ID: 1096700374

View in Genome Browser
Species Human (GRCh38)
Location 12:53379438-53379460
Sequence TCGCCATATTGGCCCTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096700374_1096700382 20 Left 1096700374 12:53379438-53379460 CCTGAGGAGGGCCAATATGGCGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1096700382 12:53379481-53379503 CCTCTTCCCTCCCTCATGATGGG 0: 1
1: 0
2: 1
3: 25
4: 337
1096700374_1096700380 19 Left 1096700374 12:53379438-53379460 CCTGAGGAGGGCCAATATGGCGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1096700380 12:53379480-53379502 CCCTCTTCCCTCCCTCATGATGG 0: 1
1: 0
2: 0
3: 31
4: 361
1096700374_1096700377 -9 Left 1096700374 12:53379438-53379460 CCTGAGGAGGGCCAATATGGCGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1096700377 12:53379452-53379474 ATATGGCGACGGTCTCCTCTTGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096700374 Original CRISPR TCGCCATATTGGCCCTCCTC AGG (reversed) Intergenic
902777693 1:18685105-18685127 TAGCCATATTGGCCTTCTCCGGG + Intronic
903472081 1:23594325-23594347 TTGCCATATTTGCCCCTCTCTGG + Intronic
1068781635 10:60925101-60925123 TCTCCCTATTGCTCCTCCTCTGG + Intronic
1075476009 10:122734507-122734529 TCGCCAAATTGGGCCTCAGCAGG - Intergenic
1084021783 11:66422109-66422131 TCGCCCTACAGGCACTCCTCTGG + Exonic
1087820348 11:102704576-102704598 TAGCCATACTGGCCCACATCAGG + Exonic
1088914189 11:114214799-114214821 TCGCCATGTTGGCCAGCCTGTGG + Intronic
1096105515 12:48995090-48995112 TCCCCACAGTGGCCCTCCCCCGG - Intergenic
1096648580 12:53050943-53050965 TACCCATATTCCCCCTCCTCTGG - Intronic
1096700374 12:53379438-53379460 TCGCCATATTGGCCCTCCTCAGG - Intergenic
1109105014 13:58239642-58239664 TTGCCATATTGGCCCTGCAGAGG - Intergenic
1115823273 14:37235737-37235759 TCTCCATATTGCCCCTCCCCTGG + Intronic
1119985526 14:79132906-79132928 TTGCCATCTTGGCCCAACTCAGG - Intronic
1129775982 15:78236794-78236816 TGGCCACTTTGGCCCACCTCAGG - Intronic
1135622934 16:23971402-23971424 TCTCCATTTGGTCCCTCCTCTGG + Intronic
1140664262 16:77213437-77213459 TCGCCCTACTGGTCCTTCTCTGG + Intergenic
1147479076 17:40741837-40741859 TGGCCATCTTGGCCCCACTCAGG - Intergenic
1147965859 17:44193880-44193902 TCGCCACATTGCCCCTCAGCAGG + Exonic
1168265985 19:55224374-55224396 TCCCCATCTGGGCCCTCCCCAGG - Intergenic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
934620654 2:95802255-95802277 TGGCCATCTTGGCCCCCTTCTGG + Intergenic
935321539 2:101894140-101894162 TTGCCATATTGGCACTTCTGTGG - Intronic
937865452 2:126748242-126748264 TGGCCATCTTGGCCCATCTCTGG + Intergenic
1169278350 20:4248295-4248317 CCGCCATCCTGGCCCTGCTCTGG - Exonic
1172901074 20:38335348-38335370 TCCCCATGATGGCCCTCCTGAGG - Intronic
1174067930 20:47878989-47879011 TCCCCATATGGGCCATCCTGTGG - Intergenic
1183722095 22:39568597-39568619 TGGCCAGATTGGACCTCCTCAGG - Intergenic
960341885 3:116485292-116485314 TGGCCATCTTGGCCAGCCTCTGG - Intronic
962055381 3:131865946-131865968 TGGCCATATTGGCCCAACTTGGG - Intronic
962586351 3:136846143-136846165 CCGCAATATTGGCACTTCTCTGG + Intronic
964529473 3:157651656-157651678 TCGCCACAGTGGCACTCCTGTGG - Intronic
987821274 5:22970050-22970072 TCCCCATCTTGGCACTCCTGGGG + Intergenic
988453079 5:31362648-31362670 TAGCCTCATCGGCCCTCCTCTGG + Intergenic
994692715 5:103037675-103037697 TCCCCATCTTTTCCCTCCTCTGG + Intergenic
1000430548 5:161147288-161147310 TAGTCATATTGCCCCTTCTCAGG + Intergenic
1005832513 6:29681848-29681870 TCGCCATATTGGCCACGCTGAGG - Intergenic
1007285749 6:40746298-40746320 TCGCCATTTAGGCCCTGCTTTGG - Intergenic
1008742315 6:54624541-54624563 TCGCCATATGGACCCCTCTCTGG - Intergenic
1016854053 6:148648638-148648660 ATGCCATATGGACCCTCCTCTGG + Intergenic
1017151290 6:151282631-151282653 GCCCCATTCTGGCCCTCCTCTGG - Intronic
1032428045 7:131837692-131837714 TCACCACAATGGCCCTTCTCTGG - Intergenic
1041467179 8:58168455-58168477 TCCTCATATTTGCCCTCCACTGG - Intronic
1185661600 X:1733022-1733044 TCACCATGTTGGCCCTGGTCTGG + Intergenic
1188548432 X:31335973-31335995 TGGCCATTTTGGCCCAACTCAGG - Intronic
1191909053 X:66127660-66127682 TGGCCATATTGGCCCCTCTGGGG + Intergenic