1096691555 -5 Left 1096691546 12:53325072-53325094 CCCTTCCCGGGCCCGCTGGAGCC 0: 1
1: 0
2: 1
3: 18
4: 203
Right 1096691555 12:53325090-53325112 GAGCCCGGCGTCCCGACCCGGGG 0: 1
1: 1
2: 0
3: 6
4: 95
1096691538_1096691555 14 Left 1096691538 12:53325053-53325075 CCGGAGCTCCGCCCGCTACCCCT 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1096691555 12:53325090-53325112 GAGCCCGGCGTCCCGACCCGGGG 0: 1
1: 1
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096691555 Original CRISPR GAGCCCGGCGTCCCGACCCG GGG Intergenic