ID: 1096711991

View in Genome Browser
Species Human (GRCh38)
Location 12:53464386-53464408
Sequence CTGTGGGAACAATCCATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096711991_1096711996 8 Left 1096711991 12:53464386-53464408 CCTGTCATGGATTGTTCCCACAG 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1096711996 12:53464417-53464439 AAATATACAATGTCCACAGATGG 0: 1
1: 0
2: 0
3: 21
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096711991 Original CRISPR CTGTGGGAACAATCCATGAC AGG (reversed) Intronic
900416446 1:2537363-2537385 CTGTGGGGAAAAACCCTGACAGG + Intergenic
903667319 1:25015978-25016000 CTGTGGGAACAGTCCAGAACAGG - Intergenic
912010709 1:104957960-104957982 CTGTGGGAAGACCACATGACAGG - Intergenic
915152347 1:153844189-153844211 CTGAGGAAACTATCCAAGACTGG + Intronic
918860725 1:189823637-189823659 CTATGGGTACACTCCATGCCTGG + Intergenic
1064306512 10:14172059-14172081 CTGAGGGAACAAGACCTGACTGG - Intronic
1064821715 10:19343303-19343325 CTGAGGGAAAAATGCATGAAGGG - Intronic
1072542248 10:96406962-96406984 GTGTGGGAGCAATCCAGGAGGGG - Intronic
1072953667 10:99870291-99870313 CTGTGGGTACAACCCATGGAGGG - Intergenic
1077043003 11:532824-532846 CTGTGGGATCAAGCCTTGCCTGG + Intronic
1077445393 11:2588296-2588318 CTGGGGGAACATTCCAGCACAGG - Intronic
1091162071 11:133433034-133433056 CTGTGGAAAGAATTCATGACTGG - Intronic
1092621671 12:10278294-10278316 CTGTGAAAATAATCCATGTCAGG + Intergenic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1099084216 12:78225135-78225157 CTGTGGGAGCCTTCCATGTCAGG + Intergenic
1104342209 12:127960922-127960944 CTGTGGGAAGAATCCATCCCAGG + Intergenic
1117001957 14:51379672-51379694 CTGGGGGAACAGCCAATGACCGG + Intergenic
1117277831 14:54207476-54207498 CTGTGGTGAGAATCCATGAGTGG - Intergenic
1122748094 14:103911683-103911705 CTGTTGGAGGAAGCCATGACAGG + Intergenic
1122953903 14:105061118-105061140 CGGTGGGAACAACCCAAGGCAGG + Intronic
1128267298 15:66278132-66278154 CTGTGGTAGCAATCCGAGACTGG - Intergenic
1128948076 15:71844430-71844452 CTGTGAGACCAGTCCATTACAGG + Intronic
1130755872 15:86762572-86762594 CTGAGGGAAGAAGCCCTGACTGG + Intronic
1133394580 16:5436081-5436103 CAGTGGGAGCAATCCAGGAGGGG + Intergenic
1140779511 16:78281976-78281998 CTGGGGGAACAAGCCAAGATGGG - Intronic
1142579111 17:929980-930002 CTTTGGAATCAATCAATGACGGG + Intronic
1146393124 17:32441259-32441281 CTGTGGATGCAATCAATGACAGG + Intergenic
1147895349 17:43747350-43747372 CTTTGGAAACAATCCATGGAGGG + Intergenic
1147991015 17:44333538-44333560 GTGTGGCAACAGTGCATGACAGG + Intergenic
1155174824 18:23292769-23292791 CATTGGGAAGAATCAATGACAGG + Intronic
1165332571 19:35149145-35149167 CTGTGGGAAAGATACCTGACTGG + Intronic
926107720 2:10162830-10162852 CTGTGCCAGCCATCCATGACAGG + Intronic
926418560 2:12675048-12675070 CTGTGGGAACACTGCATTTCAGG + Intergenic
926891694 2:17644367-17644389 CTGTGGGAACCACCAAGGACAGG - Intronic
935902540 2:107808052-107808074 CTGTGGGCACTATCCCTGCCAGG + Intergenic
936923489 2:117712940-117712962 CCGAGGGAGCAATCCATGAGAGG + Intergenic
945436043 2:209818408-209818430 CTCTGGGTATAATCCAAGACAGG + Intronic
1169785687 20:9357221-9357243 CTGTGAGAATAATCAATGACGGG - Intronic
1176081888 20:63277668-63277690 ATGTGGGACGCATCCATGACGGG - Intronic
1179490104 21:41735577-41735599 CTGTGGGAACACTCCCTCCCCGG + Intergenic
949426951 3:3928090-3928112 CTGTGGGAACAACCCTCTACTGG - Intronic
950670547 3:14522866-14522888 CTGAGGGAACACTCCCTGCCCGG - Intronic
954004350 3:47579287-47579309 CTGTGGAAACAAGCCAGGCCCGG + Exonic
954367162 3:50152350-50152372 CTGTGGGAAAGCTCCAGGACAGG - Intergenic
958169101 3:89916243-89916265 CTGTAGGAATAACCCATGAAGGG - Intergenic
965232002 3:166066129-166066151 CTGTGGGGACAATGCATGAGAGG + Intergenic
980314114 4:131174158-131174180 CAGTTTGAACAATCCGTGACAGG - Intergenic
981391926 4:144201095-144201117 CTCTGGGAACAATCTCTGAGAGG + Intergenic
988536941 5:32077585-32077607 CTGGGGCAACAACCCATGACTGG + Exonic
992701937 5:79349616-79349638 CCCAGGGAACAATCTATGACAGG + Intergenic
999062215 5:148647956-148647978 CTGAGGAAACAAACCAAGACAGG - Intronic
1001565031 5:172694573-172694595 CTGTGGGAACGATCCAATTCAGG + Intergenic
1004540386 6:16544249-16544271 CTGTGGGAACAATGCAAGGAAGG - Intronic
1007116473 6:39346617-39346639 CTGTGTAAACCATCCAAGACAGG - Intronic
1013744595 6:113330473-113330495 TTGTGTGAACAGTCCAGGACAGG - Intergenic
1014241599 6:119023781-119023803 TTGTGAGAAAAATCAATGACAGG - Intronic
1015754523 6:136594174-136594196 ATGTGGAAACAATACATGCCAGG - Intronic
1022455353 7:30553818-30553840 CTTTGGGAAGAATCCCTGATTGG - Intergenic
1022973976 7:35540299-35540321 CTGAGGGAAGAATCCAAGACAGG + Intergenic
1024143893 7:46491505-46491527 CTGTGGTAAAAATCCAGGAAAGG + Intergenic
1034387017 7:150748418-150748440 CAGTGTGAACAATCCATGTATGG - Intronic
1036217888 8:6896116-6896138 CTGTGCGAACATGCCAGGACAGG - Intergenic
1040567321 8:48579407-48579429 CTGTGAGAACATTGCATGAATGG + Intergenic
1044824036 8:96179482-96179504 CTCTGGGAACAATGCCGGACCGG + Intergenic
1046744525 8:117862706-117862728 CTGTGGCTACAAATCATGACAGG + Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1052460536 9:28757310-28757332 CTGTGAGAAGAATCAATGAGAGG - Intergenic
1055278086 9:74642209-74642231 CTGTGGGCATAAACCAGGACAGG + Intronic
1057262710 9:93594358-93594380 CTTTGGGAACATTCCAGGTCGGG + Intronic
1060538789 9:124415255-124415277 CTGAGGGAAGAATTCATGGCGGG - Intronic
1061737826 9:132674462-132674484 TTGTGGGAAGAATTCTTGACAGG - Intronic
1185954704 X:4476979-4477001 CTGTAGGAAGAATCCATCAGTGG + Intergenic
1186229705 X:7439894-7439916 CTCTGGGAAAAATCCATTCCAGG - Intergenic
1186320357 X:8417579-8417601 CTGTGGAAAGAATCCATGGAGGG + Intergenic
1188025027 X:25199356-25199378 CTGTGGGAACTGTCCTTGAGAGG - Intergenic
1189686394 X:43568093-43568115 ATGGGGAAAAAATCCATGACTGG + Intergenic