ID: 1096715301

View in Genome Browser
Species Human (GRCh38)
Location 12:53487429-53487451
Sequence CTGTGGGAATGAAGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4553
Summary {0: 1, 1: 1, 2: 25, 3: 286, 4: 4240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096715289_1096715301 5 Left 1096715289 12:53487401-53487423 CCCCTGGTATGATGGTGAACACT 0: 1
1: 0
2: 2
3: 9
4: 91
Right 1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG 0: 1
1: 1
2: 25
3: 286
4: 4240
1096715290_1096715301 4 Left 1096715290 12:53487402-53487424 CCCTGGTATGATGGTGAACACTG 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG 0: 1
1: 1
2: 25
3: 286
4: 4240
1096715286_1096715301 18 Left 1096715286 12:53487388-53487410 CCATCGCCTCTGGCCCCTGGTAT 0: 1
1: 1
2: 1
3: 18
4: 218
Right 1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG 0: 1
1: 1
2: 25
3: 286
4: 4240
1096715291_1096715301 3 Left 1096715291 12:53487403-53487425 CCTGGTATGATGGTGAACACTGG 0: 1
1: 0
2: 9
3: 123
4: 1451
Right 1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG 0: 1
1: 1
2: 25
3: 286
4: 4240
1096715288_1096715301 12 Left 1096715288 12:53487394-53487416 CCTCTGGCCCCTGGTATGATGGT 0: 1
1: 0
2: 1
3: 13
4: 152
Right 1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG 0: 1
1: 1
2: 25
3: 286
4: 4240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096715301 Original CRISPR CTGTGGGAATGAAGGAAGGA GGG Intronic
Too many off-targets to display for this crispr