ID: 1096699102

View in Genome Browser
Species Human (GRCh38)
Location 12:53370770-53370792
Sequence AAGAAGTAGAATTGTAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096699098_1096699102 9 Left 1096699098 12:53370738-53370760 CCAGTGGTCACTGCACACTTAGG No data
Right 1096699102 12:53370770-53370792 AAGAAGTAGAATTGTAGTCAGGG No data
1096699097_1096699102 12 Left 1096699097 12:53370735-53370757 CCACCAGTGGTCACTGCACACTT No data
Right 1096699102 12:53370770-53370792 AAGAAGTAGAATTGTAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096699102 Original CRISPR AAGAAGTAGAATTGTAGTCA GGG Intergenic
No off target data available for this crispr