ID: 1096709524

View in Genome Browser
Species Human (GRCh38)
Location 12:53444982-53445004
Sequence GGGCAGTTAAATGTAAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096709524_1096709530 17 Left 1096709524 12:53444982-53445004 CCTCCATTTACATTTAACTGCCC 0: 1
1: 0
2: 1
3: 16
4: 141
Right 1096709530 12:53445022-53445044 TGGATTCTAATTCCTGATTCTGG 0: 1
1: 0
2: 0
3: 11
4: 220
1096709524_1096709527 -3 Left 1096709524 12:53444982-53445004 CCTCCATTTACATTTAACTGCCC 0: 1
1: 0
2: 1
3: 16
4: 141
Right 1096709527 12:53445002-53445024 CCCAGTATTTATTTGCCTTGTGG 0: 1
1: 0
2: 3
3: 18
4: 164
1096709524_1096709531 18 Left 1096709524 12:53444982-53445004 CCTCCATTTACATTTAACTGCCC 0: 1
1: 0
2: 1
3: 16
4: 141
Right 1096709531 12:53445023-53445045 GGATTCTAATTCCTGATTCTGGG 0: 1
1: 0
2: 1
3: 19
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096709524 Original CRISPR GGGCAGTTAAATGTAAATGG AGG (reversed) Intronic
902095824 1:13944587-13944609 AGGCAGATGAAAGTAAATGGAGG + Intergenic
907175422 1:52517086-52517108 GGACAGGTAAATATTAATGGGGG - Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
910004014 1:82372900-82372922 GGGGAGTTAATTGAAAATGCAGG - Intergenic
910115491 1:83727232-83727254 TGTGAGTTAAATGAAAATGGAGG - Intergenic
913371560 1:118105396-118105418 GAGCAGCTAAACATAAATGGAGG - Intronic
914690076 1:150017955-150017977 GGACAGTAATATGGAAATGGAGG - Intergenic
914851831 1:151320331-151320353 GGGCAGTTAAAAGTAACCTGGGG - Intronic
915359925 1:155279673-155279695 GGGCAGATAACTGGAGATGGGGG + Intronic
916412965 1:164565055-164565077 GGGCACTTAAATGTACATTGTGG + Intronic
920137902 1:203785079-203785101 GGGGAGTTTAAAGAAAATGGTGG + Intergenic
920267010 1:204731478-204731500 GGGCAGTTGAAAGTCAAAGGAGG + Intergenic
921489058 1:215752199-215752221 ATGCAGTCAAATGTAAATTGTGG - Intronic
921525739 1:216215498-216215520 GAGCAGAAAAATGTAAATGGTGG - Intronic
921906926 1:220505082-220505104 GGGCATTTAAATGTGACTTGGGG + Intergenic
921933182 1:220772025-220772047 GTGCCATTAAATGAAAATGGTGG - Intronic
1064169160 10:13014588-13014610 GGGAACTGAAATGTCAATGGTGG + Intronic
1066642033 10:37563735-37563757 GGGCAGAAAAATGTAAATTTAGG + Intergenic
1067712554 10:48661624-48661646 CAGCAGTAAAATGTAAATTGGGG + Intergenic
1067722634 10:48740748-48740770 GGGCAGTCAAGTGTGAATCGTGG - Intronic
1080930557 11:36805663-36805685 GTGAGGTTGAATGTAAATGGGGG - Intergenic
1081017144 11:37896507-37896529 GGGTCCTTAAATGTGAATGGAGG + Intergenic
1082129024 11:48464794-48464816 GGCCAGGTAAAAGTACATGGGGG + Intergenic
1084444083 11:69193350-69193372 GGGCATTTAATTGGAAAGGGAGG + Intergenic
1087307183 11:96501222-96501244 GGGAAATTAAGTGTAAATGAAGG - Intronic
1090562940 11:127952437-127952459 GGGCAAGATAATGTAAATGGAGG + Intergenic
1092377732 12:7969615-7969637 GGGAAGATAAATGTCAAAGGAGG + Intergenic
1093849457 12:24018102-24018124 GGGCAGATAAAGGAAGATGGAGG - Intergenic
1096091993 12:48908523-48908545 AGGCAGTTCAATGTGAAGGGTGG - Intronic
1096591041 12:52659425-52659447 GGGCAGTGAAGGGTAAATGGAGG + Intergenic
1096709524 12:53444982-53445004 GGGCAGTTAAATGTAAATGGAGG - Intronic
1097593233 12:61597264-61597286 AGGCAGATAAAAGTAATTGGGGG - Intergenic
1101741700 12:107505135-107505157 GGGCAGTTAGGGGTGAATGGAGG - Intronic
1103597423 12:122032137-122032159 GGGCAGATAACTGAAGATGGGGG - Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1109125084 13:58506926-58506948 GGGAATTTAAATTTAAATGTGGG - Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1122065600 14:99171815-99171837 TTGCAGTAAAATTTAAATGGTGG - Exonic
1202928012 14_KI270725v1_random:10873-10895 GAACAATAAAATGTAAATGGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1124099090 15:26676739-26676761 GGGGAGTGTAATGTAAATGATGG - Intronic
1126284361 15:46994764-46994786 GGGCATTTAAATGTAAATAGAGG + Intergenic
1126662063 15:51043083-51043105 GGGAGGTTACACGTAAATGGAGG + Intergenic
1129487351 15:75887330-75887352 GGGCAGTGAAATGTGAGTGTCGG + Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1131930129 15:97432421-97432443 GAGCAGTTATATTTATATGGGGG - Intergenic
1132358997 15:101196685-101196707 GGGCATTTACATTTAAATTGTGG - Intronic
1136482971 16:30554312-30554334 GGGCAGTAAAAAGACAATGGAGG + Exonic
1137450248 16:48567065-48567087 GGTAAGTAAAATGTAAAAGGAGG - Intronic
1138118887 16:54382278-54382300 GAGCAAATAAATGTAATTGGAGG - Intergenic
1140154743 16:72412331-72412353 GGGCAGTTAACTGAAAAAGTCGG - Intergenic
1140945542 16:79764964-79764986 GGGCAGTTAGATGTCACTGGAGG - Intergenic
1144105327 17:11979325-11979347 GAGCATTTAATTGTGAATGGTGG + Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1147746060 17:42695381-42695403 GGGGACCTAAAAGTAAATGGAGG + Intronic
1158863304 18:61614278-61614300 GAGCAGTATCATGTAAATGGTGG - Intergenic
1160520169 18:79503474-79503496 GAGCAGTTAAGTCTCAATGGTGG + Intronic
1162865376 19:13541907-13541929 GGGCAGGAAAAAGTGAATGGGGG + Intronic
1163806237 19:19399736-19399758 GGGCATTTCACTATAAATGGGGG + Intronic
926964950 2:18399648-18399670 GGTCAGATAAATGTAAATACGGG + Intergenic
928111494 2:28513456-28513478 AGGCAGTTCAATGGAACTGGGGG - Intronic
928112856 2:28524700-28524722 GGGCATTGAAATCTAAGTGGAGG + Intronic
929843519 2:45497417-45497439 GGAAAGTTAAATGGAAATGTGGG - Intronic
931291109 2:60874585-60874607 GTGCAGCAAAATGTTAATGGTGG + Intergenic
931463039 2:62464558-62464580 GGGCAGTTACAGTTAGATGGAGG - Intergenic
937455152 2:122034862-122034884 GGGGATTTAAATATAAAGGGGGG + Intergenic
937658075 2:124399634-124399656 GGTCAATTAAATGTAAAGGATGG + Intronic
942216421 2:173724312-173724334 GGCCAGGTAAATGTAAATTTTGG - Intergenic
946230267 2:218286943-218286965 GGGCAGATAAAGGAAAAGGGAGG - Intronic
948657245 2:239484185-239484207 GGAAAAATAAATGTAAATGGAGG + Intergenic
1168739312 20:174512-174534 GGGCAATAAAATGTATATTGAGG - Intergenic
1168762898 20:361704-361726 ATGCAGTGAAATGTAAATGGAGG + Intergenic
1170325822 20:15153293-15153315 GGGTAGGTAAATGAAAAAGGGGG + Intronic
1170784507 20:19455812-19455834 GGGAAGTCAAATGAAGATGGAGG + Intronic
1175839111 20:62015441-62015463 GGGAAGTTAAATTTAAAAGTTGG - Intronic
1176590036 21:8639534-8639556 GAACAATAAAATGTAAATGGAGG + Intergenic
1180236772 21:46465607-46465629 GGGCACTTTAACGTAAATTGAGG + Intronic
1180272868 22:10616527-10616549 GAACAATAAAATGTAAATGGAGG + Intergenic
949137246 3:582153-582175 GAACAATAAAATGTAAATGGAGG - Intergenic
951003926 3:17595322-17595344 GGGTAGTTTAATAAAAATGGAGG + Intronic
952574372 3:34757136-34757158 GGTCAATAAAATGTAACTGGAGG - Intergenic
955659660 3:61283999-61284021 GGCCAATGAAATGTTAATGGAGG + Intergenic
955987830 3:64593436-64593458 GGGCTGTTTCATGTAAATAGAGG - Intronic
959467983 3:106713737-106713759 GTGCAGAAAAAAGTAAATGGTGG - Intergenic
960535862 3:118813689-118813711 GGGCAGGCAAATGGAAATGGGGG - Intergenic
967393955 3:188985705-188985727 GTGGAGTTAAATGTATATAGAGG - Intronic
969218466 4:5743014-5743036 GGGCAGTTCATTGCAAATTGAGG + Intronic
970549653 4:17166644-17166666 TGGCAGTTAGATGCAAAGGGGGG - Intergenic
976223306 4:82775402-82775424 GGGCAGATAAAGGAAAGTGGGGG + Intronic
978178451 4:105763557-105763579 GGGCAGCATAGTGTAAATGGTGG - Intronic
978520756 4:109612679-109612701 GGGCTGTAACATATAAATGGGGG + Intronic
978714024 4:111820310-111820332 GGCCAGTGAAATGTTCATGGTGG - Intergenic
982823330 4:159971910-159971932 GGACAGTTAAATTTAAAATGAGG + Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
986310004 5:6544680-6544702 GGGCAGTCACATGAAGATGGAGG + Intergenic
990590937 5:57263896-57263918 GGGGAGCTAAAAGCAAATGGGGG - Intronic
991015494 5:61927777-61927799 GGGAAATTAAATATAAATAGTGG - Intergenic
992117073 5:73549231-73549253 GAGCACTTAAAGGGAAATGGTGG + Intergenic
993859608 5:93119125-93119147 GCTCAGTGAAATGGAAATGGTGG - Intergenic
1001025836 5:168223845-168223867 AGACATTTAAATGTTAATGGTGG - Intronic
1002546039 5:179945917-179945939 GGGCAGGGATATTTAAATGGGGG + Intronic
1003261925 6:4525262-4525284 GGTGAATTAAATGCAAATGGAGG + Intergenic
1005062764 6:21792488-21792510 TGGCAGTCAAAGGTAAATGGGGG - Intergenic
1005519044 6:26582385-26582407 GAGCTATTAAATGTAAATTGTGG + Intergenic
1005945528 6:30592640-30592662 GGAAAGTAAAATGCAAATGGTGG + Intronic
1007973925 6:46081065-46081087 GGGCTTTTAAATGTAGCTGGAGG + Intergenic
1008412975 6:51204644-51204666 TTGCATTTAAATGTAAATGGTGG + Intergenic
1010246241 6:73662295-73662317 GGGGAATAAAAAGTAAATGGAGG + Intergenic
1010253967 6:73737032-73737054 TGGCATATAAATCTAAATGGGGG + Intronic
1010651266 6:78457895-78457917 GGGCTGTTAATTGTAAATAGAGG + Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1011406923 6:87025299-87025321 AGGTAGTAAAAAGTAAATGGAGG - Intergenic
1013008112 6:106093769-106093791 GGGCAGATAGATGTAAATGAAGG + Intronic
1015538869 6:134295102-134295124 GGGCAGGAGAATGTCAATGGAGG - Intronic
1016309281 6:142715850-142715872 GGGAAATTACAGGTAAATGGAGG - Intergenic
1016806048 6:148213009-148213031 GGGCAGGAGAATGTAAAAGGAGG - Intergenic
1020460942 7:8429418-8429440 AGGCAGTTGAATGTAAAAGATGG - Intergenic
1020686810 7:11306650-11306672 GGGCCGTTAAAAGTCATTGGAGG + Intergenic
1022234887 7:28451785-28451807 GGGAACTTAAATGTAAAGGTGGG + Intronic
1023021004 7:36011712-36011734 AGGCACTTAAATGAAAATCGGGG - Intergenic
1025217960 7:57076005-57076027 ATACAGTAAAATGTAAATGGTGG + Intergenic
1027678308 7:81187263-81187285 GGGCAATGAAATGCAAGTGGAGG - Intronic
1028147242 7:87331520-87331542 GGGCAGCTAAAAGTAAGTTGGGG - Intergenic
1029881247 7:103812452-103812474 GGGCAATTGAATGGAAATGTCGG + Intronic
1029895193 7:103976275-103976297 GGGCTGTTACAGGCAAATGGGGG + Intronic
1030287076 7:107837648-107837670 GGGCAGTGAAAAATAAATGCAGG - Intergenic
1030871477 7:114761236-114761258 GGGTAGTTAAATGGACATGGTGG - Intergenic
1030896599 7:115068910-115068932 GGGAATTTAAATATGAATGGTGG - Intergenic
1031475195 7:122212606-122212628 GGGACGGTAAATGTAAATGGGGG + Intergenic
1032596212 7:133243416-133243438 GAGGAGTTAAATAGAAATGGTGG + Intergenic
1037541895 8:19880160-19880182 GGGAAGTTAGGAGTAAATGGAGG + Intergenic
1039157654 8:34579691-34579713 TGGCAGATCAATGTAAATTGAGG - Intergenic
1042809380 8:72806985-72807007 GGGCAGATACATCTTAATGGTGG + Intronic
1043009469 8:74863665-74863687 GGGTAGTTAAATGGAAATAAAGG - Intergenic
1045288943 8:100815584-100815606 GGGCAGTTTAATGTAAGTTGGGG - Intergenic
1045440585 8:102205007-102205029 GAGCACTTAAAGGGAAATGGTGG + Exonic
1045534895 8:103018576-103018598 GGTCAGACAAATGGAAATGGTGG + Intergenic
1046048102 8:108987115-108987137 GGCCAGTTAGAAGTGAATGGGGG - Intergenic
1046204009 8:110965573-110965595 GGCCTGTAAAATGTAAATGTTGG - Intergenic
1047997091 8:130347465-130347487 TGACAGTTAAATGTAAATGATGG - Intronic
1048190866 8:132287265-132287287 GGGCAGTGTAATTTAAATGTAGG + Intronic
1048763727 8:137824782-137824804 GGGTAGTTAAAGGAAAAAGGGGG + Intergenic
1051856941 9:21578936-21578958 GGGCTTATAAATGTAATTGGAGG + Intergenic
1056983548 9:91339952-91339974 GGGCAGATAAATGGAAAGGTGGG + Intronic
1057911478 9:99023315-99023337 TGGCAGTTAAATGCAAGTAGTGG + Intronic
1058064585 9:100534876-100534898 TGGCAGTTAAATAGAAATGGTGG - Intronic
1058103640 9:100945355-100945377 GGGCAGGTAAATGTAAAACTGGG - Intergenic
1061180389 9:129022116-129022138 GGACAGTTAAAAGAAAATGGGGG - Intronic
1203620051 Un_KI270749v1:118187-118209 GAACAATAAAATGTAAATGGAGG + Intergenic
1186804990 X:13131901-13131923 GGGCTAGCAAATGTAAATGGAGG - Intergenic
1189576419 X:42358708-42358730 GAGCAGTTAAATGGAAATACAGG - Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1196703862 X:118699558-118699580 GGGCAGACAGATGTAAATGAGGG - Intergenic
1197445602 X:126549901-126549923 GCGCAGATAAATATAAATTGTGG - Exonic
1199313140 X:146345049-146345071 AGGCAGTGTAATGTAAATTGAGG - Intergenic