ID: 1096717096

View in Genome Browser
Species Human (GRCh38)
Location 12:53498215-53498237
Sequence GTCTGGACAGGAAGGCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096717089_1096717096 2 Left 1096717089 12:53498190-53498212 CCCTAAAGCTCAGAGAAACTTCA 0: 1
1: 0
2: 2
3: 21
4: 222
Right 1096717096 12:53498215-53498237 GTCTGGACAGGAAGGCTCAGGGG 0: 1
1: 0
2: 1
3: 29
4: 263
1096717090_1096717096 1 Left 1096717090 12:53498191-53498213 CCTAAAGCTCAGAGAAACTTCAG 0: 1
1: 0
2: 0
3: 30
4: 293
Right 1096717096 12:53498215-53498237 GTCTGGACAGGAAGGCTCAGGGG 0: 1
1: 0
2: 1
3: 29
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096717096 Original CRISPR GTCTGGACAGGAAGGCTCAG GGG Intronic
900223988 1:1524252-1524274 TTCTGGACAGGAAGAGTGAGGGG - Exonic
900522729 1:3113460-3113482 GCCTAGAGAGGAAGGCTCGGAGG + Intronic
900645883 1:3708614-3708636 GTCTGGGCAGGGCAGCTCAGTGG - Intronic
901320253 1:8335665-8335687 TTCTGGGAAGGGAGGCTCAGGGG - Intronic
902329612 1:15724903-15724925 GTCCTGGCAGGAAGGCTCTGAGG + Intronic
902621941 1:17655884-17655906 GGGCGGACAGGAAGGCGCAGGGG + Exonic
903180397 1:21602274-21602296 GTTGGGACAGTAAGGCTCAGAGG + Intronic
903441007 1:23387794-23387816 GTCTAGAGAGGAAGGCTAAGGGG - Intronic
904006394 1:27365615-27365637 GGCGGGAAAGGATGGCTCAGGGG - Intronic
904201111 1:28819627-28819649 ATGGGGACAAGAAGGCTCAGAGG + Intronic
904618505 1:31762551-31762573 GTCTGTACGTGAAGGCTCAAAGG + Intronic
905429489 1:37911076-37911098 GTTTGGACAGAAAGGCTCCAGGG - Intronic
911169739 1:94758078-94758100 GTCTTGGCAGGAAGACTCAACGG + Intergenic
912296684 1:108476520-108476542 GTCTGGACAGAAAGGCTACAGGG - Intergenic
912406593 1:109443812-109443834 CTCTGAACACCAAGGCTCAGAGG + Intergenic
912815060 1:112822440-112822462 GTCTGGACAGAAAGGCTACAGGG + Intergenic
913391342 1:118316099-118316121 CTCAGGAAAGGAAGGCCCAGAGG + Intergenic
914505896 1:148288529-148288551 CTCTGCAGATGAAGGCTCAGGGG - Intergenic
914847200 1:151289844-151289866 GGCTGGACGGGGGGGCTCAGGGG - Exonic
918060104 1:181053656-181053678 GTCTGGAGAAGAAGGCCCCGAGG + Exonic
918144384 1:181742726-181742748 GCCTCGGCAGGAGGGCTCAGGGG - Intronic
919775131 1:201189516-201189538 GTTTGGACAGGTAGGCTTTGGGG - Intergenic
919819986 1:201466714-201466736 TTGTGGTCAGGAAGGCCCAGGGG - Intronic
920819934 1:209370838-209370860 GTTAGGACAGGCAGGCTTAGTGG + Intergenic
921459565 1:215412074-215412096 GTCTGGACAGAAAGGCTACAGGG + Intergenic
922210783 1:223484854-223484876 GGCAGGACATGAAGGCACAGAGG - Intergenic
923724277 1:236493055-236493077 GTCTCGACATGGAGGCTCACAGG + Intergenic
924431312 1:243999396-243999418 GACTTGTCAGTAAGGCTCAGAGG + Intergenic
1066387404 10:34952897-34952919 TGGTGGACAGGATGGCTCAGGGG - Intergenic
1067251046 10:44587446-44587468 GTCTGGTCAGGGAGGGTCAGCGG - Intergenic
1070767685 10:79066169-79066191 ATCTGGACAGAAAGGTTGAGAGG + Intergenic
1073116499 10:101094558-101094580 GGCTGGAGAAGAAGGCTCTGGGG - Intronic
1073577019 10:104634947-104634969 GGCTGGAAAGCTAGGCTCAGGGG - Intergenic
1076428763 10:130387137-130387159 GTCTGGACAGGAAGGAGAACAGG + Intergenic
1077284065 11:1758152-1758174 GTCCAGACAGGAGGGCTCTGAGG + Intronic
1079447674 11:20571374-20571396 GTCTGGACAGAAAGGCTACACGG - Intergenic
1081206340 11:40280186-40280208 GGCTGGACTGAAAGGCCCAGAGG + Intronic
1081675255 11:44964893-44964915 GCCTGGCCAGGGAGGCACAGAGG - Intergenic
1083328319 11:61885011-61885033 GTGAGGAAATGAAGGCTCAGCGG + Intronic
1084439612 11:69165115-69165137 CTCTGGACACCAAGGCTCCGGGG + Intergenic
1084597877 11:70128028-70128050 GTCTTTACAGACAGGCTCAGTGG - Intronic
1084893760 11:72250588-72250610 GTCTGGAAAGGAAGGTTCCAGGG + Intergenic
1085237477 11:75026188-75026210 GTTTGGGCAGGAAGAATCAGAGG - Intergenic
1085458919 11:76681480-76681502 GTCTGGCCAGTAAAGTTCAGTGG - Intergenic
1086005230 11:82028804-82028826 GTTTGGACAGAAAGGCTACGGGG - Intergenic
1087161957 11:94957922-94957944 GTCTGGATGAGAAGACTCAGTGG - Intergenic
1088182883 11:107132128-107132150 GTGTGGGCAGAAAAGCTCAGAGG + Intergenic
1088608672 11:111556326-111556348 CTCTGGACACGAAAGCTCTGTGG - Intronic
1089165418 11:116472243-116472265 CTCTGGACACCAAAGCTCAGTGG + Intergenic
1089710022 11:120307822-120307844 GTCAGGGCAAGAAGGGTCAGTGG - Intronic
1089987885 11:122830696-122830718 GTTTGGACAGGAAGGCTACAGGG - Intergenic
1090188395 11:124752547-124752569 CTGTGGACAGGAAGGGTCTGCGG - Intergenic
1090407551 11:126486234-126486256 GTCTGCACAGCAAGGGTGAGAGG + Intronic
1091348374 11:134871816-134871838 CTCTGGACACCAAGGCTTAGTGG - Intergenic
1091761132 12:3088044-3088066 GGCTCTACAGGAGGGCTCAGAGG + Intronic
1095749007 12:45690325-45690347 TTCTGGACAGGAATACACAGTGG + Intergenic
1096717096 12:53498215-53498237 GTCTGGACAGGAAGGCTCAGGGG + Intronic
1096907002 12:54945232-54945254 GTTTGGACAGAAAGGCTAAAGGG + Intergenic
1097182255 12:57178211-57178233 CTCTGGCCAGCAAGGCTTAGGGG + Intronic
1097387686 12:58969275-58969297 GGCTAGACAGGCTGGCTCAGAGG - Intergenic
1097943232 12:65336058-65336080 GACAAGACAGGAAGGGTCAGTGG - Intronic
1098690625 12:73482860-73482882 GGCTGGACAGTAAGAGTCAGAGG - Intergenic
1099133300 12:78863597-78863619 TACCGAACAGGAAGGCTCAGCGG - Intergenic
1100169611 12:91959412-91959434 GGCTGGACGCGATGGCTCAGGGG - Intergenic
1100380160 12:94054395-94054417 CACTGGACACCAAGGCTCAGTGG + Intergenic
1101656730 12:106728281-106728303 ATGAGGACATGAAGGCTCAGAGG - Intronic
1101703576 12:107198402-107198424 GTGAGGAAAGGAAGGCTCAGAGG + Intergenic
1104096924 12:125566517-125566539 GTCTCACCAGGAAGCCTCAGTGG + Intronic
1104774603 12:131384028-131384050 GGCTGGGCAGGCAGCCTCAGGGG - Intergenic
1104915224 12:132260910-132260932 GGCTGGACAGCCAGTCTCAGCGG - Intronic
1105424675 13:20284204-20284226 ATCTGGATAGGAAGGAGCAGAGG - Intergenic
1106986865 13:35363502-35363524 GGATGGACAGGAAGGCTCTTTGG - Intronic
1107177354 13:37414663-37414685 GTCTGGACACGAAGCTTCAAAGG - Intergenic
1107349827 13:39502169-39502191 GCCTTGCCAGGAAGGCTCTGAGG + Intronic
1109582296 13:64357117-64357139 GCATCCACAGGAAGGCTCAGTGG + Intergenic
1110477551 13:75934687-75934709 GTCTGAACAGGTAGGATCTGAGG + Intergenic
1111275210 13:85938175-85938197 GCCTGGACAGGGAGGAGCAGAGG - Intergenic
1111928222 13:94485440-94485462 GTGAGTACAGGAAAGCTCAGGGG - Intergenic
1112192747 13:97193711-97193733 GTCTGGAAAGGAAACCACAGTGG + Intergenic
1112837439 13:103533342-103533364 GCAGGGACAGGAAGGATCAGAGG + Intergenic
1115447550 14:33508876-33508898 GTCAGGGGATGAAGGCTCAGGGG - Intronic
1117693490 14:58334912-58334934 ATCTGGAGAGGAAAGCACAGAGG - Intronic
1117693782 14:58338377-58338399 GTCTGGACTGGAGGACTCACGGG - Intronic
1118328917 14:64800909-64800931 GTCGGGAAAGTCAGGCTCAGAGG + Intronic
1118833032 14:69452838-69452860 GTCTGGAAAGAAATGATCAGAGG + Intronic
1119597024 14:75944451-75944473 GTCAGGGCAGGGAGGCTCCGTGG - Intronic
1121692187 14:95885940-95885962 GTCTGGGCAGCAGGGCCCAGAGG - Intergenic
1121834159 14:97077099-97077121 CACTGGACAGCAGGGCTCAGCGG + Intergenic
1122350216 14:101084680-101084702 GTCGGGACGGGAAAGCTCTGTGG - Intergenic
1124688623 15:31803483-31803505 AGCTGTCCAGGAAGGCTCAGGGG + Intronic
1127327704 15:57911681-57911703 GTCTGGGCAGGAAGGCAGGGAGG + Intergenic
1127733395 15:61820276-61820298 GTCTGGGAGGGAAGGCTCAAAGG + Intergenic
1128334445 15:66777195-66777217 GTGGGGACAGGGAGGCTGAGTGG + Intronic
1128599514 15:68983953-68983975 CTCTGGACAGGCAGCATCAGTGG - Intronic
1129356518 15:74995678-74995700 GTCTGGGCATGAAGGCTGGGAGG + Intronic
1129682049 15:77663592-77663614 GTCTGGGTAGGATGCCTCAGAGG - Intronic
1129774382 15:78225888-78225910 GTCTTCATATGAAGGCTCAGTGG + Intronic
1131937356 15:97521523-97521545 ATCTGGCCAGGAGGGCTTAGGGG + Intergenic
1132697296 16:1207654-1207676 GTGTGGACAGAAGGGCCCAGAGG - Intronic
1135827426 16:25741797-25741819 GTAAGGACACCAAGGCTCAGAGG + Intronic
1136368891 16:29823452-29823474 CACTGGAGAGGAAGGCTCAGAGG + Intronic
1137797419 16:51233768-51233790 GGCTGGAGAGCCAGGCTCAGAGG + Intergenic
1138064278 16:53924540-53924562 GTCTTGAAAGGAAGGCACAAAGG - Intronic
1139262233 16:65605591-65605613 ATGTGGACATGAAGGTTCAGGGG - Intergenic
1139352586 16:66346602-66346624 GAGTGGTCAGGAAGGATCAGAGG - Intergenic
1139592647 16:67942069-67942091 GGCTGGGCAGGCAGGCTCTGGGG + Intronic
1139660087 16:68414783-68414805 GCCGGGAGGGGAAGGCTCAGAGG + Intronic
1141599535 16:85117078-85117100 GTCATGGCAGGATGGCTCAGAGG + Intergenic
1141786231 16:86202525-86202547 GTTTGGACAGCAAGGCCCTGGGG - Intergenic
1142306308 16:89287886-89287908 GGCAGGACAGCAAGGCTGAGGGG - Intronic
1142381193 16:89733118-89733140 CTCTGGACAGGAGGCCTCAGGGG - Intronic
1143170892 17:4929651-4929673 GGCTGGACAGGCAGGCAAAGGGG + Intergenic
1143661786 17:8329064-8329086 GTCTGAACAGGAAGGCACACAGG - Intergenic
1146305148 17:31724826-31724848 GCCTGGACAGGATGACTAAGAGG + Intergenic
1146958592 17:36952911-36952933 GTCTGGAGATGAAGATTCAGAGG + Exonic
1147388005 17:40092920-40092942 GTATTTACAAGAAGGCTCAGGGG + Exonic
1147429941 17:40364721-40364743 GACAGGACAGGATGGCTGAGAGG + Intergenic
1148808151 17:50274466-50274488 CTCTACACAGGAAAGCTCAGTGG + Exonic
1150492517 17:65584177-65584199 GTCTGGACCCGAGGACTCAGGGG - Intronic
1152032557 17:77853351-77853373 GGCTTGACAGGGAGGCTCCGAGG - Intergenic
1152157202 17:78642214-78642236 GGCTGGAGAGGAGGCCTCAGTGG - Intergenic
1153651037 18:7240494-7240516 TCCTGGACAGCAAGGCTCAGGGG + Intergenic
1154074711 18:11188788-11188810 GTCTGGGTAGGAGGGCCCAGCGG + Intergenic
1157602957 18:48905459-48905481 GTCTGGACAGGTTGCCTCATAGG - Intergenic
1157699520 18:49752218-49752240 GGGTGGACAGGAGGGCTCTGCGG - Intergenic
1161384441 19:3983502-3983524 GTCTGGTCAGGAGGGCTCTGAGG - Intronic
1161454545 19:4363476-4363498 GTGGGGACAGTAGGGCTCAGGGG + Intronic
1163022677 19:14491705-14491727 GTCTGGACAAGAAGTCGTAGGGG - Exonic
1163124696 19:15238647-15238669 GCCTGGACAGGGAGGGGCAGCGG - Intronic
1165093339 19:33397671-33397693 GTCTGGGCAGCAAAGCCCAGTGG + Intronic
1165148627 19:33748473-33748495 CTCAGGCCAGGAAGGCTCAGGGG - Intronic
1167602566 19:50463006-50463028 GGCTGGACAGGAAGACCCTGGGG - Intronic
1167631739 19:50629954-50629976 CTCTGGAGAGGCAGGCACAGGGG - Exonic
1168568326 19:57442830-57442852 GGCTGGAGAGGAGGGGTCAGAGG - Intronic
925346719 2:3176843-3176865 AGCTGCACAGGAAGGCCCAGAGG + Intergenic
925891586 2:8439035-8439057 GAAGGGACAGAAAGGCTCAGAGG + Intergenic
927699453 2:25258697-25258719 GTCAAGGCAGGAAGGCTCAAGGG + Intronic
927860023 2:26554924-26554946 GTCTTGGCAAGAAGGCTCAGGGG + Intronic
927912611 2:26912083-26912105 GTCTGGACCTGACAGCTCAGGGG - Intronic
928115643 2:28543591-28543613 GGCTGGACAGGAATGGTGAGGGG - Intronic
931715285 2:65024005-65024027 GTCAGGGCAGGCATGCTCAGGGG + Intergenic
931858098 2:66325044-66325066 GTGTGGATAGGGAGGGTCAGAGG + Intergenic
932356837 2:71074213-71074235 GTCTGGACAGGAAGACTAACTGG - Intronic
932450173 2:71804713-71804735 CTCTGGCAAGGAAGGCTGAGGGG + Intergenic
937247292 2:120501914-120501936 GGATGGACAGCAAGACTCAGAGG + Intergenic
937840032 2:126515543-126515565 TTCTGGACACAGAGGCTCAGTGG - Intergenic
937920627 2:127127030-127127052 GTCTGGACACTGAAGCTCAGTGG + Intergenic
937985533 2:127636549-127636571 GTCCGGGTAGGAAGGCTCCGAGG - Exonic
938933333 2:136106569-136106591 GTCTGACCAGCAGGGCTCAGAGG + Intergenic
941732710 2:168935857-168935879 GTGTGGAAAGCATGGCTCAGGGG + Intronic
944342879 2:198624199-198624221 GTAGGGACAGGAAAGATCAGTGG + Intergenic
945554934 2:211265273-211265295 GTTTGGACAGAAAGGCTACGGGG - Intergenic
946871522 2:224089768-224089790 GTTTGGACAGAAAGGCTCCAGGG + Intergenic
946944145 2:224802357-224802379 GGCTGATCAGGAAGGCACAGTGG + Intronic
948024314 2:234764922-234764944 GTGGGGACAGGGAGGCCCAGGGG - Intergenic
948125685 2:235563326-235563348 GCCAGGACAGGAGGGCACAGAGG - Intronic
948900960 2:240956690-240956712 CTCTGGAGAGGAGGGCTCTGGGG + Intronic
1168760834 20:348248-348270 GTCTGGAGAGGAGGGCTCGCCGG - Intronic
1169288368 20:4328307-4328329 GCTTGGACTTGAAGGCTCAGTGG + Intergenic
1172124754 20:32618910-32618932 GTGAGGACTGGCAGGCTCAGAGG + Intergenic
1172568957 20:35954123-35954145 GTTGGGACTGGAAGGCTCAGGGG + Exonic
1172799283 20:37564832-37564854 GGCTGCACAGGCTGGCTCAGAGG + Intergenic
1173801452 20:45897110-45897132 GTCCTGACAGGAAGTCTCAAGGG - Intronic
1174445766 20:50590187-50590209 GATTGGACAGGAGGGCTGAGGGG - Intronic
1174482780 20:50842906-50842928 GTGTGGACAGGTAGGAACAGTGG - Intronic
1175843211 20:62043930-62043952 GGCTGGACGGGAAGACACAGAGG + Intronic
1176237462 20:64060330-64060352 GTCTGGCCAGGCAGGCTCCATGG + Intronic
1176843740 21:13860646-13860668 TTCTGGACAGCAAAGCTCAAGGG - Intergenic
1176988664 21:15467379-15467401 GTCTGAAAAGTAAGGATCAGAGG + Intergenic
1178794664 21:35732808-35732830 CTCTGGCCTGGAAGACTCAGAGG - Intronic
1179262877 21:39774055-39774077 TGCTGGAGAGGGAGGCTCAGTGG + Intronic
1179308325 21:40174980-40175002 GATAGGACAGGAAGGCTGAGAGG - Intronic
1179641181 21:42747994-42748016 GCCTGGCCAGGCAGGGTCAGCGG + Intronic
1180108626 21:45637139-45637161 GTTTGGACAGGACTGCTCACAGG + Intergenic
1180122739 21:45764942-45764964 AGCTGGACAGGAAGGATCAGTGG + Intronic
1181049010 22:20229983-20230005 GCCTGGGCAGCAAGACTCAGAGG - Intergenic
1181056180 22:20261511-20261533 GTGCGGACAGGGAGGCTCAGAGG + Intronic
1181314503 22:21962699-21962721 GTCTGCCCATGAAGGCACAGAGG + Intronic
1181423107 22:22815455-22815477 GTCAGGACAGGAAGGCTCCTGGG - Intronic
1181600690 22:23950012-23950034 GGCTGGGCAGGCAGGCCCAGGGG + Intergenic
1181607822 22:23991310-23991332 GGCTGGGCAGGCAGGCCCAGGGG - Intergenic
1182585462 22:31342147-31342169 ATCCACACAGGAAGGCTCAGTGG + Intronic
1183741545 22:39671147-39671169 GTCTGGAAGGGAACGGTCAGAGG + Intronic
1184572501 22:45334932-45334954 ACCTGGAAAGGGAGGCTCAGTGG - Intronic
1185249766 22:49794586-49794608 GTCTGCACAGGCAGCCTCAGTGG - Intronic
1185277875 22:49957576-49957598 GTCGGGATGGGATGGCTCAGGGG + Intergenic
949848225 3:8393789-8393811 GTCTGGACAAGAATGTTGAGTGG - Intergenic
950108441 3:10403347-10403369 GCCTAGACTGGGAGGCTCAGTGG - Intronic
950140693 3:10613125-10613147 CTCTGGACACCAAAGCTCAGTGG + Intronic
950821528 3:15765022-15765044 TTGTGGAAAGGAGGGCTCAGAGG - Intronic
953917732 3:46931273-46931295 GGCTGGCCAGGGAGGTTCAGGGG + Intronic
954441387 3:50524125-50524147 GTCTGGGCAGGAATACCCAGAGG - Intergenic
954468898 3:50675067-50675089 GTCTGGACCGCGAGGCTCCGCGG - Intergenic
956258981 3:67316199-67316221 GTCTGGAAAGTCAGGCACAGAGG + Intergenic
959030107 3:101289754-101289776 GGGTGGAGAGGAGGGCTCAGAGG + Intronic
959626685 3:108459992-108460014 GTCTGGAGAGGAGGGCAAAGAGG + Intronic
961903069 3:130233478-130233500 TTCTGGACAAAAAGGCTTAGTGG + Intergenic
965408825 3:168304167-168304189 CTCTGGACACTGAGGCTCAGCGG - Intergenic
967945249 3:194798955-194798977 GAGTGGAGAGGAAGGCTCTGTGG + Intergenic
969347819 4:6580305-6580327 GGGAGGACAGCAAGGCTCAGAGG + Intronic
971081848 4:23221777-23221799 GTGTGGAAAGGAACGCACAGAGG - Intergenic
972116765 4:35645483-35645505 GTCAGGAAACCAAGGCTCAGAGG - Intergenic
973077587 4:45948654-45948676 GTCTTAACAGGAAGGCACATTGG - Intergenic
973201584 4:47509128-47509150 AGTTGGACAAGAAGGCTCAGGGG - Intronic
975152325 4:71034951-71034973 GTCTGGACAGAAAGGCTACAGGG - Intergenic
975769503 4:77706049-77706071 TGCTGGAGAGGAAGGCTCAGGGG - Intergenic
975849812 4:78560551-78560573 TTCTGGACACTGAGGCTCAGAGG - Intronic
976696748 4:87925448-87925470 GTCTGGACAGAAAGGCTACAGGG - Intergenic
980049026 4:128020494-128020516 CTCTGGACTGCAAGGCTCAGGGG - Intronic
980210181 4:129777177-129777199 ATCTCCACAGGAAGGCACAGAGG + Intergenic
982209608 4:153023757-153023779 GTGCAGACAGGATGGCTCAGAGG - Intergenic
983635489 4:169893765-169893787 GTGAGGACACAAAGGCTCAGAGG + Intergenic
983954924 4:173686347-173686369 GACTGGACACTGAGGCTCAGAGG - Intergenic
985611956 5:894150-894172 GCCTGTCCAGGAGGGCTCAGAGG + Intronic
985618446 5:938500-938522 GTCAGGAGAGGAAGGCTCAGGGG + Intergenic
987035591 5:14015201-14015223 GTCTGGACAGGCAAGATCAAAGG - Intergenic
987214267 5:15716506-15716528 GTCTGGTCTTGAAGGCTCAAGGG - Intronic
987756035 5:22098421-22098443 GTTTGGACAGAAAGGCTAAAGGG - Intronic
991293074 5:65051372-65051394 GTTGGGACAGGAGGGCACAGAGG - Intergenic
993198022 5:84775445-84775467 GGTTGGAAATGAAGGCTCAGAGG - Intergenic
993396120 5:87391118-87391140 GTCTGTACACCAAGGCTCAGAGG - Intronic
996572700 5:124949312-124949334 GTTTGGTCAGGTAGGCACAGTGG + Intergenic
997775301 5:136599046-136599068 CTCTAGACAACAAGGCTCAGTGG - Intergenic
998509363 5:142698592-142698614 GTCTGAAGAGGAAGGATCAGAGG - Intergenic
999195909 5:149781475-149781497 ATCTGGACAAGAAGACTGAGAGG - Intronic
999512083 5:152262872-152262894 GTCTCCACAGGAAGGCCAAGTGG + Intergenic
999926053 5:156379374-156379396 GTCTGGGCAGAGAGGATCAGAGG + Intronic
1000871297 5:166580605-166580627 CTTTGGAAAAGAAGGCTCAGAGG + Intergenic
1000926371 5:167199436-167199458 GCCGGGCCAGGAAGACTCAGTGG - Intergenic
1001010196 5:168090590-168090612 GTCTGGACGGGAAGGAGAAGTGG + Exonic
1001951451 5:175819562-175819584 CTCTGGACAGGGAGGGTCAAGGG + Intronic
1002484490 5:179524821-179524843 GTGTGGACAGGAGCGCTCAGGGG - Intergenic
1002500089 5:179642667-179642689 GTGTGGACAGGAGCGCTCAGGGG + Intronic
1002501882 5:179652094-179652116 GTGTGGACAGGAGCGCTCAGGGG - Intergenic
1002894959 6:1373049-1373071 GTCTGAACATGAGGGCCCAGTGG - Intergenic
1002930603 6:1631986-1632008 ATCATCACAGGAAGGCTCAGAGG + Intronic
1003949331 6:11103578-11103600 GTCAGGGCAGGATGGCTCTGTGG + Exonic
1003983596 6:11413194-11413216 GAGTGGAGAGGAAAGCTCAGGGG + Intergenic
1005854354 6:29849654-29849676 AACTGGACAGAAAGGCTCACAGG + Intergenic
1006886830 6:37388964-37388986 GTGTGGCCAGGAAGGCTCAAAGG - Intronic
1008106598 6:47445655-47445677 GTCTGGAGAGTAAGGTCCAGAGG - Intergenic
1009847843 6:69156288-69156310 GTGTGAGCAGGGAGGCTCAGAGG + Intronic
1014454660 6:121622566-121622588 GTTTGGACAGAAAGGCTAAAGGG + Intergenic
1015997249 6:139007595-139007617 GTGTGGACAGGAAGGATGACTGG - Intergenic
1017110174 6:150924910-150924932 GCCTGGAAAGGAATACTCAGCGG + Intronic
1019412131 7:911332-911354 CTCTGGGCAGGAAGGCGCTGTGG - Intronic
1019617817 7:1974203-1974225 GGCTGGAGAGGAAAGATCAGAGG + Intronic
1020613314 7:10427640-10427662 TCCTGGACACCAAGGCTCAGGGG - Intergenic
1022120141 7:27300264-27300286 GTCTTGTCATGAAGGATCAGTGG - Intergenic
1024598840 7:50962292-50962314 GACTGGAGAGGGAGGCTGAGAGG + Intergenic
1026966670 7:74444512-74444534 GGCTGCACAGGAAGGATCAGAGG + Intergenic
1027689239 7:81321459-81321481 CTCAGGACAGGATGTCTCAGTGG + Intergenic
1031040395 7:116833171-116833193 ATCAGAAGAGGAAGGCTCAGTGG + Intronic
1032468182 7:132159794-132159816 GCCTGGACAGGAAAGGGCAGTGG - Intronic
1033537794 7:142328227-142328249 CTCCTGACAGGAAGGCTCTGGGG + Intergenic
1033553577 7:142469454-142469476 CTCCTGACAGGAAGGCTCTGGGG + Intergenic
1033555779 7:142487736-142487758 CTCCTGACAGGAAGGCTCTGGGG + Intergenic
1034299491 7:150002761-150002783 GTCTGAAAAGGGAGGCTCTGGGG - Intergenic
1034429299 7:151033230-151033252 GCCTGGACAGGAAGGGGCCGGGG - Intronic
1034806511 7:154094012-154094034 GTCTGAAAAGGGAGGCTCTGGGG + Intronic
1036658242 8:10691380-10691402 GGCTGAACAGAAGGGCTCAGAGG + Intronic
1039488741 8:37931777-37931799 CTCTGGACACCAAGGCTTAGGGG - Intergenic
1039646453 8:39289851-39289873 CTCTGGAGAGGAAGGATCTGAGG + Intergenic
1040807938 8:51415342-51415364 GGCTGTACAGGAAGGATCACTGG + Intronic
1044571142 8:93720318-93720340 AATGGGACAGGAAGGCTCAGAGG - Intronic
1045363480 8:101454254-101454276 GAGTGGGTAGGAAGGCTCAGTGG - Intergenic
1046587688 8:116167838-116167860 GTCTGGATATTGAGGCTCAGAGG + Intergenic
1049951902 9:653200-653222 GTCTGGACATGAAGAGTCTGAGG + Intronic
1050997153 9:12234768-12234790 TAATGGACACGAAGGCTCAGAGG + Intergenic
1055451019 9:76431563-76431585 CTCTGGTCATGGAGGCTCAGTGG - Intronic
1056758490 9:89397863-89397885 GTAGGGACATGATGGCTCAGAGG + Intronic
1056764602 9:89436973-89436995 GGCTGGACATGAGAGCTCAGAGG - Intronic
1056927355 9:90846264-90846286 GTCTGGTCAAGGTGGCTCAGTGG + Intronic
1056966056 9:91163728-91163750 TTCTGGCAAGGAAGGCTCACGGG + Intergenic
1057125147 9:92610953-92610975 GTCTGGAGAGGACTGGTCAGAGG - Intronic
1057792487 9:98133336-98133358 GCCTGGCCAAGAAGCCTCAGTGG + Intronic
1059380357 9:113918943-113918965 AACTGGAAAGGAAGACTCAGTGG + Intronic
1059439920 9:114301137-114301159 GATTGGACAGGAAGACTCCGGGG + Intronic
1060224866 9:121784438-121784460 GCCTGGACAGGCGGGCTCGGAGG + Exonic
1061583276 9:131550655-131550677 GTTTGGACAGAAAGGCTACGGGG - Intergenic
1061709428 9:132477523-132477545 GTCGGGTCAGGAAGGGTCAGGGG + Intronic
1185639646 X:1581326-1581348 GGCTGGAGAGTAAAGCTCAGTGG - Intergenic
1185749255 X:2597506-2597528 GGCTGGACAGGAAGCCTGACTGG + Intergenic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1186784286 X:12943412-12943434 GTCTGGACAGAAAGGCTACAGGG - Intergenic
1187935773 X:24334516-24334538 TTCTGGACACCAAGGCTCAGGGG - Intergenic
1188244690 X:27825357-27825379 GTTTGGGCAGGAGGGCACAGTGG - Intergenic
1189254943 X:39630623-39630645 GTAGTGCCAGGAAGGCTCAGTGG - Intergenic
1189619237 X:42818299-42818321 GTGTGGACTGGCAGGCTGAGTGG - Intergenic
1198217989 X:134574355-134574377 GGCTGGACAAGGAGGCACAGGGG - Intronic
1198231466 X:134693515-134693537 GTGAGGAAATGAAGGCTCAGAGG + Intronic
1199305663 X:146264843-146264865 GTCTGGACCAGAAAGCTCAGAGG + Intergenic
1200124562 X:153807201-153807223 GCCTGGGCAGGAAGGCACACAGG + Intronic
1200725549 Y:6664973-6664995 GTGTGGAGAGGAAGGCACTGTGG - Intergenic