ID: 1096701021

View in Genome Browser
Species Human (GRCh38)
Location 12:53382831-53382853
Sequence GCTCACAGCCTGTCACCTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096701012_1096701021 26 Left 1096701012 12:53382782-53382804 CCCAGCTCTCAGGCAGTCACGAT 0: 1
1: 0
2: 0
3: 9
4: 165
Right 1096701021 12:53382831-53382853 GCTCACAGCCTGTCACCTCAGGG 0: 1
1: 0
2: 0
3: 14
4: 176
1096701013_1096701021 25 Left 1096701013 12:53382783-53382805 CCAGCTCTCAGGCAGTCACGATC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1096701021 12:53382831-53382853 GCTCACAGCCTGTCACCTCAGGG 0: 1
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096701021 Original CRISPR GCTCACAGCCTGTCACCTCA GGG Exonic
900133396 1:1101537-1101559 GCTCAGGGTCTGTCAGCTCATGG + Intronic
900133409 1:1101647-1101669 GCTCACAGTCTGTCGGCTCACGG + Intronic
902442992 1:16443460-16443482 CCACACAGCCTGTCACAACAAGG - Intronic
902789601 1:18758535-18758557 GCCCACATCCTGTCACTTCCAGG + Intergenic
905022122 1:34825335-34825357 GCACACTGTCTCTCACCTCAGGG - Intronic
905295527 1:36952015-36952037 GCCCACAGACTGTCAGCACAGGG + Intronic
911239471 1:95449420-95449442 GCTCAGAACCAGTCAACTCAGGG - Intergenic
912244575 1:107947625-107947647 GCCCACAGCCATTCACCTAATGG + Intronic
915390838 1:155542582-155542604 GATTACAGCCTGTCAACTGAAGG + Intronic
916989485 1:170226983-170227005 TCTGACAGCCTGTGACCTCAGGG - Intergenic
918147707 1:181772108-181772130 GCTCACAGCCCTTCTCCCCAAGG - Exonic
920127137 1:203702294-203702316 GCTCACAGAATGTCATGTCAAGG + Intronic
922798835 1:228354723-228354745 GCTGACAGCCAGGCACCTCTGGG - Intronic
922857439 1:228787162-228787184 GCTCAGTGCCTGTTTCCTCAGGG - Intergenic
923686644 1:236158081-236158103 GCTCCCAGCCTGCCCCCTCCTGG - Intronic
1062942192 10:1432155-1432177 GCATAAAGCCTGACACCTCATGG + Intronic
1063367529 10:5500135-5500157 GCTCACTGCCTATAACTTCAAGG + Intergenic
1064081068 10:12308379-12308401 GCTCCTACCCTGTGACCTCATGG + Intergenic
1066990825 10:42511680-42511702 CCTCACAGCCTCTCAGATCAGGG - Intergenic
1070789319 10:79180210-79180232 GTGCACAGCCTGGCACCTCGGGG - Intronic
1072492453 10:95921043-95921065 GCTCACAGCCAGTGGACTCAGGG - Intronic
1074867799 10:117555038-117555060 GTCCCCAGCCTCTCACCTCACGG - Intergenic
1075099053 10:119493196-119493218 ATTCACAGCCTGCCACCCCAGGG - Intergenic
1075898185 10:126016569-126016591 GCTCACGGCTGGTCAGCTCAGGG + Exonic
1076323813 10:129604751-129604773 GCTTTCAGGCTGTGACCTCAAGG + Intronic
1076646113 10:131955879-131955901 GCACACAGCCTGGCACCCCGTGG + Exonic
1078058988 11:8031577-8031599 CCCCACAGCCCCTCACCTCACGG - Intronic
1079091002 11:17480253-17480275 GCTCAAAGCCTGTATCCACAGGG + Intergenic
1079837431 11:25351347-25351369 GCTCCCAGCCTGAGAGCTCAGGG + Intergenic
1083178434 11:60968253-60968275 GCTAACAGACTCTCACCTAAGGG - Intergenic
1083688140 11:64389923-64389945 GCAGCCAGCCTGTCACCCCAAGG + Intergenic
1086593387 11:88542676-88542698 TTTCACAGCCTCTCAACTCAAGG + Intronic
1086741286 11:90372424-90372446 CCTCAGGGCCTCTCACCTCAAGG + Intergenic
1087168449 11:95026702-95026724 CCACACAGCCTGTGTCCTCAGGG + Exonic
1087827596 11:102783821-102783843 TCTCACAGCTTGTCAAATCAGGG - Intergenic
1088793196 11:113244827-113244849 GCACACATTCTGTCAGCTCACGG + Intronic
1091624903 12:2114280-2114302 CCTCACAGCATGGCAGCTCAGGG + Intronic
1092732263 12:11545979-11546001 GCCCACAACCTGGCAGCTCAGGG - Intergenic
1093844038 12:23945733-23945755 GTTCACATTCTGTCACCTAATGG - Intronic
1095789332 12:46147195-46147217 GTTCACAGCCTGGCAACTTAGGG - Intergenic
1096101534 12:48972992-48973014 GCTCACAGCCTGGCACGTAAAGG - Intergenic
1096701021 12:53382831-53382853 GCTCACAGCCTGTCACCTCAGGG + Exonic
1103888636 12:124221859-124221881 GCTAGCACCCTCTCACCTCAGGG + Intronic
1104435477 12:128752934-128752956 GGTCAGAGCCTGTCTACTCAGGG - Intergenic
1104815344 12:131642463-131642485 TCTCACTGCCTGTGACCTGAGGG + Intergenic
1104918250 12:132277614-132277636 CCTCACAGCCTGGCAGCTCCAGG + Intronic
1105739068 13:23303253-23303275 GCTCCCAGCCTGGCAGTTCAGGG + Intronic
1110560571 13:76907346-76907368 CCTCACAGCCTTTCCCCACAGGG + Intergenic
1111767808 13:92556490-92556512 ACATACAGCCTGTCACATCATGG - Intronic
1112563569 13:100533895-100533917 CCCCACAGGCTGTCACCTCATGG - Intronic
1112781221 13:102903214-102903236 GCTTACATCCTGTCACCTGTCGG - Intergenic
1113098870 13:106695727-106695749 TCTCACAGCCTAGCTCCTCAAGG - Intergenic
1113811175 13:113143623-113143645 GTTCACAGGCGGTCACCTGAGGG + Intronic
1120820871 14:88910653-88910675 GGCCACAGCCTGTCCCCACAAGG + Intergenic
1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG + Intronic
1122790152 14:104180963-104180985 GCTTACTGCCCGTCACCCCAGGG - Intergenic
1122854383 14:104553164-104553186 GCACACAGCCTGTCTCCTACCGG - Intronic
1122987057 14:105217338-105217360 GCTCACAGCCTGCCAGGCCAAGG + Intronic
1124248700 15:28094145-28094167 GCACACAGCCTGTCTCCTAGGGG + Intronic
1125968257 15:43891537-43891559 GCTCACAGACAGTGACCTCTGGG - Intronic
1128775127 15:70314408-70314430 ACTCACAGCCTATCACCTACAGG + Intergenic
1129242526 15:74260005-74260027 CCTCACAGCCTCCCTCCTCAGGG - Intronic
1132359146 15:101198040-101198062 GACCACAGTCTGTCACCACAGGG - Intronic
1132504727 16:302069-302091 GCGCACAGCCAGCCTCCTCAGGG + Intronic
1132837474 16:1961536-1961558 GCTCAAAGCCTGTCAGCAGAGGG + Exonic
1132881487 16:2163536-2163558 AGTCACAGCCAGTCACCTCCAGG - Intronic
1133060331 16:3170736-3170758 GCTCACCGCCAGCCACCTCCTGG - Intergenic
1134249814 16:12566400-12566422 TCTCAGAGCCTGTTACCTCCAGG + Intronic
1134813705 16:17188549-17188571 GTTCACAGGCTGCCTCCTCAGGG + Intronic
1139671127 16:68493005-68493027 GATCACAGCCTCCCTCCTCAGGG - Intergenic
1140079380 16:71730397-71730419 GCTCACTGCTTATCACCCCAGGG + Intronic
1141054137 16:80801076-80801098 GCTCACAGGCTGCCACTCCATGG + Intronic
1141897376 16:86966974-86966996 ACTCACGGCCTGCCAGCTCACGG + Intergenic
1144503908 17:15813626-15813648 GCTGACATCCTGCCACCTTACGG - Intergenic
1144633095 17:16885439-16885461 GCTGACATCCTGCCACCTTACGG - Intergenic
1145167764 17:20629128-20629150 GCTGACATCCTGCCACCTTACGG - Intergenic
1148844630 17:50522133-50522155 GGTAACTGCCAGTCACCTCAGGG - Intronic
1151953628 17:77369677-77369699 GGACACAGCCTGCCACCTAATGG + Intronic
1152082968 17:78199891-78199913 TCTCCCATCCTGTCACCCCAAGG - Intronic
1152252408 17:79218909-79218931 GCTCACCGCTGGTCACCCCATGG - Intronic
1152339135 17:79714797-79714819 GCTCAGCCTCTGTCACCTCATGG - Intergenic
1157200494 18:45655123-45655145 CCTAACAACCTGTCTCCTCAGGG + Intronic
1157511530 18:48278859-48278881 CCTCACAGGCTGTCCCCTCAGGG + Intronic
1157618412 18:49001465-49001487 GCCCAGAGCCTGTCTCCTCCTGG - Intergenic
1163791095 19:19306478-19306500 GTTCTCAGCCTGACACCTGATGG + Intronic
1165393422 19:35550994-35551016 CCTCACAGCCTCTCACCGAATGG + Exonic
1167299999 19:48672700-48672722 ACTCACAGCCTGGTTCCTCAAGG - Intronic
1167756225 19:51415311-51415333 GCTCAGAACCTGTCCCCTCTGGG + Exonic
925153609 2:1634340-1634362 GAGCACAGCCTGTCAGCTCTGGG + Intronic
927209289 2:20628922-20628944 ACTCTCAGCCTGTTCCCTCATGG - Intronic
927720065 2:25376849-25376871 GCTCGCAGCCTCTCGCCTTAGGG - Intergenic
928076995 2:28274023-28274045 GCTTATAACCTGTCACCTCCAGG + Intronic
928301540 2:30129725-30129747 GCTCACAGGCTGTCTTCTCTTGG + Intergenic
932193541 2:69762750-69762772 CCTCACAGCTCCTCACCTCAGGG + Intronic
932881688 2:75507802-75507824 GATCAGAGCCTCACACCTCAGGG + Intronic
933934298 2:87188551-87188573 GGTCATAGCCAGTCACCTCTGGG - Intergenic
936358844 2:111777344-111777366 GGTCATAGCCAGTCACCTCTGGG + Intronic
936463223 2:112726468-112726490 GCTCACACTCTGTGACCTCTAGG + Intronic
937245962 2:120493568-120493590 TCCCACAGCCTTTCACCTTATGG + Intergenic
938885359 2:135641610-135641632 GCTCTCAGCCAGTCTTCTCATGG + Exonic
940180271 2:150924043-150924065 GCTTGCAGTCTATCACCTCATGG - Intergenic
940790451 2:158025570-158025592 ACTGCCAGCCTGTGACCTCAAGG + Intronic
944692441 2:202170121-202170143 CCTCCCAGGCTGTCACCTGAGGG - Intronic
946266385 2:218545813-218545835 GCTCACATCCTTTAACCTCTAGG + Intronic
946371169 2:219282134-219282156 CCTCTCAGCCTTCCACCTCAGGG - Intronic
947398313 2:229708122-229708144 GCTCACAGCCTGGAAACTCCTGG - Intronic
947485018 2:230540039-230540061 GCTCCCAGGGTGTCATCTCAGGG + Intronic
948888359 2:240895056-240895078 AGTCACAGCCTGTGACCTCGAGG - Intronic
1174558534 20:51413351-51413373 GGACACAGTCTGTCTCCTCAGGG + Intronic
1175135452 20:56820221-56820243 GGAAACAGCCTGTCACCTCATGG + Intergenic
1175728230 20:61333913-61333935 CCTCCCACCCAGTCACCTCATGG - Intronic
1176253915 20:64140679-64140701 GCTATCAGCCTGTGAGCTCAGGG - Intergenic
1178824855 21:36006361-36006383 GCTTACTGCCTCTCAGCTCAGGG - Intergenic
1179243527 21:39611584-39611606 GCTCACCTCCTGTCCCCTCTGGG + Intronic
1179288036 21:39994959-39994981 GCTCACAGGGTGACACCTGAAGG + Intergenic
1179660485 21:42871437-42871459 GCTCAGAGCAGGACACCTCAAGG + Intronic
1180010793 21:45049944-45049966 GCTCACAGCCTCTCCCCGCCTGG + Intergenic
1180832060 22:18911458-18911480 GCTCACTGCCTGGCACCTTTGGG + Intronic
1180949806 22:19715836-19715858 GCTCCCAGCCTGGCTCCCCAAGG - Intronic
1181775143 22:25153956-25153978 GCTGACATCCTAGCACCTCAGGG + Intronic
1182314848 22:29438816-29438838 ACTAACAGGCTTTCACCTCACGG + Exonic
1182695102 22:32193228-32193250 ACTAACAGGCTTTCACCTCATGG - Intronic
1182716249 22:32358096-32358118 ACTAACAGGCTTTCACCTCAAGG + Exonic
1183669050 22:39261479-39261501 CCTCACAGCATGGCAGCTCATGG + Intergenic
1184701743 22:46179057-46179079 GCAAAGAGCCTGTCAGCTCAGGG + Intronic
1203282146 22_KI270734v1_random:136763-136785 GCTCACTGCCTGGCACCTTTGGG + Intergenic
950704629 3:14772236-14772258 GCTCACAGCAGGCCACCTCGGGG + Intronic
951368938 3:21820259-21820281 GCTCACATTCTGTGACCACAAGG + Intronic
951921654 3:27861269-27861291 GCTCACACCCTGACACCTTTAGG + Intergenic
952311899 3:32198237-32198259 GCTCCCAGCCTGCCATCCCAAGG - Intergenic
954421392 3:50420861-50420883 ACTCACAGCCTGGCACATGAGGG - Intronic
954801500 3:53189680-53189702 GCCCAGAGCCTGTCATCTCCGGG + Intronic
959579433 3:107968617-107968639 GCTCAAGTCCTGTGACCTCAGGG - Intergenic
963433303 3:145236544-145236566 CCTCACAGACTTCCACCTCATGG - Intergenic
963967999 3:151395157-151395179 GCTCAGAGAAGGTCACCTCAAGG - Intronic
964337758 3:155675418-155675440 TCTTACAGCCTGTCAGCTCCAGG - Intronic
966385415 3:179392319-179392341 GCTCACAGCCCCACCCCTCAGGG - Exonic
966971990 3:185052626-185052648 GCTCTCAGTCTGTCAAGTCATGG + Intergenic
967745467 3:193050060-193050082 CCTCACCACCTCTCACCTCATGG + Intergenic
968798007 4:2721898-2721920 ACGAACAGACTGTCACCTCATGG + Intronic
979624636 4:122830882-122830904 GCACACAGGCAGTCACCTCCTGG - Intronic
987019146 5:13852003-13852025 CCTCACAGCATGGTACCTCATGG - Intronic
988912210 5:35854701-35854723 GCTAACAGATTGTCACTTCATGG - Intronic
993006677 5:82435505-82435527 GCTCACAGCGAGTCACAGCAAGG - Intergenic
994986590 5:106941309-106941331 CAACACAGCCTGGCACCTCAAGG - Intergenic
997225818 5:132208684-132208706 GCTCAGAGCCTGTCACACCTGGG + Intronic
997631241 5:135370258-135370280 GCCCACAGCTTTTCACCTCAGGG - Intronic
1000368766 5:160515327-160515349 ACTGACAGACTGTCACTTCAGGG - Intergenic
1002089727 5:176797468-176797490 GCTCACACCCTGTGGCCTCGGGG + Intergenic
1002633852 5:180597584-180597606 GCTGCCAGCCTGTCACTCCAAGG - Intergenic
1003872739 6:10414893-10414915 GCTCGGAGCCTGTGACCGCACGG + Intronic
1005417902 6:25621121-25621143 CCTCATAGCCTGTTAGCTCATGG - Intergenic
1005421705 6:25657844-25657866 GAAGACAGACTGTCACCTCAGGG + Intronic
1005750382 6:28876410-28876432 GCACGCTGCCTCTCACCTCATGG - Intergenic
1007374245 6:41445498-41445520 GCTCCCAGCCTGATACCTCATGG - Intergenic
1007375594 6:41454190-41454212 GCTCACAGACACACACCTCATGG - Intergenic
1007375606 6:41454461-41454483 GCTCACAGACACACACCTCATGG - Intergenic
1007375612 6:41454578-41454600 GCTCACAGACACACACCTCATGG - Intergenic
1007627415 6:43254371-43254393 GGTCACAGCCTCTCATCTGAGGG - Intronic
1013452267 6:110295452-110295474 CCTCCCTGCCTGTCAGCTCAGGG - Intronic
1017878908 6:158546162-158546184 GCTCCCAGCTTGTCACCACGAGG - Intronic
1019971365 7:4543485-4543507 GCTCACAGCCTGTGACGTGGAGG + Intergenic
1026929386 7:74215455-74215477 GGCCACAGACTGTCACCTCCAGG + Intronic
1033233086 7:139616903-139616925 GCTTACAGCCTGTCTCACCATGG + Intronic
1034588584 7:152118800-152118822 GCTCACAGCCAGTGTCCGCAAGG + Intronic
1035483121 7:159202859-159202881 GGTCCCAGGCTGTCTCCTCATGG - Intergenic
1035483297 7:159203489-159203511 GGTCCCAGGCTGTCTCCTCATGG - Intergenic
1035483337 7:159203629-159203651 GGTCCCAGGCTGTCTCCTCATGG - Intergenic
1037288555 8:17326455-17326477 GCTCACAGCTTGTGACCACAAGG - Intronic
1038302813 8:26370329-26370351 TCACACAGCCTGGCACCCCAAGG + Exonic
1038315639 8:26482339-26482361 GCCCACAGCCTGTCTCATCCAGG + Intronic
1039908414 8:41804213-41804235 GCTCTCAGCTCCTCACCTCATGG + Intronic
1042048723 8:64684105-64684127 GGTCAGAGCCTGTGCCCTCATGG - Intronic
1047447213 8:124930244-124930266 CCTCACAGCCAGTCCCCCCAGGG - Intergenic
1049221120 8:141429383-141429405 CCTCAACGCCTGTCACCTCAGGG + Intronic
1049462521 8:142736677-142736699 GGTCACTGCTTGTCAGCTCAGGG + Exonic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1050674954 9:8041765-8041787 TCCCCCAGCCTGCCACCTCAAGG + Intergenic
1052916617 9:33928123-33928145 GCACAGAGCCTCTCACCTTAAGG - Intronic
1056235891 9:84593962-84593984 GCACACAGCCTGGCACATCATGG - Intergenic
1057604934 9:96492379-96492401 GCGCACAGCCTGTCACCAGGTGG + Intronic
1058889749 9:109351290-109351312 CCTGACAGCATCTCACCTCAAGG + Intergenic
1060396608 9:123320981-123321003 GCTCAAAGCCTGACACCTGGCGG + Intergenic
1062298941 9:135853152-135853174 CCTCCCAGCGTGTCACCTCAGGG - Intronic
1186534915 X:10337077-10337099 CCTCACAGCCCCTCACTTCACGG + Intergenic
1187396351 X:18922904-18922926 TCTCACATCCTCTCACCCCAGGG - Intronic
1189984932 X:46545377-46545399 GCCGACAGCCTGAAACCTCAGGG + Exonic
1195878718 X:109570552-109570574 GCTCACAGCCCCACCCCTCAAGG - Intergenic
1196936422 X:120735237-120735259 CCTCACAGGCTGTCTCCTCAGGG + Intergenic
1198407011 X:136323152-136323174 CCACACAACCTGACACCTCATGG + Exonic
1199525193 X:148784215-148784237 ACTCACAGCCTGTCTGCTTAGGG - Intronic