ID: 1096711696

View in Genome Browser
Species Human (GRCh38)
Location 12:53461996-53462018
Sequence GATGCACCCAACCTGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 93}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096711686_1096711696 23 Left 1096711686 12:53461950-53461972 CCACCCGCCTCAGCCTTCCAAAG 0: 629
1: 24054
2: 114630
3: 170453
4: 179470
Right 1096711696 12:53461996-53462018 GATGCACCCAACCTGGAAACTGG 0: 1
1: 0
2: 1
3: 12
4: 93
1096711687_1096711696 20 Left 1096711687 12:53461953-53461975 CCCGCCTCAGCCTTCCAAAGTAC 0: 93
1: 4383
2: 74567
3: 195737
4: 245098
Right 1096711696 12:53461996-53462018 GATGCACCCAACCTGGAAACTGG 0: 1
1: 0
2: 1
3: 12
4: 93
1096711692_1096711696 6 Left 1096711692 12:53461967-53461989 CCAAAGTACTGGTATTACCAGCA 0: 1
1: 10
2: 506
3: 10025
4: 122897
Right 1096711696 12:53461996-53462018 GATGCACCCAACCTGGAAACTGG 0: 1
1: 0
2: 1
3: 12
4: 93
1096711688_1096711696 19 Left 1096711688 12:53461954-53461976 CCGCCTCAGCCTTCCAAAGTACT 0: 94
1: 4242
2: 72565
3: 159136
4: 159261
Right 1096711696 12:53461996-53462018 GATGCACCCAACCTGGAAACTGG 0: 1
1: 0
2: 1
3: 12
4: 93
1096711690_1096711696 16 Left 1096711690 12:53461957-53461979 CCTCAGCCTTCCAAAGTACTGGT 0: 9
1: 242
2: 7720
3: 110905
4: 232804
Right 1096711696 12:53461996-53462018 GATGCACCCAACCTGGAAACTGG 0: 1
1: 0
2: 1
3: 12
4: 93
1096711691_1096711696 10 Left 1096711691 12:53461963-53461985 CCTTCCAAAGTACTGGTATTACC 0: 1
1: 12
2: 701
3: 25575
4: 347621
Right 1096711696 12:53461996-53462018 GATGCACCCAACCTGGAAACTGG 0: 1
1: 0
2: 1
3: 12
4: 93
1096711685_1096711696 27 Left 1096711685 12:53461946-53461968 CCATCCACCCGCCTCAGCCTTCC 0: 1
1: 59
2: 558
3: 6115
4: 72653
Right 1096711696 12:53461996-53462018 GATGCACCCAACCTGGAAACTGG 0: 1
1: 0
2: 1
3: 12
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096711696 Original CRISPR GATGCACCCAACCTGGAAAC TGG Intronic
900356917 1:2269498-2269520 GATGAACCCAGCCTGCAAAACGG - Intronic
900835001 1:4996158-4996180 GATACACCCAATCTGGAAAACGG + Intergenic
908580513 1:65511278-65511300 CATCCACACAACCTGGAATCTGG + Intronic
920171563 1:204075114-204075136 TATGCACCCATCTTTGAAACCGG - Intronic
920171643 1:204075530-204075552 TATGCACCCAACTTTGAAACTGG + Intronic
921668134 1:217897064-217897086 GATGCCGCCAACCTGAAAATAGG + Intergenic
923079723 1:230642109-230642131 GATACGTCCAACCTGGAAAACGG + Intergenic
923509357 1:234636544-234636566 GATGCACCCTTTGTGGAAACAGG - Intergenic
1063095637 10:2906261-2906283 GATCCACCCCACCTAGATACAGG - Intergenic
1072247234 10:93554592-93554614 GATGAAACCATCCTGGAAAGTGG - Intergenic
1074623174 10:115148405-115148427 AATGCATCCAAACTGGAAAGAGG - Intronic
1083880382 11:65545509-65545531 CACTCACCCAAACTGGAAACGGG + Intronic
1084196775 11:67527250-67527272 GATCCACCCATCCTGGACACTGG - Intergenic
1084664532 11:70569356-70569378 GCTCCACCGCACCTGGAAACCGG - Intronic
1085125336 11:73998097-73998119 GATGCACAGAACTTAGAAACTGG + Intergenic
1089241384 11:117084171-117084193 AATGCCCCCAACATGCAAACTGG + Intronic
1096711696 12:53461996-53462018 GATGCACCCAACCTGGAAACTGG + Intronic
1097915090 12:65012869-65012891 GAAGCACTCAACTTGGCAACAGG + Intergenic
1098032286 12:66267076-66267098 GCTGCACCCCAGCTGGAGACAGG - Intergenic
1102213003 12:111140525-111140547 GATGCACCCAGCCACGAAGCTGG - Intronic
1102252464 12:111396961-111396983 GAGGCATCCAACCTGGAGCCTGG + Intergenic
1104696945 12:130871405-130871427 GATGCACCCACCCAGAAAAACGG - Intergenic
1104946517 12:132417121-132417143 CATGCCACCAACCTGGAACCAGG + Intergenic
1112920516 13:104605933-104605955 GTTGCATCCAACCTGGAAACTGG + Intergenic
1113123981 13:106956173-106956195 GAAGGACCCAAATTGGAAACAGG + Intergenic
1119973265 14:78996668-78996690 GATGTACCAAACCTGCAAAATGG - Intronic
1122601834 14:102925437-102925459 GACGCTCCCACCCGGGAAACAGG + Intronic
1124060516 15:26289627-26289649 GTTGCACCCACCCTGAAAAGAGG + Intergenic
1129625904 15:77199188-77199210 GATGGAACCAATCTGGAAAAAGG - Intronic
1129680951 15:77658052-77658074 GATGCCCCCAACCTGGGGTCTGG + Intronic
1132477535 16:148747-148769 GTGGCACCTACCCTGGAAACAGG + Intergenic
1132883386 16:2172061-2172083 GAGGCACGCAACATGGGAACGGG - Intronic
1135848662 16:25942193-25942215 GGTGCCCCTAACCTGGAGACTGG + Intronic
1135945162 16:26858845-26858867 GATCCCCCCAGCTTGGAAACAGG - Intergenic
1136577230 16:31131980-31132002 GATGCATCCATCCTGGAAGTAGG + Exonic
1138567838 16:57846362-57846384 GCTGCCTCCAACCTGGACACAGG + Intronic
1143856020 17:9850112-9850134 TACGCACCCAACGAGGAAACAGG - Intronic
1144468300 17:15514950-15514972 GATGCCCCTAACCTGTAAAAGGG - Intronic
1148083378 17:44979735-44979757 GGGGCTCCCAGCCTGGAAACTGG - Intergenic
1148486058 17:47991593-47991615 AGTGCACCCCACCCGGAAACAGG - Intergenic
1149986465 17:61351273-61351295 GATGCAGCTAAACTGGAAATGGG - Intronic
1158438326 18:57450461-57450483 ACTGCACCCAACCTGAAAAAGGG + Intronic
1158817193 18:61116041-61116063 GTTGGACCCCAGCTGGAAACGGG - Intergenic
1160360516 18:78272026-78272048 CATCCACCTCACCTGGAAACGGG - Intergenic
1160394442 18:78561640-78561662 GTTGCAGCCAATCTGAAAACAGG - Intergenic
1163581686 19:18143251-18143273 ACTGCACCCAGCCTGGAAGCTGG + Intronic
1163776587 19:19222087-19222109 CATGCCCCCAAACTGGGAACTGG + Intronic
1167127680 19:47561957-47561979 ACTGCACCCAGCCTGTAAACTGG - Intergenic
927139338 2:20119048-20119070 GATGCTCCCAGCCCAGAAACAGG + Intergenic
928369707 2:30732150-30732172 GATAAACACAACCTGGAGACGGG + Intronic
933770385 2:85740353-85740375 GTTGCCCCAGACCTGGAAACAGG - Intergenic
934162766 2:89268116-89268138 GATGCATCCAATTTGGAAACAGG - Intergenic
934204509 2:89914408-89914430 GATGCATCCAATTTGGAAACAGG + Intergenic
938021637 2:127910453-127910475 ACTGCACCCAGCCTGGTAACCGG + Intergenic
938662786 2:133504742-133504764 AATGCACCAACCCTGGGAACTGG - Intronic
941655387 2:168138175-168138197 GATCCACCCACTTTGGAAACAGG - Exonic
944538125 2:200731165-200731187 GATGCAGCCTACCTGGGAACAGG - Intergenic
945397826 2:209342291-209342313 GATGCACCCACCAATGAAACAGG + Intergenic
947912777 2:233812160-233812182 GAAGCACCCAACTTGAAATCTGG - Intronic
948247537 2:236499146-236499168 CATGCAGCCAACCTGGACTCAGG - Intronic
948888043 2:240893572-240893594 GCTGCCCCCACCCTGGGAACCGG - Intronic
1169399572 20:5268404-5268426 AATGCACCCCACCAGGAGACAGG + Intergenic
1170071981 20:12379179-12379201 GAGCAACCCAAACTGGAAACTGG + Intergenic
1174704810 20:52644501-52644523 GATCAATCCAACCTGTAAACTGG + Intergenic
1175656459 20:60775448-60775470 GAAGCCCCCAAACTGGACACAGG - Intergenic
1175906794 20:62384293-62384315 ACTGCACCCAGCCTGGATACAGG + Intergenic
1178703484 21:34853770-34853792 GAAGGAACCAACCTGTAAACTGG - Intronic
1180840824 22:18958105-18958127 CATGCACCCAACCTGGAGATCGG - Intergenic
1181060663 22:20280669-20280691 CATGCACCCAACCTGGAGATCGG + Intronic
1181279833 22:21711454-21711476 GATGCACCCCACCCCGAATCCGG + Intronic
1184356873 22:43987253-43987275 GATAGCCCCAAGCTGGAAACTGG + Intronic
950076828 3:10193312-10193334 ACTGCACCCAGCCTGGAATCTGG - Intronic
951746319 3:25981506-25981528 GAAAGACCCAACCTGGCAACTGG + Intergenic
955825387 3:62940944-62940966 GATGCAACCAACGTGAAAATAGG - Intergenic
956381274 3:68666963-68666985 GACGCACCCAATGTGGAAATGGG - Intergenic
960203179 3:114862775-114862797 GATGCCCCCAACTTACAAACAGG - Intronic
962046816 3:131769037-131769059 GATGAACCCAAGCTGGAATGAGG - Intronic
969844981 4:9913571-9913593 GATGCTCCCCAAATGGAAACAGG - Intronic
973202456 4:47519885-47519907 TATGCACCTAACATGGTAACTGG + Intronic
975664855 4:76725638-76725660 GATGAACCTAACCTGGAAGAGGG - Intronic
981656968 4:147122668-147122690 TTTGCACCCAACCAGGAAAGGGG - Intergenic
984544312 4:181082060-181082082 GACTCACCCAGCCTTGAAACTGG + Intergenic
984908008 4:184648438-184648460 GTGGCACCCAAGCAGGAAACCGG - Intronic
988215904 5:28272512-28272534 GATGCATCAGACCTGGAAACTGG + Intergenic
989025922 5:37068195-37068217 GATGCAGACCACCTGGACACAGG - Intergenic
990381939 5:55227410-55227432 GTTAAACCCAACCTGGCAACCGG + Intergenic
1004048342 6:12048032-12048054 GATGCATCCTACCTGCAAAATGG - Intronic
1018589446 6:165402702-165402724 GATAAAGACAACCTGGAAACAGG + Intronic
1022108868 7:27215584-27215606 GCTGCACCCAACCAGGGAAAGGG + Intergenic
1026685264 7:72504391-72504413 TATGCTGCCAACCTTGAAACAGG - Intergenic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1031290010 7:119922466-119922488 AATTCAGCTAACCTGGAAACTGG + Intergenic
1037171696 8:15900114-15900136 GATGCTGCCAACATGGAAACAGG - Intergenic
1040581071 8:48699059-48699081 CATGCAACCTGCCTGGAAACTGG - Intergenic
1048377960 8:133838917-133838939 TATATACCCAACCCGGAAACCGG + Intergenic
1053388532 9:37715825-37715847 GAACCACCCAACCATGAAACTGG - Intronic
1058475722 9:105330632-105330654 GATGCACCAAAGATGAAAACAGG - Intronic
1059401964 9:114076307-114076329 CAGGGACCCAACCTGGGAACTGG - Intronic
1062132626 9:134908013-134908035 GATGGAACCAACCTGGAAAATGG - Intronic
1186157188 X:6737774-6737796 CAACCTCCCAACCTGGAAACAGG - Intergenic
1186420497 X:9421785-9421807 CATACTCCCAACTTGGAAACAGG + Intergenic
1190969356 X:55333779-55333801 AATGCAGCCAACTTGGAAAGTGG + Intergenic
1192830469 X:74745800-74745822 GATGAAGTCAATCTGGAAACAGG - Intronic
1195134705 X:101893313-101893335 GATACACTCAACCTAGCAACAGG + Intronic
1195533559 X:105984415-105984437 GATGCTTCCAACCTGGGAATGGG + Intergenic
1196323323 X:114370538-114370560 GATACAGCCAGCCTGGAAAATGG + Intergenic
1197726551 X:129780709-129780731 GATGGAGCCAACCTGGAGATGGG + Intronic