ID: 1096706630

View in Genome Browser
Species Human (GRCh38)
Location 12:53425956-53425978
Sequence CTGTGTGTATGTATAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 1, 2: 2, 3: 76, 4: 643}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096706624_1096706630 19 Left 1096706624 12:53425914-53425936 CCCAAGGTGAGCACCAAGGAGTG 0: 1
1: 0
2: 2
3: 13
4: 118
Right 1096706630 12:53425956-53425978 CTGTGTGTATGTATAGAGGTGGG 0: 1
1: 1
2: 2
3: 76
4: 643
1096706626_1096706630 6 Left 1096706626 12:53425927-53425949 CCAAGGAGTGTATATGTGTGTGT 0: 1
1: 4
2: 41
3: 361
4: 2127
Right 1096706630 12:53425956-53425978 CTGTGTGTATGTATAGAGGTGGG 0: 1
1: 1
2: 2
3: 76
4: 643
1096706625_1096706630 18 Left 1096706625 12:53425915-53425937 CCAAGGTGAGCACCAAGGAGTGT 0: 1
1: 0
2: 2
3: 5
4: 130
Right 1096706630 12:53425956-53425978 CTGTGTGTATGTATAGAGGTGGG 0: 1
1: 1
2: 2
3: 76
4: 643

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096706630 Original CRISPR CTGTGTGTATGTATAGAGGT GGG Intronic
900910208 1:5591977-5591999 ATGTGTGTGTGTATACATGTGGG - Intergenic
901105371 1:6751774-6751796 GTGTGTGTCTGTGTAGAGGAAGG + Intergenic
902071375 1:13741752-13741774 GTGTGTGTGTGTGTAGGGGTGGG + Intronic
902129834 1:14250294-14250316 ATGAGTGTATTTATAGAGCTTGG - Intergenic
903011677 1:20335305-20335327 CTGTTTGTTTGTTTAGAGATAGG - Intronic
903365951 1:22805543-22805565 CTGGGTGGTTGTAGAGAGGTGGG - Intronic
903414163 1:23169963-23169985 GTGTGTGTGTGTGTAAAGGTAGG - Intronic
903969044 1:27107229-27107251 CTGGGTGTGTGTGTAGGGGTTGG - Intronic
904486187 1:30825829-30825851 GTGTGTGTGTGTGTAGAGGGTGG - Intergenic
904598758 1:31662488-31662510 CTGTGTGTGTGTGCTGAGGTGGG - Intronic
904850226 1:33453810-33453832 CTGTATGTATCTGTAGATGTGGG + Intergenic
905910862 1:41653309-41653331 GTGAGTGTGTGTGTAGAGGTGGG - Intronic
905981084 1:42228752-42228774 ATGTGTGTGTGTATAGAGGCAGG - Intronic
905982255 1:42240190-42240212 TTGTTTGTTTTTATAGAGGTAGG + Intronic
906919020 1:50043516-50043538 CTGTGTGTATGTGTATATGTGGG - Intergenic
907234928 1:53037940-53037962 GTGTGTGTGTGTATAGAGACAGG - Intronic
907244419 1:53099057-53099079 GTGTGTGAGTGTACAGAGGTGGG - Intronic
907279916 1:53340605-53340627 GTGTGTGTATGGATAGGTGTGGG - Intergenic
907348532 1:53805189-53805211 CTGTTTGTTTGTTTAGAGATGGG + Intronic
907789125 1:57644592-57644614 ATGTGTGTATGTACATATGTGGG - Intronic
907848921 1:58235561-58235583 GTGTGGGTATATATAGAGGGAGG + Intronic
908054155 1:60265004-60265026 GTGTGGGAATGTTTAGAGGTAGG + Intergenic
908480137 1:64531523-64531545 GTGTGTGTCTGTGTAGGGGTGGG + Intronic
908520764 1:64939384-64939406 TTGTGTGAATGTATGGAAGTTGG - Intronic
908641940 1:66233702-66233724 GTGTGTGTGTGTATAAAGGATGG + Intronic
908768929 1:67578360-67578382 GTGTGTGTGTGTGTTGAGGTGGG + Intergenic
909216374 1:72895711-72895733 GTGTGTGTGTGTATAGAAGGGGG + Intergenic
910147105 1:84093305-84093327 CTGTGTGTGTGTGGTGAGGTAGG + Intronic
911412617 1:97529010-97529032 ATGTGTATATTTATAGAGATTGG - Intronic
911703936 1:100988672-100988694 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
912230454 1:107786970-107786992 ATGTGTGTGTGTAGATAGGTGGG - Intronic
912442890 1:109712476-109712498 CTGTGTGTGTGTTTGGGGGTGGG + Intronic
913192608 1:116426286-116426308 GTGTGTGTATGTGGGGAGGTAGG + Intergenic
913390502 1:118305841-118305863 ATGTGTGTGTGTATAGTTGTGGG + Intergenic
914774751 1:150726439-150726461 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
914997848 1:152560569-152560591 CTGTGTGGATGGGTAGAGGGTGG + Intronic
915371762 1:155357070-155357092 GTGTGTGTGTGTGTAGAGCTGGG - Intronic
915521865 1:156450430-156450452 ATCTGTGTATGTAGACAGGTAGG - Intergenic
915881646 1:159678741-159678763 AGGTGTGTATATATATAGGTTGG - Intergenic
916088933 1:161291944-161291966 GTGTGTGTGTGTATTGGGGTGGG + Intergenic
916347127 1:163806060-163806082 TTGTGTGTATGTATGGAGTCTGG + Intergenic
916801473 1:168220351-168220373 GTGTGTGTGTGTGTAGGGGTGGG - Intergenic
917497580 1:175555219-175555241 CTGTATGTATCTATAGGGGGTGG - Intronic
918137595 1:181688297-181688319 GTGTATGTTTTTATAGAGGTTGG + Intronic
918717592 1:187809664-187809686 TTGTATGTATGTATGTAGGTAGG - Intergenic
918846038 1:189614841-189614863 ATGTGTGTATATATATATGTTGG - Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919772158 1:201169132-201169154 CTGTGTGTAGGTATAGAGGTGGG + Intronic
920964906 1:210693562-210693584 TGGTGTGTATGTCTAGAAGTGGG - Intronic
921297260 1:213716187-213716209 CTGTGTGTGTGTGTTGGGGTGGG + Intergenic
921347881 1:214205705-214205727 ATGTGTGTATATACAGAGGGAGG + Intergenic
921617790 1:217291849-217291871 GTGTGTATATGTGTAGAGGGCGG + Intergenic
922046665 1:221951799-221951821 CTGTGTGTAAGGAAAAAGGTTGG - Intergenic
922172068 1:223164010-223164032 CTGTGTGTATGTATACAGTATGG - Intergenic
922209071 1:223473641-223473663 CTGTCTGTATCTATTCAGGTTGG - Intergenic
922232482 1:223699125-223699147 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
922550621 1:226491541-226491563 AGGTGTGTATATATAGAGGCTGG + Intergenic
922935210 1:229417310-229417332 CTATCTGACTGTATAGAGGTGGG - Intergenic
923409784 1:233695558-233695580 CACTGTGTGTGTATGGAGGTAGG - Intergenic
924286976 1:242497472-242497494 TTGTGTGTGTGTATGGAGGCAGG + Intronic
924395381 1:243613174-243613196 GTGTGTGTATGTATATATGAGGG - Intronic
924823906 1:247520517-247520539 GTGTGTGTGTGTGAAGAGGTGGG - Intronic
1063451982 10:6156157-6156179 GTGTGTGTATTTTTAGAGGCAGG + Intronic
1064600294 10:16986014-16986036 CTGTGTGTATGTGTGGGGCTGGG + Intronic
1064796181 10:19014012-19014034 GTGTGTGTATGTATATATGAAGG - Intergenic
1065029475 10:21570242-21570264 GTGTGTGTGTGTTTAGAGATGGG + Intronic
1065388163 10:25154455-25154477 TTGTGTGTTTTTATAGAGATGGG + Intergenic
1065795545 10:29304211-29304233 CTGTGTGTATGTATATGTGTAGG - Intronic
1068088230 10:52401074-52401096 GTGTGTGTGTGTATAGAGGCAGG - Intergenic
1068281290 10:54873779-54873801 GTGTGTGTATATATATATGTTGG + Intronic
1068455739 10:57251379-57251401 TTGTGTGTGGGTATAGATGTTGG + Intergenic
1068543751 10:58324857-58324879 ATGTGTGTGTGTGTAGAGATAGG + Intergenic
1069238669 10:66110497-66110519 GTGTGTGTATATATAGAGAGAGG - Intronic
1069266621 10:66466331-66466353 GTGTGTGTGTGTGTATAGGTGGG - Intronic
1070218851 10:74418681-74418703 CTGTGTGTGTTTAAAGGGGTGGG - Intronic
1070372930 10:75802310-75802332 GTGTGTGTGTGTTTAGAGATAGG - Intronic
1071267924 10:83980806-83980828 GTGTGTGTATGGAGAGAGATGGG - Intergenic
1071584367 10:86805369-86805391 GTGTGTGTGTGTGTACAGGTAGG - Intronic
1071616983 10:87083808-87083830 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1071676821 10:87662562-87662584 CTATGTGTGTGTATAGGGGGTGG - Intronic
1072410555 10:95198168-95198190 CTGTGTCTATGTAGAAAGGGAGG - Intronic
1072759009 10:98040568-98040590 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1072876986 10:99183093-99183115 CTGTCTGTAGGCATTGAGGTGGG - Intronic
1073113354 10:101076076-101076098 CTGTGTGTGTGTATTGTGGGGGG - Intergenic
1073316969 10:102589095-102589117 GTGTGTGTGTGTATGGAGATGGG + Intronic
1073321266 10:102617569-102617591 CTGTGTGTAGGTATGGAGTGTGG + Intronic
1073451986 10:103615518-103615540 GTGTGTGTGTGTGTAGGGGTTGG + Intronic
1073965611 10:108985772-108985794 CTGTGGGTATATATTGATGTTGG + Intergenic
1074724875 10:116297633-116297655 CTGTGTGTTTGTGGAGAGGACGG + Intergenic
1075178407 10:120187197-120187219 CTGAGTGTAAGCATGGAGGTGGG + Intergenic
1075796870 10:125126736-125126758 ATGTGTGTCTGTATAGCGGGGGG - Intronic
1076020510 10:127068738-127068760 ATGTGTGTATATATAGGTGTGGG - Intronic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1077139593 11:1018215-1018237 GTGTGTGAATGTAGCGAGGTAGG + Exonic
1077537456 11:3131311-3131333 ATGTATGTATGTATAGATGGAGG - Intronic
1077588422 11:3472616-3472638 CTATCTGACTGTATAGAGGTGGG + Intergenic
1077748906 11:4941421-4941443 GTTTGTGTATTTACAGAGGTAGG - Intronic
1078334872 11:10455507-10455529 CTGTGTGTGTGGATGGGGGTGGG + Intronic
1078350126 11:10586154-10586176 CTGTGTGTGTGTGTGGAGGGTGG + Intronic
1078943418 11:16034946-16034968 CTGTTTGTATCTATAGAAGTGGG - Intronic
1079821542 11:25137212-25137234 TTGTGTGTGTGTATACATGTAGG + Intergenic
1079957314 11:26881503-26881525 CTTTGTGAATGTATAAAGCTGGG - Intergenic
1080395294 11:31884553-31884575 CTGTGTGTCTGTGGAGAGGAGGG + Intronic
1080397947 11:31907133-31907155 GTGTGTGTGTGTGTAGAGATGGG + Intronic
1081536666 11:44001817-44001839 GTGTGTGTGTGTGTAGAGGGTGG + Intergenic
1081838782 11:46179702-46179724 GTGTGTGTATGTGTAGTTGTAGG + Intergenic
1082902686 11:58272792-58272814 CTGTGTGTCTGTGGAGAGGACGG + Intergenic
1083053454 11:59797137-59797159 ATGTCTGTATGTAGAGATGTAGG + Intronic
1083517067 11:63270000-63270022 CTGTCTGTATGTCAAGAGTTTGG - Intronic
1083877451 11:65531780-65531802 TTGTGTGTATGTTCAGGGGTGGG - Intronic
1084137223 11:67193853-67193875 ATGTATGTATGTATTGAGATGGG - Intronic
1084526268 11:69700110-69700132 CTGTGTATATATATAGTTGTGGG - Intronic
1084908690 11:72369763-72369785 CTGTGTGTGTGTATGTATGTGGG + Intronic
1084947760 11:72647921-72647943 GTCTGTGTATCTATAGGGGTTGG + Intronic
1085413922 11:76307733-76307755 CTGTGTGTGTGTTGGGAGGTGGG - Intergenic
1085449283 11:76622403-76622425 CTGTGTGTGCGTGTGGAGGTTGG - Intergenic
1085470075 11:76752283-76752305 GTGTGTGTATGTTTGGGGGTGGG + Intergenic
1085633697 11:78141162-78141184 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
1086076724 11:82862575-82862597 CTGTGTGTGTAGATAGAGCTGGG - Intronic
1086835999 11:91623660-91623682 GTGTGTGTATGTATATATGAAGG + Intergenic
1087301076 11:96436494-96436516 GTGTGTGTGTGTGTAGATGTGGG + Intronic
1087420175 11:97912973-97912995 GTGTGTGTGTGTATAATGGTTGG + Intergenic
1087463479 11:98474449-98474471 GTGTGTGTGTGTGTAGAGGATGG - Intergenic
1087843688 11:102946901-102946923 CTGTGTGTATGTAGAGATGGAGG + Intronic
1087984947 11:104666520-104666542 CTGTGTGTATGTCGTGGGGTGGG + Intergenic
1089508623 11:118981291-118981313 CTGTGTGTGTCTGTGGAGGTGGG + Exonic
1091504103 12:1049659-1049681 CAGTTTGAATGGATAGAGGTTGG + Intronic
1092657841 12:10706130-10706152 ATGTGTGTATATATATATGTGGG + Intronic
1092820735 12:12351033-12351055 GTGTGTGTGTTTATGGAGGTGGG - Intergenic
1092855767 12:12672387-12672409 TTGTGTGAATGTAGGGAGGTAGG - Intronic
1093294128 12:17366877-17366899 GTGTGTGTAGGAATAGGGGTAGG - Intergenic
1093571100 12:20666875-20666897 CTGTTTGTAGGTATATAAGTTGG - Intronic
1093843123 12:23930420-23930442 CTGTATATATTTATAGAGGGAGG + Intronic
1095195072 12:39305055-39305077 CTTTGTATATGTTTAGAGATGGG + Intronic
1095477788 12:42603513-42603535 ATGTGTGCATGCATAGAGGGTGG - Intergenic
1095551414 12:43445669-43445691 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1096079090 12:48822112-48822134 GTGTGTGTGTGTATAGGGGAAGG - Intronic
1096216586 12:49801161-49801183 CTGTGTGTGTGTATGGGGGAGGG - Intronic
1096598574 12:52713969-52713991 CTGTTTGTTTGTTTAGAGATAGG + Intergenic
1096706630 12:53425956-53425978 CTGTGTGTATGTATAGAGGTGGG + Intronic
1097298318 12:57991175-57991197 GTGTGTGTGTGTATAGTGGGGGG + Intergenic
1097804630 12:63951930-63951952 TTGTGTGTGTGTGTGGAGGTGGG + Intronic
1098576706 12:72050966-72050988 ATGTGTCAATATATAGAGGTCGG + Intronic
1098627437 12:72689770-72689792 GTGTGTGTGTGTGTAGAGGTGGG - Intergenic
1098782452 12:74703974-74703996 ATGTATGTATGTATATAGTTGGG - Intergenic
1099201709 12:79685872-79685894 TTGTGTGTATGTATATATCTAGG - Intronic
1099477629 12:83126658-83126680 ATGTGAGTATGTATATGGGTGGG + Intronic
1099835042 12:87899046-87899068 CTGTGTGTATGTGTGATGGTTGG - Intergenic
1100155819 12:91799113-91799135 ATGTGTGTATATATAGGGGATGG - Intergenic
1100304850 12:93340951-93340973 ATGTGTGTGTGTGTAGAGATGGG + Intergenic
1100363803 12:93900909-93900931 GTGTGTGTGTGTGTGGAGGTGGG - Intergenic
1100519829 12:95363202-95363224 GTGTGTGTATGTGTAGATGGAGG - Intergenic
1100863139 12:98828748-98828770 CTGTATGAATGTATAGACTTGGG + Intronic
1101397372 12:104360142-104360164 ATCTATGTATGTGTAGAGGTTGG - Intergenic
1101662690 12:106779894-106779916 GTGTGTGTGTGTGTAGAGTTGGG + Intronic
1103143066 12:118568101-118568123 ATGTATGTATGTATATATGTAGG + Intergenic
1103219151 12:119229110-119229132 CTATGTATATGTATATATGTTGG + Intergenic
1104039548 12:125120902-125120924 GTGTGTGCATGTATAGGTGTCGG + Intronic
1105601265 13:21890058-21890080 GTGTGTGCATGTGTAGATGTGGG - Intergenic
1106861723 13:33916654-33916676 CTGTGTGTCTGTGTATATGTAGG + Intronic
1107021804 13:35759796-35759818 ATGTGTGTATGTGTTGGGGTAGG - Intergenic
1107022097 13:35762655-35762677 GTGTGTGTATGTATGAATGTAGG - Intergenic
1107753408 13:43593659-43593681 GTGTGTGTGTGTACAGAGATTGG - Intronic
1108163049 13:47662796-47662818 ATGTGTGTATGTATGTATGTAGG - Intergenic
1108306623 13:49142494-49142516 GTGTGTGTATGTGGAGTGGTAGG - Intronic
1108537813 13:51404049-51404071 GTGTGTGTATTTGTAGAGATAGG - Intronic
1108611136 13:52084805-52084827 GTGTGTGTGTGTTTAGAGCTAGG + Intronic
1108680313 13:52774446-52774468 CTGTGTGTATATGAAGAAGTGGG + Intergenic
1108687891 13:52836679-52836701 GTGTGTGTGTGTTTAGAGATGGG + Intergenic
1109504233 13:63278627-63278649 TTGTGTGTGTGTATATATGTAGG - Intergenic
1109725701 13:66338630-66338652 GTGTGTGTGTGTAGAGGGGTGGG + Intronic
1110160963 13:72378258-72378280 GTGTGTGTGTGTGTATAGGTAGG - Intergenic
1110202579 13:72869800-72869822 ATGTGTGTGTGTGTGGAGGTGGG - Intronic
1110300245 13:73918071-73918093 GTGTGTGTGTGTGTAGATGTTGG - Intronic
1110685401 13:78367272-78367294 ATGTGTGTATCTATAGAGAGAGG - Intergenic
1110828553 13:80002295-80002317 CTGTGTGTATGTTGAGGGGAGGG - Intergenic
1111011344 13:82318856-82318878 ATGTGTGTATGTATACACGGGGG + Intergenic
1111315299 13:86549028-86549050 GTGTCTGTATTTATAGATGTAGG + Intergenic
1112554929 13:100458286-100458308 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1112554934 13:100458353-100458375 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1112986283 13:105454166-105454188 TTGTGTGTATGGTGAGAGGTAGG + Intergenic
1113296332 13:108963270-108963292 CTATGTGCATGTATTTAGGTAGG + Intronic
1113468414 13:110527886-110527908 GTGTGTGTATTTGTAGAGATAGG - Intronic
1113468713 13:110530126-110530148 CCCTGTGTCTGTGTAGAGGTGGG - Intronic
1113468730 13:110530173-110530195 CCCTGTGTCTGTGTAGAGGTGGG - Intronic
1113468938 13:110530795-110530817 CCCTGTGTCTGTGTAGAGGTGGG - Intronic
1113535149 13:111060343-111060365 GTGTGTGTGTGTGTAGAGATTGG - Intergenic
1113865659 13:113521118-113521140 CTGTGTGTGTGTGTGTAGGTAGG + Intronic
1114536035 14:23423414-23423436 TTGTGTTTATGTTTAGAGGGGGG - Intronic
1114621093 14:24096612-24096634 CTGTGTGGAAGTATACATGTAGG - Intronic
1115221022 14:31058565-31058587 GTGTGTGTGTGTTTAGAGATAGG + Intronic
1115344869 14:32331695-32331717 GTGTGTGTGTGTATAGGGGAAGG + Intronic
1115398439 14:32934336-32934358 GTGTGTGTGTGTGTAGAGGGGGG + Intergenic
1115637349 14:35303335-35303357 CAGTGTTTATATATAGAAGTTGG + Intronic
1115976537 14:39002997-39003019 ATTAGTGTATGTACAGAGGTAGG + Intergenic
1116970918 14:51065172-51065194 CTGTGTGTATATGTACATGTGGG + Intronic
1117393352 14:55284002-55284024 GTGTATGTATTTTTAGAGGTAGG + Intronic
1117492782 14:56268783-56268805 CTGTGTGTGTGTGTTGAGATGGG + Intronic
1117782198 14:59244726-59244748 GTGTGTGTGTGTATTTAGGTTGG + Intronic
1118116530 14:62783187-62783209 ATGTGTGTATGTTTGGGGGTGGG - Intronic
1118519418 14:66565300-66565322 GTGTGTGTGTGTTTTGAGGTGGG + Intronic
1118906020 14:70023843-70023865 GTGTGTGTGTGTGTAGGGGTAGG + Intronic
1119093007 14:71801788-71801810 TTCTGTGTATGTATGGGGGTGGG + Intergenic
1119327671 14:73771049-73771071 GTGTGTGTGTGTTTGGAGGTGGG - Intronic
1119625157 14:76167747-76167769 ATGTGTGTGTGTGTACAGGTAGG + Intronic
1119736029 14:76982794-76982816 GTGTGTGTGTGTGTAGAGATAGG + Intergenic
1120063981 14:80018241-80018263 GTGTGTGTGTGTGTGGAGGTGGG - Intergenic
1120120257 14:80670411-80670433 CTGTGTGTATGTATATAAATAGG - Intronic
1120303630 14:82739174-82739196 GTGTGTGTATGTATAGTGGTTGG + Intergenic
1120433484 14:84449773-84449795 CTGTGTGTATGTTTTGGGGGTGG - Intergenic
1120631594 14:86898375-86898397 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1121847099 14:97181398-97181420 ATGTGTGTATGTGTACATGTGGG - Intergenic
1121847108 14:97181615-97181637 ATGTGTGTATGTGTACATGTGGG - Intergenic
1122268071 14:100556009-100556031 CTATGTGTATGTAGTGAGGGAGG + Intronic
1122649628 14:103219514-103219536 GTGTGTGTGTGTGTAGAGGTAGG + Intergenic
1122714131 14:103683614-103683636 CTGTGTGTCTTTACAGAGGATGG - Intronic
1123080260 14:105689570-105689592 GTGTGTGTATATATAGGGGTAGG - Intergenic
1123496680 15:20833815-20833837 CTGTGTGTGTTTACACAGGTGGG - Intergenic
1123553915 15:21407407-21407429 CTGTGTGTGTTTACACAGGTGGG - Intergenic
1123590159 15:21844772-21844794 CTGTGTGTGTTTACACAGGTGGG - Intergenic
1123804143 15:23854058-23854080 CTGTGTGTATGTGTGGGGGGTGG + Intergenic
1124217752 15:27823024-27823046 CTGTGTGTACGGAATGAGGTAGG + Intronic
1124467981 15:29956706-29956728 GTGTGTGTATATGTAGAGGCAGG - Intronic
1124707573 15:31978136-31978158 CTTTCTGTCTGTGTAGAGGTTGG - Intergenic
1124888017 15:33705047-33705069 GTGTGTGTATGTGTTGGGGTAGG - Intronic
1125135951 15:36342835-36342857 CTGTGTGTATGTGTATATGAGGG - Intergenic
1125511676 15:40295483-40295505 CAGTGTGTATGCACAGGGGTGGG + Intronic
1126222321 15:46228722-46228744 CTGTGTGTGTGTTGAGGGGTTGG - Intergenic
1126355185 15:47787956-47787978 GTGTGTGTTTGTATAGGGGTGGG + Intergenic
1126364140 15:47876530-47876552 GTGTGTGTATGTGTAGATGGAGG - Intergenic
1126833550 15:52635520-52635542 GTGTGTGTGTGTGTAGAGGCAGG - Intronic
1126925118 15:53576597-53576619 ATGTGTGTATTTTTAGGGGTGGG - Intronic
1127453773 15:59140076-59140098 GTGTGTGTGTGTATGGGGGTGGG + Intronic
1127628402 15:60802603-60802625 GTGTGTGTATGTGTATACGTGGG + Intronic
1128049762 15:64653714-64653736 TTGTGTGTTTGTTTAGGGGTTGG - Intronic
1128947319 15:71836258-71836280 GTGTGTGTATATATACATGTTGG - Intronic
1129795579 15:78373806-78373828 GTGTGTGTATATATAGAGATGGG + Intergenic
1130147588 15:81286148-81286170 CTGTGGGAATGTCTGGAGGTAGG + Intronic
1130168536 15:81487284-81487306 GTGTGTGTGTGTTTAGAGGGAGG - Intergenic
1130858114 15:87859983-87860005 GTGTGTGTATGTATGGACATAGG - Intronic
1131107780 15:89746496-89746518 CTGTGTGTGTGTGTGGAGGCGGG - Intergenic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1131107862 15:89746926-89746948 GTGTGTGTGTGTGTGGAGGTGGG - Intergenic
1131484133 15:92806568-92806590 TAGTGTGTATGTATGTAGGTAGG + Intronic
1131647992 15:94366768-94366790 CTCTGTTTATGTATGCAGGTGGG - Intronic
1132166945 15:99602686-99602708 GTGTGTGTGTGTGTAGGGGTGGG + Intronic
1132166964 15:99602786-99602808 GTGTGTGTGTGTGTAGGGGTGGG + Intronic
1202962261 15_KI270727v1_random:134603-134625 CTGTGTGTGTTTACACAGGTGGG - Intergenic
1132676357 16:1122930-1122952 CTGTGGGTGGGTATGGAGGTAGG - Intergenic
1133542773 16:6772502-6772524 GTGTTTGTATGTATATGGGTGGG + Intronic
1133542783 16:6772570-6772592 GTGTGTGTATGTATATGGGTGGG + Intronic
1133542908 16:6773500-6773522 CTATGTGTATGTGTAGGAGTTGG + Intronic
1133589288 16:7227287-7227309 CTGTGTGTGTGTGTGGGGGTGGG - Intronic
1134388780 16:13798885-13798907 ATGTGTATAGGTATAGATGTAGG + Intergenic
1135577721 16:23598835-23598857 ATGTATGTATTTATAGAGATGGG + Intergenic
1135662216 16:24306641-24306663 GTGTGTGTATGTGTTGGGGTAGG - Intronic
1136143147 16:28299919-28299941 CTGTGTGGAGGCCTAGAGGTGGG - Intronic
1136177528 16:28527969-28527991 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1136618988 16:31415516-31415538 CTGGGTGTGTGGATGGAGGTGGG - Intronic
1137390939 16:48081117-48081139 CAGTGTGACAGTATAGAGGTAGG - Intergenic
1137798584 16:51242230-51242252 CTGGGTGGATGTATGGAGGAAGG + Intergenic
1138957874 16:61992954-61992976 TTGTGTGTGTGTATGGAGGTGGG + Intronic
1139255815 16:65541351-65541373 ATGTGTGTATGTATATATGTAGG + Intergenic
1139609485 16:68045263-68045285 CTGTGTGTATATGTATGGGTGGG + Intronic
1140700541 16:77577416-77577438 GTGTGTGTGTGTATAATGGTGGG + Intergenic
1141216414 16:82028866-82028888 ATGTGTGTATATATATAGATGGG - Intergenic
1141391286 16:83666808-83666830 GTGTGTGTATGTGTGGAGGTGGG - Intronic
1141498224 16:84425073-84425095 GTGTGTGTATGTATTGAGGGGGG - Intronic
1142363846 16:89639530-89639552 GTGTGTGTGTGTGCAGAGGTGGG - Intergenic
1142778454 17:2161038-2161060 TTGTATGTATGTATGTAGGTAGG + Intronic
1143334577 17:6162695-6162717 CTGTGTGTGTGTGTGGGGGTGGG - Intergenic
1143348396 17:6267515-6267537 GTGTGTGTGTGTGTAGAGGTGGG - Intergenic
1143462581 17:7113277-7113299 GTGTGTGTGTGTGTAGAGGTGGG - Intronic
1143615863 17:8048705-8048727 TTGTGTGTGTGTATGGTGGTGGG - Exonic
1143895572 17:10133905-10133927 CATTGTGTATATATACAGGTTGG + Intronic
1143969479 17:10784933-10784955 GTATGTGTATGTATGGAGGGAGG + Intergenic
1144922212 17:18773496-18773518 TTGTGTGTGTGTATGTAGGTGGG + Intronic
1145364980 17:22253607-22253629 CTATGTTTATATACAGAGGTTGG - Intergenic
1146449716 17:32963114-32963136 GTGTGTGTGTGTATGGAGGGAGG + Intergenic
1146492888 17:33294568-33294590 CTGTGTGGATGTATGTATGTGGG - Intronic
1146519656 17:33516418-33516440 GTGTGTGTGTGTATGGAGGAGGG + Intronic
1147179717 17:38676553-38676575 GTGTGTGTGTGTGTAGAGGTGGG - Intergenic
1147311030 17:39596373-39596395 CTGTGTGTATGTGTGTATGTGGG + Intergenic
1147543959 17:41384391-41384413 GTGTGTGTATGTTTAGATATAGG + Intronic
1147608800 17:41789252-41789274 GTGTGTGCATGTGTGGAGGTGGG - Intergenic
1147846270 17:43406229-43406251 TTATGTGTTTGTGTAGAGGTTGG + Intergenic
1148518124 17:48241344-48241366 CTGTGTGCATGTGTGGAGGTGGG + Intronic
1148686444 17:49503673-49503695 CTGGGCGTATGTGTGGAGGTGGG + Intronic
1148928178 17:51106094-51106116 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1149397493 17:56259899-56259921 GTGTGTGTGTGTTTGGAGGTGGG - Intronic
1149481591 17:57007810-57007832 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1150448998 17:65250097-65250119 GTGTGTGTGTGTTTAGGGGTGGG - Intergenic
1150900593 17:69272299-69272321 CTGTGTGTATATATATTGGGTGG - Intronic
1151208933 17:72529287-72529309 CTGTGTGTGTGTAGGGGGGTGGG - Intergenic
1151343220 17:73485187-73485209 GTGTGTGTATGTGGAGAGGTGGG + Intronic
1151622808 17:75256948-75256970 CTGTTAGACTGTATAGAGGTGGG - Intronic
1152493296 17:80652499-80652521 GTGTGTGCATGTGTAGAGATAGG + Intronic
1152656573 17:81522657-81522679 CTGTGTGTGTGTGTAGATGCAGG + Intronic
1153680545 18:7496631-7496653 CTGTGTGTGTGTATATAGTCAGG + Intergenic
1154045547 18:10901405-10901427 GTGTGTGTGTGAATAGAAGTAGG - Intronic
1154061344 18:11063515-11063537 ATGTGTATATCCATAGAGGTAGG - Intronic
1154454590 18:14509499-14509521 CTGTGTGTGTTTACACAGGTGGG - Intronic
1154929711 18:20980449-20980471 CATTGTCTGTGTATAGAGGTGGG + Intronic
1155254795 18:23985713-23985735 CTCTGTATATATATAGAGGGAGG + Intergenic
1155767935 18:29659154-29659176 GTATGTGTATGTATGGGGGTGGG + Intergenic
1156044972 18:32867875-32867897 GTGTACGTATGTATAGAGATTGG + Intergenic
1156627817 18:38931013-38931035 GTGTGTGTGTGTGTGGAGGTGGG + Intergenic
1157017022 18:43727510-43727532 CTATGTGTAGGAATATAGGTTGG + Intergenic
1157751756 18:50184865-50184887 GTGTGTGTGTGTGTAGAGATAGG - Intronic
1157881472 18:51325039-51325061 CTGTGTGTGGGCAGAGAGGTGGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158424760 18:57328952-57328974 CGTTGTGTTTGAATAGAGGTGGG - Intergenic
1158775941 18:60579807-60579829 ATGTGTGTATCTCTATAGGTTGG + Intergenic
1159181491 18:64912411-64912433 GTGTGTGTTTGTATGCAGGTGGG + Intergenic
1159351793 18:67284733-67284755 TTTTATGTATGTATAGATGTAGG - Intergenic
1159443902 18:68516417-68516439 GTGTGTGTGTGTGTATAGGTGGG - Intergenic
1159556464 18:69951001-69951023 GTGTGTGTGTGTGTAGAGGTGGG + Intronic
1160367136 18:78335742-78335764 CTGTGTTTCAGTTTAGAGGTTGG + Intergenic
1160731323 19:642878-642900 CTGTGTGTGTGTATGGCGGGGGG - Intronic
1161125924 19:2557004-2557026 GCGTGTGTGTGTGTAGAGGTGGG - Intronic
1161772677 19:6239669-6239691 GTGTGTGTTTGTACACAGGTAGG - Intronic
1161838767 19:6665811-6665833 GTGTGTGTGTTTGTAGAGGTGGG + Intronic
1162529131 19:11225512-11225534 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1163014214 19:14443881-14443903 GTGTGTGCATGTACAGATGTGGG - Intronic
1163122635 19:15227239-15227261 CTGTGTGTGAGTATAGGGGTTGG + Exonic
1163209926 19:15832695-15832717 CTGTGTGTAAGGAAAAAGGTTGG - Intergenic
1163778265 19:19230915-19230937 GTGTGTGTGTGTGTAGAGATGGG + Intronic
1164293088 19:23884997-23885019 CTATCTGAAGGTATAGAGGTAGG + Intergenic
1164457255 19:28419102-28419124 GTGTGTGTGTGTGTAGAGGTGGG - Intergenic
1164749708 19:30643682-30643704 CTGTGTGGAAGCATGGAGGTGGG + Intronic
1164810126 19:31148927-31148949 TTGTTTGTTTGTGTAGAGGTGGG + Intergenic
1165409583 19:35651094-35651116 CTCTGTGTATGTTGAGAGGCAGG + Intronic
1165454861 19:35904469-35904491 CTGTGGGTCTGTATCGCGGTAGG + Exonic
1166352380 19:42205910-42205932 CTGTGTGTTTTTTTAGAGGCAGG - Intronic
1167256068 19:48429727-48429749 GTGTGTGTGTGTGTAGAGATGGG + Intronic
1167277612 19:48548332-48548354 CTGAGTGGATGAATAGAGGATGG + Intergenic
1167320014 19:48791583-48791605 ATGTGTGTATATATATATGTAGG + Intergenic
1167902469 19:52632153-52632175 CTGTCAGACTGTATAGAGGTGGG - Intronic
925363362 2:3294935-3294957 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363369 2:3294974-3294996 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363437 2:3295321-3295343 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363498 2:3295619-3295641 GTGTGTGTATGTAGAGAGGATGG - Intronic
925363517 2:3295719-3295741 GTGTGTGTATGTAGAGAGGATGG - Intronic
925363642 2:3296303-3296325 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925433090 2:3814025-3814047 CTGTGTGTTTTTATAGTGGCTGG + Intronic
925465727 2:4106050-4106072 CTGTGTGTGTGTTGAGGGGTGGG + Intergenic
925536539 2:4924297-4924319 CTGTGTGAGTGTATGTAGGTAGG + Intergenic
925567052 2:5267696-5267718 CTGTGTGTGTGTGTTGCGGTGGG - Intergenic
926487691 2:13482968-13482990 GTGTGTGTGTGTATAAAGTTTGG + Intergenic
926646353 2:15293921-15293943 CTCAGTGTATGCATAGAGGTAGG - Intronic
926653095 2:15367949-15367971 CTGTGTGAATATACAGAGGAAGG - Intronic
927831701 2:26356949-26356971 GTGTGTGTGTGTGTGGAGGTAGG - Intronic
929741256 2:44603027-44603049 GTGTGTGTGTATATATAGGTTGG - Intronic
930491711 2:52082071-52082093 CTTTATGTATGGATACAGGTAGG + Intergenic
930759163 2:55013577-55013599 CTGTGTGTATGTTTTTTGGTGGG + Intronic
932607139 2:73172867-73172889 CTGTGTGCATGTATGGGGCTGGG - Intergenic
933829119 2:86192225-86192247 GTGTGTGTGTGTGTAGAGATAGG - Intronic
935226311 2:101055977-101055999 ATGTGTGTATTTTTAGAGATGGG - Intronic
935317729 2:101853328-101853350 GTGTGTATATGTATATATGTAGG - Intronic
935637240 2:105258722-105258744 GTGTGTGTGTGTGTAGGGGTGGG - Intergenic
935909345 2:107878350-107878372 CAGTGTGCATGTCTAGAAGTGGG - Intronic
936488443 2:112947577-112947599 CTGTGTGTATCTAAAGAGAGTGG - Intergenic
937176480 2:119941427-119941449 GTGTGTGTGTGTATAGAGTTTGG + Intronic
938012198 2:127837814-127837836 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
938477602 2:131630080-131630102 CTGTGTGTGTTTACACAGGTGGG + Intergenic
938734162 2:134171344-134171366 CTGTGTGTATATATTAATGTAGG + Intronic
939354812 2:141087496-141087518 CTGTGTGAATATTTGGAGGTTGG - Intronic
939721503 2:145658523-145658545 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
939917973 2:148071316-148071338 GTGTGTGTATGTGTAGATATGGG + Intronic
940558097 2:155257956-155257978 CTGTGTATATGTATAAAGAAAGG - Intergenic
941352109 2:164449726-164449748 TTGTGTGTGTGTATTCAGGTAGG - Intergenic
941751007 2:169135469-169135491 CTGTCGGACTGTATAGAGGTGGG - Intronic
941878887 2:170461822-170461844 GTATGTATATGTATGGAGGTCGG + Intronic
942561670 2:177226531-177226553 GTGTGTGCATGTGTGGAGGTGGG - Intergenic
943888003 2:193247923-193247945 CTGTGTGTGTGTCTGGAGATGGG - Intergenic
944014560 2:195019558-195019580 GTGTGTGTGTGTATGGAGGGGGG - Intergenic
944066939 2:195629213-195629235 GTGTGTGTATTTTTAGAGATGGG - Intronic
944239615 2:197473172-197473194 TTGTGTGGATGTATGTAGGTGGG - Intronic
944917167 2:204372937-204372959 CTGTGTGTCTATTTAGAGTTTGG - Intergenic
945192821 2:207207791-207207813 ATGTGTGTATGTCTAGATGATGG - Intergenic
945856434 2:215074545-215074567 GTCTGTGTATTGATAGAGGTTGG + Intronic
945956377 2:216090039-216090061 GTCTGTGTGTGTACAGAGGTTGG + Intronic
946076890 2:217081623-217081645 GTGTGTGTGTGTGTAGTGGTTGG - Intergenic
946088138 2:217195167-217195189 CTGTGTGTGTGTGTAGGGGGTGG - Intergenic
946545596 2:220739150-220739172 GTGTGTGTATATATAAAGGCTGG - Intergenic
946658509 2:221975157-221975179 TTGTGTGTATGTAGAGGGGAAGG - Intergenic
947296047 2:228631751-228631773 GTGTGTGTGTGTGTAGGGGTAGG + Intergenic
947771974 2:232677199-232677221 GTGTGTGTGTGTGTAGAGATGGG - Intronic
947947355 2:234117188-234117210 GTGTGTGTATATATATATGTAGG + Intergenic
948018686 2:234712326-234712348 CTATCTGTATGGATAGAAGTGGG + Intergenic
949029919 2:241789313-241789335 CTGTGTGTGTGTATAGTTGAAGG + Intronic
1168868529 20:1109296-1109318 CTGTGTGTATGTAGGGTGGTGGG - Intergenic
1169269642 20:4189173-4189195 GTGTGTGTGTGTATGTAGGTAGG - Intergenic
1169973060 20:11291689-11291711 TTGTGTGTATGTGTAGAGATAGG - Intergenic
1170113311 20:12828846-12828868 ATGTGTGTATATATAGAGTGTGG + Intergenic
1170265211 20:14459510-14459532 ATGTGTGTATGTATGTAGGTAGG + Intronic
1170615416 20:17945217-17945239 CTGTGTGTAGGTCTAGAGGAAGG - Intronic
1171034612 20:21705475-21705497 GTGTGTGTGTGTAGAGGGGTGGG + Intergenic
1171098913 20:22363689-22363711 CTGTGTGTGTGTGTGGGGGTGGG - Intergenic
1171177929 20:23068162-23068184 GTGTGTGTTTTGATAGAGGTCGG + Intergenic
1171198117 20:23217412-23217434 GTGTGTGTATATATAGATATAGG + Intergenic
1171882370 20:30627948-30627970 CTGTGTGTGTTTACACAGGTGGG - Intergenic
1172281190 20:33709709-33709731 GCGTGTTTCTGTATAGAGGTGGG - Intronic
1172281311 20:33710172-33710194 GTGTGGTTCTGTATAGAGGTAGG - Intronic
1172606148 20:36215460-36215482 CTATGTGTATGTCAGGAGGTTGG - Intronic
1173379052 20:42521051-42521073 ATGTATGTATGTATATAGGTAGG - Intronic
1173547405 20:43909456-43909478 GTGTGTGTATGTATGTAGGAAGG + Intergenic
1173584914 20:44175307-44175329 CTTTCTGTATGAATATAGGTGGG + Intronic
1173706330 20:45112942-45112964 CTGTGTGTATGTATCTATGTGGG - Intronic
1174482017 20:50837961-50837983 GTGTGTGTGTGTGTAGAGGTGGG - Intronic
1174500296 20:50979355-50979377 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1174530617 20:51210512-51210534 CTGTGTATATGTATGAAGGGAGG - Intergenic
1176137782 20:63532431-63532453 GTGTGTGTGTGTGTAGACGTGGG + Intronic
1176819578 21:13643809-13643831 CTGTGTGTGTTTACACAGGTGGG + Intergenic
1176940286 21:14915634-14915656 CTGTGTGTGTGGATGGGGGTGGG + Intergenic
1177020804 21:15855068-15855090 TTGTATATATGTGTAGAGGTGGG + Intronic
1177355982 21:20008365-20008387 GTGTGTGTGTGTAGGGAGGTAGG - Intergenic
1177713128 21:24805759-24805781 CTGTGTGTGTGTATAATGTTAGG - Intergenic
1177784981 21:25661949-25661971 CCGTGGATATGTATAGATGTGGG + Intronic
1177829326 21:26119606-26119628 ATGTGTATATGTACATAGGTAGG - Intronic
1179952440 21:44716781-44716803 GTGTGTGTGTGTTTAGAGATGGG + Intergenic
1180195930 21:46194391-46194413 CTGAGTGAATGTAGAGAGGAGGG - Intronic
1180196055 21:46194988-46195010 CCGTGTGGATGTTTAGAGGTGGG - Intronic
1181468713 22:23125143-23125165 ATGTGTGGAGGTATAGGGGTGGG - Intronic
1182597753 22:31435280-31435302 ATATGTGTATATATGGAGGTGGG + Intronic
1182948252 22:34345423-34345445 ATGTGTGTATGTATAGGGTGAGG - Intergenic
1182985798 22:34714959-34714981 GTGTGTATATGGACAGAGGTGGG - Intergenic
1183119198 22:35717030-35717052 GTGGGTGTATTTCTAGAGGTGGG + Intergenic
1183473318 22:38021244-38021266 CGGTGCGTATGTGTTGAGGTTGG + Intronic
1184615021 22:45632077-45632099 CTTTGTTTATTTATAGAGATGGG - Intergenic
1184825966 22:46951183-46951205 TTGAGTGTATGTATAGTGCTGGG + Intronic
949252628 3:2005644-2005666 CTGTTTGTATTTTTAGAGATGGG - Intergenic
949726473 3:7052550-7052572 CTGTGTGTGTATATGGAGGTGGG - Intronic
950470780 3:13184979-13185001 CTGTTTGTCTGTGTGGAGGTAGG - Intergenic
950636363 3:14317984-14318006 GTGTGTGTTTGTGTGGAGGTCGG + Intergenic
951337524 3:21442905-21442927 GTGTGTGTGTGTTGAGAGGTTGG + Intronic
951400031 3:22221148-22221170 CTGTGTGTACCTATATAGATAGG - Intronic
951635318 3:24767895-24767917 AGGTGTGTATATATAGAGGCTGG - Intergenic
952051337 3:29388062-29388084 CTGTGTGTGTGTAGACAGTTTGG - Intronic
953660998 3:44891504-44891526 GTGTGTGTGTGTGTAGAGGAGGG - Intronic
954555513 3:51514687-51514709 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
954631287 3:52048996-52049018 GTGTGTGTATATATATACGTAGG + Exonic
954849612 3:53589462-53589484 CTGAGTGTATGAATCAAGGTCGG + Intronic
955010401 3:55008878-55008900 GTGTGTGTGTGTATAGAGGGAGG - Intronic
955011218 3:55016561-55016583 CTGTGTGCATGCATGTAGGTGGG + Intronic
955206770 3:56903055-56903077 GTGTGTGTATGTTTAGAGAGGGG - Intronic
955628391 3:60945705-60945727 CTGTGGGGATGGATACAGGTAGG + Intronic
956252039 3:67244579-67244601 GTGTGTGTGTGTATGGGGGTGGG - Intergenic
956276996 3:67512912-67512934 ATGTGCGTATATATAGAGGGGGG - Intronic
956298176 3:67737575-67737597 ATGTGTGTATGTTTGGAGGAGGG - Intergenic
956454108 3:69403817-69403839 GTGTGTGTGTGTGTTGAGGTGGG - Intronic
956709581 3:72027582-72027604 CTGTTGGACTGTATAGAGGTGGG - Intergenic
956734459 3:72227465-72227487 GTGTGTGTATGTGTGGAGGTGGG - Intergenic
957741428 3:84275054-84275076 GTGTGTGTATGTAAAGGGGTGGG + Intergenic
957844189 3:85710116-85710138 TATAGTGTATGTATAGAGGTAGG + Intronic
958170665 3:89935618-89935640 CTTTGTGTGTGTATATATGTTGG + Intergenic
959160655 3:102720683-102720705 TTGTGGGTATGCATAGATGTGGG + Intergenic
960378312 3:116929977-116929999 CTGTGTGTAAGCATTGAGGCTGG + Intronic
960390579 3:117073025-117073047 GTGTGTGTGTGTTTAGAGATGGG + Intronic
960517974 3:118623353-118623375 CTGTGTGTATATGTTGAGGGTGG + Intergenic
960804063 3:121565835-121565857 ATGTGTGTATATATATAGCTGGG + Intergenic
961164439 3:124753892-124753914 CTGTCAGACTGTATAGAGGTGGG + Intergenic
961595196 3:128010255-128010277 ACGTGTGTATGTATAGTTGTGGG + Intergenic
961930832 3:130531007-130531029 GTGTGTGTGTGTGTAGAGGAGGG - Intergenic
962233776 3:133690975-133690997 ATGTGTGTGTGTATAAAGTTAGG - Intergenic
962284798 3:134076660-134076682 CTGTGTGTGTGTAAATAGGAGGG + Intronic
962318403 3:134372920-134372942 CTGTGTGTATGGGCAGGGGTTGG + Intronic
962458094 3:135583801-135583823 GTGTGTGTGTGTGTAGGGGTGGG - Intergenic
962809615 3:138949404-138949426 GTGTGTGTGTGTGTAGGGGTTGG + Intronic
962902145 3:139770728-139770750 CTGTGTGCATGTATACCGGTGGG + Intergenic
963464407 3:145660506-145660528 TTGTGTGTGTGTACAGAGTTAGG - Intergenic
963638963 3:147835885-147835907 TTGTGTGTTTGTTTGGAGGTAGG + Intergenic
964289652 3:155163180-155163202 CTATGTGTGTGTATGGAGGGAGG - Intronic
964301001 3:155284808-155284830 CTGTGTGTAAGGAAAAAGGTTGG + Intergenic
964364750 3:155937981-155938003 CTGTGAATATGTATGAAGGTGGG + Exonic
964733462 3:159892007-159892029 CTGTTTGTGTGTATACTGGTTGG + Intronic
966435484 3:179879114-179879136 GTGTGTGTATGTATATGTGTGGG - Intronic
966495325 3:180573560-180573582 GTGTGTGTGTGTATAGAGAGAGG - Intergenic
966585871 3:181623846-181623868 GTGTGTGTGTGTGTAGCGGTGGG - Intergenic
967191451 3:186988546-186988568 CTGTGTGTGTGTTTTGGGGTGGG + Intronic
967670352 3:192226521-192226543 ATGTGTGTATGTATATATGTGGG - Intronic
967878948 3:194285643-194285665 GTGTGTGTGTGTATACAGGAGGG + Intergenic
967936051 3:194728642-194728664 GTGTGTGTGTGTATAGAGATGGG + Intergenic
968229682 3:196997949-196997971 GTGTGTGTGTGTGTAGAGGTTGG + Intronic
969061581 4:4439566-4439588 GTGTGTGTATATATATGGGTAGG - Intronic
969089044 4:4679286-4679308 GTGTGTGTGTGTTTAGAGATAGG - Intergenic
969121117 4:4912037-4912059 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
969348824 4:6586230-6586252 TTGTGTGCATGTGTAGAGATGGG + Intronic
969368815 4:6717567-6717589 GTGTGTGTATATATATATGTGGG + Exonic
970661657 4:18292321-18292343 GTGTGTGTGTGTGTAGGGGTGGG + Intergenic
970805012 4:20020664-20020686 CTGTGTGTGTGTTTTGAGATAGG - Intergenic
970849598 4:20585291-20585313 CTGAGTGTACGTATATATGTTGG - Intronic
970872182 4:20828773-20828795 ATGTGTGTAGGTATGGAGGTAGG - Intronic
973139602 4:46750187-46750209 GTGTGTGTGTGTGTAGAGATGGG - Intronic
973217213 4:47682789-47682811 CTGTGTGACTAGATAGAGGTGGG - Intronic
973366040 4:49210395-49210417 CTGTGTGTGTTTACACAGGTGGG - Intergenic
974713160 4:65630046-65630068 GTGTGTGTGTGTGTAGAGGGAGG - Intronic
974795548 4:66744519-66744541 GTGTGTGTGTGTGTGGAGGTGGG - Intergenic
974936899 4:68419800-68419822 ATGTTGGTATGCATAGAGGTGGG + Intergenic
975329152 4:73094745-73094767 GTGTGTGTATATATACTGGTTGG + Intronic
975735193 4:77373732-77373754 CTGTGTGTGTGTTTGGAGGTGGG + Intronic
975990551 4:80255732-80255754 GTGTGTGTATGTTTATATGTGGG + Intergenic
976056614 4:81076802-81076824 ATGTATGTATGTATATATGTGGG - Intergenic
977540696 4:98315423-98315445 CTGTGTGTGAGTATTGAAGTAGG + Intronic
977598289 4:98908182-98908204 CTGTGTGTATGATTGGGGGTGGG - Intronic
977810743 4:101352809-101352831 GTGTGTGTGTGTGTAGGGGTGGG - Intergenic
978497636 4:109377320-109377342 CTGTGAGTATGTAGAGAGATGGG + Intergenic
978668984 4:111223410-111223432 CTGTGTGTATATATATGTGTTGG + Intergenic
978805622 4:112797295-112797317 CTAGGTGTATGTATAGAAGAAGG - Intergenic
979353498 4:119674313-119674335 GTGTGTGCATGTTTAGGGGTGGG + Intergenic
979535422 4:121814429-121814451 GTGTGTGTATGTATGTGGGTGGG + Intronic
980756325 4:137167935-137167957 CTGTGTGTATGTATACACGCAGG + Intergenic
980756327 4:137167974-137167996 CTGTGTGTATGTATACACGCAGG + Intergenic
981507085 4:145514135-145514157 CAGTGTGTGTGCATAGAGGCTGG + Intronic
981909916 4:149967235-149967257 TTGTGTGTGTGCATAGAGGGCGG - Intergenic
982202535 4:152974477-152974499 ATGTGTGTGTGTGTAGAGGGAGG - Intronic
982230376 4:153203384-153203406 GTGTGTGTGTGTAGAGATGTGGG - Intronic
982261548 4:153498539-153498561 GTGTGTGTATTTTTGGAGGTGGG + Intronic
983141224 4:164152149-164152171 CTTTATGTATGTATATATGTAGG - Intronic
983559525 4:169086887-169086909 GTGTGTGTGTGTATAGAGACAGG - Intergenic
983561109 4:169102456-169102478 CTGTGTGTATTTTTAAATGTAGG - Intronic
984218234 4:176941270-176941292 GTGTGTGTATGTGTAAAGGAGGG + Intergenic
984231054 4:177099553-177099575 ATGTGTGTATGTATATAAGTAGG - Intergenic
984540500 4:181031754-181031776 GTGTGTGTGTGTATATACGTAGG - Intergenic
984915004 4:184715133-184715155 CTGTGTGTATGTTTAGCAGGTGG + Intronic
985218297 4:187675978-187676000 GTGTGTGTGTGTGTAGAGCTGGG + Intergenic
985436841 4:189939082-189939104 CTCTGTGCATATATAGAGGCTGG + Intergenic
985776294 5:1844680-1844702 ATATGTGTAGGTGTAGAGGTAGG - Intergenic
985776302 5:1844758-1844780 ATGTGCGTAGGTATAGATGTAGG - Intergenic
985781165 5:1872549-1872571 GTGTGTGTGTGTGTAGTGGTAGG + Intergenic
986593625 5:9397205-9397227 CTGTGTGGATGTGTATATGTGGG - Intronic
987051612 5:14151402-14151424 GTGTGTGTATGTATGTATGTAGG + Intronic
987617446 5:20294822-20294844 ATGTGTGTATATATATATGTAGG - Intronic
987925112 5:24330843-24330865 CTGTATGTATGTATGTATGTAGG + Intergenic
988636883 5:32994543-32994565 GTGTGTGTGTGTAGAGAGGGAGG - Intergenic
990086527 5:51985579-51985601 GTGTGTGTATGTATATATGGTGG + Intergenic
990577650 5:57138585-57138607 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
991326196 5:65436211-65436233 GTGTGTGTGTGTGTAGAGATGGG - Intronic
991385028 5:66077751-66077773 GTGTGTGTGTGTGTAGAGGGAGG - Intronic
991479288 5:67059797-67059819 CTATGTGTATATATAGATTTAGG + Intronic
991666355 5:69003757-69003779 CTCTGTGTATGTATAATTGTAGG - Intergenic
991709427 5:69393740-69393762 CTGTGTGTGTGTGTAGAGACAGG + Intronic
992025805 5:72667725-72667747 GTGTGTGTGTGTATAGTGTTTGG + Intergenic
992303832 5:75413658-75413680 GTGTGTGTGTGTATAGGTGTTGG - Intronic
992913252 5:81420245-81420267 ATGTGTGTATGTATATGTGTGGG - Exonic
993760736 5:91793576-91793598 CAGTGTGTATATATAGAGAGAGG - Intergenic
993935517 5:93996200-93996222 ATGTGTGTATGTATATATTTAGG - Intronic
994548051 5:101193964-101193986 GTGTGTATATGTATGTAGGTAGG - Intergenic
995783285 5:115800851-115800873 ATGTGTGTATGTATTGATATAGG - Intergenic
995820716 5:116227841-116227863 CAGTGTGTATGTATACCAGTGGG + Intronic
995896818 5:117022738-117022760 TTGTGTGTGTGTTTAGGGGTGGG + Intergenic
996496965 5:124169579-124169601 CTGTGTGTGTGTGTATAGGTGGG + Intergenic
997699969 5:135890375-135890397 CTGGGTGGATGTAAAGAGGGAGG + Intergenic
998158635 5:139800431-139800453 TTGTGTGTGTGTGTAGAGATGGG + Intronic
998314127 5:141164771-141164793 TTGTGTGTGTGTATTGAGATGGG - Intergenic
998852224 5:146362092-146362114 ATGTGTGTGTGTATATAGGCGGG - Intergenic
999174984 5:149625752-149625774 GTGTGTGTGTGTGGAGAGGTGGG - Intronic
999680730 5:154057696-154057718 GTGTGTGTGTGTGTAGAGATGGG + Intronic
1000438181 5:161239170-161239192 GTGTGTGTATGTATGTATGTGGG - Intergenic
1000671911 5:164073493-164073515 GTGTGTCTATGTATGGAGGTTGG + Intergenic
1000747361 5:165050659-165050681 ATATGTGTATATATACAGGTTGG - Intergenic
1001637812 5:173224913-173224935 GTGTGTGTGTGTGTAGAGGTGGG - Intergenic
1001939667 5:175731593-175731615 CTGTGTGTGTGTATGGTGGTGGG - Intergenic
1002999324 6:2316811-2316833 CTGTGTGTGTGTGTGGAGGGTGG + Intergenic
1003036701 6:2646326-2646348 GTGTGTGTCTGTATAGTGGGTGG + Intergenic
1003288129 6:4752850-4752872 GTGTGTGTTTGTAGATAGGTAGG + Intronic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1004205781 6:13590697-13590719 ATGTGTGTATGTTTAGTTGTGGG + Intronic
1004883060 6:20027730-20027752 GTGTGTGTATGTGTATAGGAAGG - Intergenic
1005573700 6:27172154-27172176 GTGTGTGTATGTATATAGGAGGG - Intergenic
1005948356 6:30612111-30612133 ATGTGTGTATATATAGAGAGAGG - Intronic
1006795715 6:36731132-36731154 ATGTGTGTGTGTGTAGGGGTGGG - Intronic
1006872207 6:37261985-37262007 GTGTGTGTGTGTCTAGAGCTCGG + Intronic
1007082404 6:39117068-39117090 ATGTGTGTATGTATATGGGGGGG - Intergenic
1007121193 6:39383335-39383357 TTTTGTGTATGGTTAGAGGTAGG + Intronic
1007837351 6:44683918-44683940 GTGTGTGTGTGTGTAAAGGTTGG - Intergenic
1008323102 6:50142300-50142322 GTGTGTGTGTGTGTAGGGGTTGG - Intergenic
1008551163 6:52632576-52632598 GTGTGTGTGTGTGTAGAGATAGG + Intergenic
1008901751 6:56627281-56627303 CTGTGTATATTTATAGATGCTGG - Exonic
1009468497 6:64002707-64002729 GTGTGTGTGTATATAGAGATAGG + Intronic
1010082376 6:71878832-71878854 ATGTATGTATGTATTGAGATGGG - Intergenic
1010207972 6:73339828-73339850 TTGTGTGTGTGTGTAGGGGTAGG - Intergenic
1010449872 6:75990580-75990602 GTGTGTGTGTGTGTAGAGGTGGG - Intronic
1010738873 6:79475489-79475511 TTGTGTGTAAGTATAGCTGTAGG - Intergenic
1011111426 6:83840918-83840940 GTATGTGTATATATAGAGATAGG + Intergenic
1011807202 6:91085777-91085799 TTGTGTGTGAGCATAGAGGTAGG + Intergenic
1012269492 6:97191127-97191149 CTGTGTGGGAGTAGAGAGGTGGG - Intronic
1013945424 6:115716889-115716911 CTGTGTATATGTGTAGAGTAAGG + Intergenic
1014190549 6:118491186-118491208 GTGTGTGTGTGTATAGATGTTGG - Intronic
1014300033 6:119670281-119670303 GTGTATGTATGTATGGATGTAGG - Intergenic
1014602041 6:123425271-123425293 GTGTGTGTATGTGTAGATGAGGG + Intronic
1014994231 6:128122241-128122263 ATGTGTGCATGTATAGGGGTGGG + Intronic
1015088234 6:129322244-129322266 GTGTGTGTATAAATAGATGTAGG - Intronic
1016837172 6:148489876-148489898 GTGTGTGTGTGTATAGTGTTAGG + Intronic
1017217216 6:151922820-151922842 ATGTGTGTAGATATATAGGTTGG - Intronic
1017324463 6:153130459-153130481 GTGTATGTATGTATAGGGGGTGG - Intronic
1017514696 6:155145616-155145638 CTGTGTGTATGTCAAGTGCTGGG - Intronic
1017613408 6:156215423-156215445 CTTTGTATATGTCTAGAGGTGGG - Intergenic
1019067575 6:169315210-169315232 GTGTGTGTGTGAACAGAGGTGGG - Intergenic
1019067618 6:169315568-169315590 GTGTGTGTGTGAACAGAGGTGGG - Intergenic
1019092723 6:169553020-169553042 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019092736 6:169553088-169553110 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019766704 7:2856704-2856726 CTGTGTGTGTGTGTCTAGGTCGG - Intergenic
1020381520 7:7552739-7552761 GTGTGTGTGTGTAAAGAGATGGG + Intergenic
1021268085 7:18549787-18549809 CTGTGTGTATGTGTGGGTGTGGG - Intronic
1021575769 7:22104409-22104431 GTGTGTGTGTGTATAGAGGCAGG + Intergenic
1022190782 7:28015053-28015075 GTGTGTGTGTGTGTAGGGGTAGG + Intronic
1023173259 7:37410534-37410556 CTGTGTGTGTGTTAAGGGGTGGG - Intronic
1024401616 7:48929971-48929993 ATGTATGTATGTATGTAGGTAGG + Intergenic
1024855117 7:53769962-53769984 ATCTGTGTGTGGATAGAGGTAGG - Intergenic
1024904835 7:54365258-54365280 GCGTGTGAATGTTTAGAGGTTGG - Intergenic
1024954140 7:54898402-54898424 TTGTGTTTATGTATGAAGGTAGG - Intergenic
1025034501 7:55585234-55585256 GTGTGTGTGTGTATGGAGGCTGG + Intergenic
1026257211 7:68722680-68722702 CTATGTTTATGTATATATGTTGG + Intergenic
1026871443 7:73855176-73855198 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1027023239 7:74831490-74831512 GTGTGTGTATGTACAGAGAGAGG - Intronic
1027064690 7:75113810-75113832 GTGTGTGTATGTACAGAGAGAGG + Intronic
1027377804 7:77571725-77571747 TTGTTTGTTTGTTTAGAGGTGGG + Intronic
1027521395 7:79213228-79213250 GTGTGTGTGTGTATATATGTGGG + Intronic
1027629523 7:80585309-80585331 GTGTGTGTGTGTGTGGAGGTGGG + Intronic
1029415738 7:100442104-100442126 ATGTGTGTGTGTCTGGAGGTTGG - Intergenic
1029710634 7:102297386-102297408 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1029852137 7:103473610-103473632 ATGTGTGTATGTACATATGTGGG - Intronic
1031031675 7:116742051-116742073 CTGTGTGCATGTAGAAAAGTTGG + Intronic
1031830816 7:126623088-126623110 CTGTGTGTTGCTATAGATGTGGG - Intronic
1031882522 7:127212831-127212853 CTGTGTGTATTAATAGAAGCAGG - Intronic
1031960966 7:127989475-127989497 CTCTGTGTATGAATAAAGCTAGG - Intronic
1032698687 7:134359838-134359860 TTGTGTGCATGTGTACAGGTGGG - Intergenic
1033066168 7:138156188-138156210 TTTTGTGTGTGTGTAGAGGTGGG - Intergenic
1033094135 7:138414994-138415016 GTGTGTGTGTGTATAGAGATGGG + Intergenic
1033240717 7:139677203-139677225 GTGTGTGTATGTAGAGAGAGAGG + Intronic
1033540664 7:142352973-142352995 GTGTGTGTGTGTGTAGGGGTGGG + Intergenic
1034749243 7:153553545-153553567 TTGTGTGTGTGTGTGGAGGTAGG - Intergenic
1035180592 7:157086554-157086576 CTGTGTATATATGTAGGGGTGGG - Intergenic
1035180601 7:157086590-157086612 ATGTGTGTGTGTATATACGTAGG - Intergenic
1035205642 7:157292443-157292465 GTGTGTGTATGTATATGTGTGGG + Intergenic
1036279771 8:7390878-7390900 CTGTGTGTGTAAATGGAGGTAGG - Intergenic
1036341748 8:7921005-7921027 CTGTGTGTGTAAATGGAGGTAGG + Intergenic
1036480962 8:9139351-9139373 TGGTGTGTATGTAAAGAGATAGG - Exonic
1037113389 8:15194174-15194196 GTGTGTGTGTGATTAGAGGTGGG - Intronic
1037338879 8:17820681-17820703 CTGTGTGTGTGTAGAGGGGGAGG - Intergenic
1037357490 8:18037543-18037565 CTGTGTGTATATATATATTTTGG + Intergenic
1037434538 8:18848640-18848662 TTGTATGTATGTGTAGTGGTGGG + Intronic
1037579797 8:20237997-20238019 CTGTGTGTATACATAGGGGTAGG - Intergenic
1038063565 8:23938391-23938413 GTGTGTGTGTGTGTAGAGGTGGG + Intergenic
1038225373 8:25652101-25652123 CTATGTGTATGTTTACAGGTGGG + Intergenic
1038397425 8:27257445-27257467 GTGTGTGTTTGTATGGGGGTCGG - Intronic
1038516830 8:28194494-28194516 GTGTGTGTGTGTATAGAGAGAGG - Intergenic
1039752462 8:40490994-40491016 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
1039752643 8:40492422-40492444 TTGTGTGTGTGTGTAGAGGTGGG + Intergenic
1040505833 8:48046769-48046791 GTGTGTGTGTGTGTAGAGATGGG + Intronic
1040660248 8:49565174-49565196 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
1040770965 8:50974837-50974859 GAGTGTGTATATTTAGAGGTAGG + Intergenic
1042070899 8:64931957-64931979 GGGTGTGTGTGTATAGTGGTAGG - Intergenic
1042224787 8:66506894-66506916 CTCTGTGTCTATATATAGGTGGG + Intronic
1042663945 8:71185663-71185685 TTGTGTGTATGGTAAGAGGTGGG + Intergenic
1043614434 8:82108058-82108080 GTGTGTGTGTGTATTGGGGTGGG + Intergenic
1044620360 8:94185266-94185288 GTGTGTGTGTGTATTGGGGTAGG - Intronic
1045039740 8:98211754-98211776 GTGTGTGTGTGTGTAGGGGTGGG + Intronic
1045313314 8:101022414-101022436 TTGTGTGTATGTGTAGGGATGGG - Intergenic
1045513144 8:102830849-102830871 CTGTGTGTGTGTGTAGAGACAGG + Intronic
1045652644 8:104355592-104355614 GTGTGTGTATATATAGAGAGAGG + Intronic
1046333488 8:112752929-112752951 GTGTGTGTGTGTACAGAGATAGG + Intronic
1047698041 8:127422730-127422752 TTGTGTGTGTGTGTAGTGGTGGG + Intergenic
1048650929 8:136476880-136476902 CTGTGTGTGTGTTTAGTGTTGGG + Intergenic
1050005110 9:1121293-1121315 ATGTGTGTATTTTTAGAGATAGG + Intergenic
1051359453 9:16269147-16269169 CTGGATGTGTGTGTAGAGGTGGG + Intronic
1052167668 9:25352948-25352970 CTGTGTGTTTGTGGAGAGTTAGG - Intergenic
1052223477 9:26055714-26055736 CTGTCTCTAAGTATAGAGTTGGG + Intergenic
1053202860 9:36164601-36164623 GTGTGTGTGTGTATGGGGGTGGG - Intergenic
1053547727 9:39041485-39041507 GTGTGTGTATGTGTGTAGGTGGG - Intergenic
1054841044 9:69740205-69740227 GTGTGTGTATGTATGTATGTAGG + Intronic
1054865955 9:70001435-70001457 GTGTGTGTATTTATACAGCTTGG + Intergenic
1056342017 9:85645164-85645186 CTATGTATATGTAAAGAGTTTGG + Intronic
1056707363 9:88963099-88963121 CTGTGTGTCTGTCTTTAGGTCGG - Intergenic
1056836669 9:89961256-89961278 CAGTGTGGATGTCTAGAGTTGGG + Intergenic
1057581189 9:96289221-96289243 ATGTGTGTGTGTATGGAAGTGGG + Intronic
1057586122 9:96330304-96330326 CTGTGTGTGTGTATATGTGTGGG - Intronic
1057904905 9:98975796-98975818 CTCTGTGGATGTTTAGAGGAGGG + Intronic
1058160715 9:101567757-101567779 CTGTGTGTATGTGTGCATGTGGG - Intergenic
1058701442 9:107603944-107603966 GTGTGTGTGTGTTTAGAGCTGGG + Intergenic
1059174186 9:112154315-112154337 TTGTGTGTGTGTGTGGAGGTGGG - Intronic
1059400449 9:114066399-114066421 GTGTGTGTGTGTGTAGAGATGGG + Intronic
1059698069 9:116747733-116747755 CTCTGTGTATGTATGGGGGTAGG - Intronic
1060025089 9:120164133-120164155 GTGTGTGTATGTATATATATGGG - Intergenic
1060781105 9:126413842-126413864 GTGTGTGTGTGTATAAGGGTTGG + Intronic
1062028166 9:134350062-134350084 CTGTGTGTGTGTGTAGGGGGGGG + Intronic
1203527781 Un_GL000213v1:105761-105783 CTGTGTGTGTTTACACAGGTGGG - Intergenic
1203449849 Un_GL000219v1:101431-101453 CTCTGTGCATATATAGAGGCTGG - Intergenic
1185593376 X:1293168-1293190 CTGTGTCTATGTAGAAAGGAAGG - Intronic
1185913313 X:4006511-4006533 CTGTGTGTATGTCAGGAGGCAGG + Intergenic
1186364373 X:8875764-8875786 TTAGGTGCATGTATAGAGGTAGG + Intergenic
1187719393 X:22135495-22135517 GTGTGTGTATGTATAGGTGTTGG + Intronic
1187797956 X:23024925-23024947 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1189862818 X:45290835-45290857 ATGTGTGGGTGTATGGAGGTGGG + Intergenic
1190106295 X:47563203-47563225 CTGTGTGTATGTGCAGATGTAGG - Intronic
1190335397 X:49258666-49258688 GTGTGTGTGTGTCTAGAGCTGGG - Intronic
1190816528 X:53934631-53934653 GTGTGTGTGTGTATAGATATAGG - Intergenic
1190914350 X:54799270-54799292 CTGTGTGGATGGGTAGAGGCCGG - Intergenic
1192185084 X:68941288-68941310 GTGTGTGTATGTAGTGTGGTGGG + Intergenic
1192423485 X:71054426-71054448 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1192798634 X:74445196-74445218 ATGTGTGCATGCATTGAGGTGGG + Intronic
1193772180 X:85600893-85600915 CTGTGGGTATGGGTAGGGGTAGG + Intergenic
1195008874 X:100715747-100715769 CTGTGTGTGTGTAGAGAGATGGG - Intronic
1195269045 X:103213019-103213041 GTGTGTGTGTGTATGGAGATGGG + Intergenic
1195770245 X:108343198-108343220 GTGTGTGTATGTACAAAGGCTGG + Intronic
1195841814 X:109182799-109182821 CTATGGGACTGTATAGAGGTGGG - Intergenic
1196307229 X:114118407-114118429 GTGTGTGTATGTATTAAGGGGGG + Intergenic
1196405699 X:115360331-115360353 CTGAGTGCATGGGTAGAGGTGGG - Intergenic
1196669272 X:118348043-118348065 TTGTGTGTGTGTATTGGGGTGGG + Intronic
1197103256 X:122681611-122681633 GTGTGTGTGTGTTTAGAGATGGG + Intergenic
1197241250 X:124125372-124125394 GTGTGTGTATGTGTAGGGGTAGG + Intronic
1197783140 X:130176274-130176296 GTGTGTGTGTGTAGAGAGGGAGG + Intronic
1198046092 X:132904549-132904571 GTGTGTGTGTGTATAGAGACAGG + Intronic
1198436803 X:136625201-136625223 CTGTGTATATGTCAAGGGGTCGG + Intergenic
1198554394 X:137777314-137777336 GTGTGTGTGTGTGTAGAAGTGGG + Intergenic
1198986399 X:142459092-142459114 GTGTGTGTGTGTATAGAGGATGG - Intergenic
1199088233 X:143657050-143657072 GTGTGTGTATATATATAGGTAGG - Intergenic
1199268304 X:145853652-145853674 CTGTGTGTTTGTATGTAGGGAGG + Intergenic
1199363408 X:146948550-146948572 GTGTGTGTATATATATATGTTGG + Intergenic
1199392613 X:147298349-147298371 GTATGTGTGTGTATAGAGATGGG - Intergenic
1201065485 Y:10091266-10091288 CTGTGTGTGTGTGTTGGGGTGGG - Intergenic
1201745913 Y:17373314-17373336 TTGTGTGTGTGTGCAGAGGTGGG - Intergenic