ID: 1096710630

View in Genome Browser
Species Human (GRCh38)
Location 12:53452627-53452649
Sequence GAGGGCGCGCGCGCGGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 205}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096710620_1096710630 4 Left 1096710620 12:53452600-53452622 CCCGGTGGCGGCTGCGCAGGAGT 0: 1
1: 0
2: 1
3: 13
4: 134
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205
1096710607_1096710630 22 Left 1096710607 12:53452582-53452604 CCCCTCCCCCCGCCTTTTCCCGG 0: 1
1: 0
2: 0
3: 34
4: 459
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205
1096710612_1096710630 17 Left 1096710612 12:53452587-53452609 CCCCCCGCCTTTTCCCGGTGGCG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205
1096710617_1096710630 13 Left 1096710617 12:53452591-53452613 CCGCCTTTTCCCGGTGGCGGCTG 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205
1096710609_1096710630 21 Left 1096710609 12:53452583-53452605 CCCTCCCCCCGCCTTTTCCCGGT 0: 1
1: 0
2: 0
3: 19
4: 218
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205
1096710616_1096710630 14 Left 1096710616 12:53452590-53452612 CCCGCCTTTTCCCGGTGGCGGCT 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205
1096710618_1096710630 10 Left 1096710618 12:53452594-53452616 CCTTTTCCCGGTGGCGGCTGCGC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205
1096710606_1096710630 23 Left 1096710606 12:53452581-53452603 CCCCCTCCCCCCGCCTTTTCCCG 0: 1
1: 0
2: 2
3: 93
4: 873
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205
1096710613_1096710630 16 Left 1096710613 12:53452588-53452610 CCCCCGCCTTTTCCCGGTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205
1096710605_1096710630 24 Left 1096710605 12:53452580-53452602 CCCCCCTCCCCCCGCCTTTTCCC 0: 1
1: 0
2: 11
3: 210
4: 2086
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205
1096710621_1096710630 3 Left 1096710621 12:53452601-53452623 CCGGTGGCGGCTGCGCAGGAGTC 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205
1096710610_1096710630 20 Left 1096710610 12:53452584-53452606 CCTCCCCCCGCCTTTTCCCGGTG 0: 1
1: 0
2: 0
3: 17
4: 253
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205
1096710615_1096710630 15 Left 1096710615 12:53452589-53452611 CCCCGCCTTTTCCCGGTGGCGGC 0: 1
1: 0
2: 0
3: 18
4: 68
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205
1096710604_1096710630 30 Left 1096710604 12:53452574-53452596 CCTATTCCCCCCTCCCCCCGCCT 0: 1
1: 1
2: 22
3: 208
4: 1978
Right 1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG 0: 1
1: 0
2: 2
3: 29
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096710630 Original CRISPR GAGGGCGCGCGCGCGGTAGG GGG Intronic