ID: 1096698351

View in Genome Browser
Species Human (GRCh38)
Location 12:53365542-53365564
Sequence TTGACTAAGGCTGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096698351_1096698356 -8 Left 1096698351 12:53365542-53365564 CCTCCCTCCTCAGCCTTAGTCAA No data
Right 1096698356 12:53365557-53365579 TTAGTCAAAAGTCTGACCCATGG No data
1096698351_1096698357 -5 Left 1096698351 12:53365542-53365564 CCTCCCTCCTCAGCCTTAGTCAA No data
Right 1096698357 12:53365560-53365582 GTCAAAAGTCTGACCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096698351 Original CRISPR TTGACTAAGGCTGAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr