ID: 1096717097

View in Genome Browser
Species Human (GRCh38)
Location 12:53498216-53498238
Sequence TCTGGACAGGAAGGCTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096717089_1096717097 3 Left 1096717089 12:53498190-53498212 CCCTAAAGCTCAGAGAAACTTCA 0: 1
1: 0
2: 2
3: 21
4: 222
Right 1096717097 12:53498216-53498238 TCTGGACAGGAAGGCTCAGGGGG 0: 1
1: 0
2: 5
3: 32
4: 299
1096717090_1096717097 2 Left 1096717090 12:53498191-53498213 CCTAAAGCTCAGAGAAACTTCAG 0: 1
1: 0
2: 0
3: 30
4: 293
Right 1096717097 12:53498216-53498238 TCTGGACAGGAAGGCTCAGGGGG 0: 1
1: 0
2: 5
3: 32
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096717097 Original CRISPR TCTGGACAGGAAGGCTCAGG GGG Intronic
900489501 1:2939960-2939982 TCTGGACAAGGAGGCAAAGGAGG - Intergenic
902391195 1:16107933-16107955 TCTGGAAAAGAAAGATCAGGAGG + Intergenic
902621942 1:17655885-17655907 GGCGGACAGGAAGGCGCAGGGGG + Exonic
904201112 1:28819628-28819650 TGGGGACAAGAAGGCTCAGAGGG + Intronic
904329277 1:29747397-29747419 TCTGGACCGCATGACTCAGGAGG + Intergenic
904937207 1:34140064-34140086 TCTAGACTGGAAGCTTCAGGAGG - Intronic
906248454 1:44293429-44293451 TCTGGCCAGGAAGGCACAGCTGG - Intronic
908839723 1:68266804-68266826 TATGGAGAGTAATGCTCAGGAGG - Intergenic
909072960 1:71018075-71018097 TCTTTACAGCAAGTCTCAGGTGG + Intronic
910142144 1:84037933-84037955 GCAGTACAGGAAGGATCAGGTGG + Intergenic
910516745 1:88069933-88069955 TCTGGACTGGAAGGCACACCTGG + Intergenic
913338730 1:117734717-117734739 TGAAGACAGGAAGGCACAGGGGG - Intergenic
914347120 1:146809393-146809415 GCCGGACAGGAGGGCTTAGGAGG + Intergenic
915243826 1:154542555-154542577 TCTGGGCGGGAAGGGTCAGTCGG - Intronic
916075698 1:161198847-161198869 CCAGGAAAGGAGGGCTCAGGAGG - Exonic
918303786 1:183227720-183227742 TCAGGACAGGAAGAGGCAGGTGG - Intronic
918445928 1:184616918-184616940 TCTGGAGTGCAAGGCTGAGGTGG + Intronic
919775130 1:201189515-201189537 TTTGGACAGGTAGGCTTTGGGGG - Intergenic
920748780 1:208654368-208654390 TCTGGAAAGGAAGGTTCAGGAGG + Intergenic
922333061 1:224594626-224594648 TTTGCACAGGAAAGGTCAGGCGG + Intronic
922802329 1:228370167-228370189 CAGGGAGAGGAAGGCTCAGGAGG - Intronic
1065749428 10:28872136-28872158 TGTGGACATGAAGACTCTGGAGG + Intronic
1066590597 10:36989657-36989679 TGTAGACCGGAAGGCACAGGTGG - Intergenic
1067163343 10:43845401-43845423 TCTGGACAGGAAGTACCTGGAGG - Intergenic
1067251045 10:44587445-44587467 TCTGGTCAGGGAGGGTCAGCGGG - Intergenic
1069346554 10:67476944-67476966 TCTGCACAGCAAGGCTGAGGCGG - Intronic
1069599204 10:69692635-69692657 TCTGGGCAGGAAGGGTGATGAGG + Intergenic
1069599437 10:69693928-69693950 TCTGGGCAGGAAGGGTGATGAGG - Intergenic
1070767686 10:79066170-79066192 TCTGGACAGAAAGGTTGAGAGGG + Intergenic
1071898817 10:90095752-90095774 TCTGTTCAGTAATGCTCAGGAGG - Intergenic
1071948313 10:90673462-90673484 TCATGACAAGAAGGCTGAGGAGG + Intergenic
1072185295 10:93032077-93032099 TGTGGAGACGAAGGCTAAGGGGG - Intronic
1072913863 10:99525203-99525225 TTTGCACATGAATGCTCAGGAGG + Intergenic
1074496022 10:113980792-113980814 TCTGGAGAGAAAGGATCTGGAGG - Intergenic
1075087368 10:119422582-119422604 GGTGGACAGGAAGGCTCAGGAGG - Intronic
1075582618 10:123633792-123633814 TCAGGAGAGGAAGGCAGAGGAGG + Intergenic
1075616775 10:123895651-123895673 TCAGGACTGGAACCCTCAGGAGG + Intronic
1076437861 10:130459102-130459124 GCTGGACAGGCAGGGTCAGGTGG + Intergenic
1076481764 10:130789383-130789405 CCTGGACAGGAGGGATGAGGAGG + Intergenic
1077252164 11:1565494-1565516 TTTGGACTGGAAGGCAGAGGAGG + Intronic
1077550308 11:3197282-3197304 GCTGGAAATGAAGGCCCAGGAGG + Intergenic
1077898628 11:6473266-6473288 TGTGGACAGAAAGCCTCATGTGG - Intronic
1079686356 11:23363813-23363835 TATGGACAGTAAGGCTGAGGTGG - Intergenic
1080502448 11:32883732-32883754 CCTGGACACCAAGGCTTAGGTGG - Intergenic
1081600362 11:44488480-44488502 TCTGGATAGGAGGGCTGAGCTGG + Intergenic
1081613612 11:44578003-44578025 TCTGGAAATTGAGGCTCAGGGGG - Intronic
1084603512 11:70160098-70160120 CCAGGACAGGCAGGCCCAGGAGG - Intronic
1084857599 11:71998981-71999003 TCTGGAAAGGAAGGCTCTTCAGG + Intronic
1085051294 11:73381551-73381573 TCTTGACAGGGAGGCTGGGGAGG + Intronic
1085522174 11:77145371-77145393 TGAGGACATGGAGGCTCAGGAGG + Intronic
1086180046 11:83939925-83939947 TGTGAACAGGAAGGATAAGGTGG + Intronic
1087356229 11:97097928-97097950 TCTGCACAGGAAGGGTGGGGTGG - Intergenic
1089260920 11:117223469-117223491 TCTGAACAGGCAGTCTCAAGTGG + Intronic
1089329936 11:117682139-117682161 TGTGTACAGGATGGCCCAGGAGG + Intronic
1089496652 11:118911436-118911458 TCTGGGGAGGAAGGCTCCTGGGG + Intronic
1090382735 11:126338300-126338322 TCTCGACAAGAAGGCTGAAGCGG + Exonic
1091338050 11:134787552-134787574 TCGTGTCAGAAAGGCTCAGGAGG + Intergenic
1092261944 12:6957632-6957654 TCTGGAAAGGGAGGGTCGGGTGG - Exonic
1096626069 12:52896890-52896912 TCTGTGCAGCAAGGCTCAAGAGG - Intergenic
1096717097 12:53498216-53498238 TCTGGACAGGAAGGCTCAGGGGG + Intronic
1097809832 12:64006457-64006479 TCTGGAGAGGCAGGCTGTGGAGG + Intronic
1098371776 12:69767806-69767828 TCTGCACAGGAAGGTTGGGGTGG + Intronic
1098556660 12:71826014-71826036 TCTGGAGAGGAAGGCTCCTGTGG + Intergenic
1099133299 12:78863596-78863618 ACCGAACAGGAAGGCTCAGCGGG - Intergenic
1101049012 12:100841561-100841583 AATGGTCAGGAAGGCTGAGGTGG + Intronic
1101284981 12:103302293-103302315 GCGGGACAGGAGGCCTCAGGCGG - Exonic
1101656729 12:106728280-106728302 TGAGGACATGAAGGCTCAGAGGG - Intronic
1103345883 12:120249976-120249998 TGTGACCAGGCAGGCTCAGGAGG + Intronic
1103566348 12:121817712-121817734 GCAGGCCAGGAAGCCTCAGGGGG + Intronic
1103850751 12:123931559-123931581 CCAGAACTGGAAGGCTCAGGAGG + Intronic
1104019276 12:124980825-124980847 TCTCAACAGGAAGGCTGACGAGG - Exonic
1105257745 13:18755616-18755638 TCTGGGCAGCAAAGCTCAAGGGG - Intergenic
1105260399 13:18774924-18774946 TCTGGGCAGCAAAGCTCAAGGGG - Intergenic
1105424674 13:20284203-20284225 TCTGGATAGGAAGGAGCAGAGGG - Intergenic
1108524633 13:51276233-51276255 TCTTGGCAGGAAGCCACAGGGGG + Intronic
1108573509 13:51771911-51771933 TCTGGACAGGAAGGAGCGAGGGG + Exonic
1109646414 13:65264271-65264293 TCTGCACAGGAAGGGTGAGGTGG - Intergenic
1111716251 13:91883165-91883187 TCTGGAAGGCAAGGCTCAGATGG + Intronic
1113239919 13:108326117-108326139 TATGGATAAGAAAGCTCAGGGGG - Intergenic
1115592733 14:34879742-34879764 ACTGGACAAGGAGACTCAGGAGG - Intergenic
1117378736 14:55138943-55138965 TCTGGAAAGGAAGGATCCTGTGG - Intronic
1118450903 14:65901370-65901392 TATGGACAGGAAGAGTTAGGAGG + Intergenic
1118571573 14:67200029-67200051 TCTGGACACCCAGGCTCTGGGGG + Intronic
1118817790 14:69325047-69325069 GCTAGACAGGAGGCCTCAGGAGG + Intronic
1119167757 14:72509394-72509416 TCTAGACAGCAAGGCTCCAGAGG - Intronic
1119328526 14:73776763-73776785 TCTGAAGAGCAAGGCTCTGGAGG - Intronic
1120129870 14:80794035-80794057 TTTGGAAACTAAGGCTCAGGAGG - Intronic
1123035738 14:105471195-105471217 TCTGGGCAGAAACCCTCAGGCGG - Intergenic
1123075636 14:105666177-105666199 TCGGGACAGGAGGGGACAGGAGG + Intergenic
1123737072 15:23195873-23195895 TCTGGAAGGCAAGGCTCAGATGG + Intergenic
1123737825 15:23202296-23202318 TCTGGAAGGCAAGGCTCAGATGG + Intergenic
1124287770 15:28418849-28418871 TCTGGAAGGCAAGGCTCAGATGG + Intergenic
1124288290 15:28424544-28424566 TCTGGAAGGCAAGGCTCAGATGG + Intergenic
1124289034 15:28430965-28430987 TCTGGAAGGCAAGGCTCAGATGG + Intergenic
1124294189 15:28486345-28486367 TCTGGAAGGCAAGGCTCAGATGG - Intergenic
1124294935 15:28492777-28492799 TCTGGAAGGCAAGGCTCAGATGG - Intergenic
1124355998 15:28995163-28995185 TCTGCACAGGAAGGCTGAAGAGG - Intronic
1124464082 15:29920548-29920570 TTTGGAAGGGAAGGCTGAGGCGG - Intronic
1125465649 15:39949202-39949224 GCTGGAAAGGCGGGCTCAGGAGG + Exonic
1127016558 15:54695268-54695290 TCTGTCCAGGAGTGCTCAGGTGG - Intergenic
1128171194 15:65514983-65515005 ACTGGACAGTAAGGCTTGGGAGG - Intronic
1128281884 15:66401939-66401961 GCTGGAGAGGTAGGCTGAGGTGG + Intronic
1128323414 15:66707656-66707678 TCTGGGCAATTAGGCTCAGGCGG + Intronic
1128443508 15:67736571-67736593 TCTGTAAAGGAAGGCTCTTGTGG - Intronic
1128599513 15:68983952-68983974 TCTGGACAGGCAGCATCAGTGGG - Intronic
1129159631 15:73740125-73740147 TCTGTATGGGCAGGCTCAGGGGG + Exonic
1129199665 15:73991481-73991503 TCAGGACAGGAAGGCCAGGGAGG + Intronic
1129227774 15:74179911-74179933 TCTGCACTGGGAGCCTCAGGAGG - Intronic
1130294553 15:82635934-82635956 GCTGGACAGGAAGGCTCACCAGG + Intronic
1131439533 15:92448462-92448484 TGTAGAGAGGAAGGCTGAGGAGG + Intronic
1134269239 16:12719142-12719164 TATGGACTGGGAGGCTGAGGTGG + Intronic
1135332557 16:21572975-21572997 TCAGCACTGGAAGGCTGAGGTGG + Intergenic
1135505328 16:23031323-23031345 GCTGGCCAGGGGGGCTCAGGTGG + Intergenic
1136615494 16:31395816-31395838 AGTGGACAGGAAGGCTCAGTTGG + Intronic
1139570989 16:67812208-67812230 TGTGGGCAGGCAGGCTCAGGTGG - Intronic
1140302684 16:73773510-73773532 ACTGGAATGGAAGCCTCAGGTGG - Intergenic
1140926284 16:79587657-79587679 TATGGTCAGGAAGGCAAAGGGGG - Intronic
1141146330 16:81532838-81532860 TCTGGGCAGAGAGGCGCAGGAGG - Intronic
1143719297 17:8798908-8798930 TTTGGCCAGGAAGGCACAGACGG + Exonic
1144379164 17:14675926-14675948 TCTGGATAAGAAGGGTAAGGGGG + Intergenic
1144482520 17:15639597-15639619 TCTGGACAACAGGGCTCCGGAGG - Intronic
1144605658 17:16663407-16663429 GCAGGTCAGGAAGGCACAGGAGG + Intergenic
1144649781 17:17000062-17000084 GCTGGTCAGGAAGGCACAGGAGG + Intergenic
1147153657 17:38532550-38532572 ACTGGACGGCAAGGCCCAGGAGG + Exonic
1147382761 17:40065337-40065359 TTTGGACAGGAGGGTACAGGTGG - Intronic
1147388006 17:40092921-40092943 TATTTACAAGAAGGCTCAGGGGG + Exonic
1148743849 17:49907732-49907754 TCTGGACATCAAGGAGCAGGAGG + Intergenic
1148963076 17:51409683-51409705 GATGGACAGGAAGACACAGGGGG - Intergenic
1149956440 17:61055955-61055977 TCTGCTCAGGATGGCTCTGGAGG + Intronic
1150891013 17:69149780-69149802 TCAGCACAGGAAGAATCAGGTGG + Intronic
1151603115 17:75118780-75118802 TGTGGACAGGCTGGTTCAGGTGG - Intronic
1151937789 17:77273859-77273881 TCACGACATGAGGGCTCAGGTGG + Intergenic
1152792642 17:82290186-82290208 TCAGGACATGAAGGCACATGAGG + Intergenic
1153468850 18:5419788-5419810 TCCGGAGAAGAAGGCTGAGGAGG - Exonic
1153603976 18:6812492-6812514 AGCGGACAGGAAGGCTTAGGAGG + Intronic
1153651039 18:7240495-7240517 CCTGGACAGCAAGGCTCAGGGGG + Intergenic
1153823815 18:8856292-8856314 TCTGGAAAGTAAAGCTCATGTGG - Intergenic
1154134283 18:11762096-11762118 TGAGGACAGGGAGGCACAGGAGG + Intronic
1156258282 18:35420636-35420658 TCAGCACTGGGAGGCTCAGGTGG + Intergenic
1156268171 18:35507271-35507293 TCTGGAGAGTAAGGCTGAGCTGG + Intergenic
1157182247 18:45508157-45508179 TCAACACAGGAAGACTCAGGAGG - Intronic
1157410243 18:47457420-47457442 TGGGGACAGGAAGGCTCACCTGG - Intergenic
1157756096 18:50219002-50219024 TTTGGACAGGGTGGCTTAGGAGG + Intergenic
1158908371 18:62035972-62035994 CCTGGAAAGGAAGGCTTAGCTGG - Intergenic
1160820357 19:1054939-1054961 CCTGGCCAGGGAGCCTCAGGGGG + Intronic
1160977912 19:1802794-1802816 TGGGGACAGGAAGGCTTTGGAGG - Intronic
1162535031 19:11258190-11258212 TCATGTCAGGAAGGCTCAGCTGG - Intronic
1162584046 19:11548240-11548262 TCTCGAAAGGATGCCTCAGGCGG + Intronic
1163022676 19:14491704-14491726 TCTGGACAAGAAGTCGTAGGGGG - Exonic
1164259826 19:23559894-23559916 TCCTGAGAGAAAGGCTCAGGTGG + Intronic
1165697546 19:37912381-37912403 TCAGGACACTAAGGCTCAGAAGG - Intronic
1166045983 19:40231604-40231626 TCTGCACAGCAGGGCTCAGCAGG + Exonic
1166382411 19:42361954-42361976 TGGGGACAGCCAGGCTCAGGAGG + Intronic
1166383679 19:42368867-42368889 GCAGGACAGGAAGGCCCAGGAGG - Exonic
925346720 2:3176844-3176866 GCTGCACAGGAAGGCCCAGAGGG + Intergenic
927041697 2:19237136-19237158 GCAGGGCAGGAAGGATCAGGGGG - Intergenic
928127059 2:28624205-28624227 TAGGGACAGGAAGGAGCAGGAGG - Intronic
928239713 2:29575977-29575999 TCTTAACTGGGAGGCTCAGGAGG - Intronic
929804435 2:45132389-45132411 TCTAGAAAGGAAGACTCAGCTGG + Intergenic
929823839 2:45294884-45294906 TCTGGAGAGGAAGCCTAGGGTGG - Intergenic
929943035 2:46349276-46349298 GATGGACAGCCAGGCTCAGGAGG - Intronic
931715286 2:65024006-65024028 TCAGGGCAGGCATGCTCAGGGGG + Intergenic
932097444 2:68864088-68864110 TCTGCACAGGAAGGGTCCGGTGG - Intergenic
932276250 2:70454339-70454361 TTTGGACAGCAGGGCTAAGGAGG + Intronic
932356836 2:71074212-71074234 TCTGGACAGGAAGACTAACTGGG - Intronic
934492331 2:94769944-94769966 TCTGGGCAGCAAAGCTCAAGAGG - Intergenic
934520939 2:95019807-95019829 GCTGGACAGGGAGGCACATGTGG - Intergenic
936820191 2:116510795-116510817 TCTGAATAGGAAGGGTGAGGTGG + Intergenic
937823214 2:126335075-126335097 TCTGCACAGGAAGGATAAGGTGG - Intergenic
939247549 2:139645238-139645260 TCTGCACAGGAAGGGTGGGGAGG + Intergenic
942232532 2:173873663-173873685 TGTGTTCAGGAAGGGTCAGGAGG - Intergenic
942710595 2:178830743-178830765 TCTGGACTTGATGGGTCAGGAGG + Exonic
942792614 2:179778016-179778038 TCTTGACAGGGAGGCTGAGGTGG - Intronic
943424818 2:187718184-187718206 TGTGGATAGGAAGGCTCTGGAGG + Intergenic
944138888 2:196433321-196433343 TCTGGGCGGCAAGGCTCTGGAGG + Exonic
944420533 2:199525313-199525335 ACTGGACAGCAAAGCTCAGGTGG + Intergenic
944664861 2:201951445-201951467 TCAGGAGATGAAGGCTGAGGAGG + Intergenic
946326365 2:218986465-218986487 TCTGGAGAGGCAGGCTAAGGAGG + Intergenic
946406391 2:219494114-219494136 CCAGGACAGGGAGGCTAAGGTGG + Intronic
947621077 2:231591581-231591603 TTTGGAGAGGAAGGCTCAGTCGG - Intergenic
947659299 2:231854912-231854934 TCTGCACAGAAAGGCTCGGCTGG + Intergenic
947802190 2:232936591-232936613 TCTGGACACCAAGGCACAGGTGG + Intronic
947933904 2:233986882-233986904 TGTGGATAGGAAAGTTCAGGTGG + Intronic
948200522 2:236127020-236127042 TCTGAACAGGAAAGGTGAGGGGG - Exonic
948874125 2:240818368-240818390 TCTGGACCGGAGGGATGAGGAGG - Intronic
948902508 2:240963648-240963670 GCTGCACAGGGAGGCCCAGGAGG + Intronic
948995092 2:241573973-241573995 CCTGGCCGGGAGGGCTCAGGTGG - Exonic
1169465721 20:5836643-5836665 TTTAGACAGGAAGGTCCAGGAGG - Intronic
1169515509 20:6312106-6312128 TCTTCACAGGAAGGGTGAGGTGG - Intergenic
1170575540 20:17659385-17659407 TCAGGGCAAGAAGGCTGAGGGGG - Intronic
1171457161 20:25278608-25278630 TCTGGAAGGGAGGGCCCAGGTGG - Intronic
1173021258 20:39269573-39269595 CCTGGCCAGGCAGGCCCAGGAGG - Intergenic
1173968718 20:47133802-47133824 CCTGGACATCAAGGCTCAAGTGG - Intronic
1176843739 21:13860645-13860667 TCTGGACAGCAAAGCTCAAGGGG - Intergenic
1176846412 21:13879965-13879987 TCTGGGCAGCAAAGCTCAAGGGG - Intergenic
1178596841 21:33962072-33962094 TGTGAAGAGGAAGCCTCAGGAGG + Intergenic
1179262878 21:39774056-39774078 GCTGGAGAGGGAGGCTCAGTGGG + Intronic
1179728037 21:43351092-43351114 CCTGGACAGGAGGCCTCAGCTGG - Intergenic
1179954613 21:44731504-44731526 CCTGGATGGGAAGGCTCAGATGG - Intergenic
1180622795 22:17172810-17172832 ACTGGAGAGGCAGGCTGAGGCGG + Intergenic
1181056181 22:20261512-20261534 TGCGGACAGGGAGGCTCAGAGGG + Intronic
1181423106 22:22815454-22815476 TCAGGACAGGAAGGCTCCTGGGG - Intronic
1184389713 22:44196379-44196401 TCTGCACAGACAGGCCCAGGCGG - Exonic
1184572499 22:45334931-45334953 CCTGGAAAGGGAGGCTCAGTGGG - Intronic
1185249765 22:49794585-49794607 TCTGCACAGGCAGCCTCAGTGGG - Intronic
950821527 3:15765021-15765043 TGTGGAAAGGAGGGCTCAGAGGG - Intronic
950826723 3:15830919-15830941 TCTGGACAGCAAACCTCACGTGG + Intronic
952822989 3:37500893-37500915 ACTGGTCATGAAGGCTCATGGGG - Intronic
953409098 3:42679094-42679116 ACTTGACAGGAAGGAGCAGGGGG + Intergenic
956863864 3:73350590-73350612 TCTGGTCAGGAGGTCCCAGGGGG + Intergenic
958156433 3:89761543-89761565 TCTGCACAGGAAGGGTGAGGTGG + Intergenic
958930619 3:100204077-100204099 TCTCGAGAGGGAGGCTGAGGAGG + Intergenic
959110983 3:102123150-102123172 TCTGGGCAGGAAAGCTGATGAGG + Intronic
961373234 3:126445390-126445412 TCTGCACAGGAAGGGTAAGCTGG + Intronic
961652792 3:128425714-128425736 ACAGGACAGGAGGGCCCAGGAGG - Intergenic
961903070 3:130233479-130233501 TCTGGACAAAAAGGCTTAGTGGG + Intergenic
962402290 3:135070976-135070998 TCTGGCCAGGGAGGGTCAGATGG + Intronic
966243092 3:177776353-177776375 TGAGGACAGGAAGCCTCAGGTGG - Intergenic
969105383 4:4803550-4803572 TCTGGGCAGCAATGCCCAGGAGG - Intergenic
969517428 4:7655405-7655427 TTTGGAACGGAAGGCTGAGGGGG - Intronic
972834651 4:42855184-42855206 TCTGGAAAGGAAGGGTGAGATGG + Intergenic
973761516 4:54120681-54120703 TCTGGACAGGAAGTATGAGCAGG - Intronic
974311370 4:60214609-60214631 ACTTGAAAGGAAGGCTGAGGTGG - Intergenic
974312759 4:60233902-60233924 TCTGCACAGGAAGGATGGGGTGG + Intergenic
977681536 4:99803622-99803644 GCTGGGCAGGCAGGCTCATGTGG + Intergenic
978174143 4:105708937-105708959 ACTGGGCGGGAAGGCGCAGGCGG + Exonic
979139419 4:117153204-117153226 TCTGCACAGGAAAGCTGGGGTGG + Intergenic
979737450 4:124104829-124104851 TCTGCACAGGAAGGGTGTGGAGG + Intergenic
982222903 4:153140118-153140140 ACTGGACAAGAGGGGTCAGGTGG - Intergenic
984027575 4:174561866-174561888 TCTGAACAGGAAGACTGAAGTGG - Intergenic
985117177 4:186603841-186603863 TCTGGAGAAGAATACTCAGGTGG - Exonic
985618447 5:938501-938523 TCAGGAGAGGAAGGCTCAGGGGG + Intergenic
985827614 5:2204752-2204774 CCTGGACAGGAAGCTCCAGGAGG - Intergenic
988605998 5:32678764-32678786 ACTGGACACCAAGGCTGAGGAGG + Intergenic
989602457 5:43212541-43212563 TCAGGAGAGGAGGGCTCAGCAGG + Intronic
992776976 5:80097360-80097382 ACTGGCCAAGAAGGCACAGGTGG - Intergenic
998514189 5:142737838-142737860 TCTGGGCAGGAATGTCCAGGTGG + Intergenic
998590574 5:143473419-143473441 TCTGGACAGAAACGCTTAGATGG - Intergenic
999245242 5:150150679-150150701 TCTGGGCCTGAGGGCTCAGGAGG + Intronic
1000327282 5:160181980-160182002 AGAGGACAGGAAGGGTCAGGAGG - Intergenic
1000871298 5:166580606-166580628 TTTGGAAAAGAAGGCTCAGAGGG + Intergenic
1001687380 5:173604245-173604267 GCTGGACAAAATGGCTCAGGGGG + Intergenic
1001946060 5:175779123-175779145 TCTGGGCAGGGAGCCTAAGGCGG - Intergenic
1002409454 5:179062041-179062063 CCTGGGCAGGAAGACTGAGGAGG + Exonic
1002450846 5:179317763-179317785 TCTGGCCAGGGAGTCTCAGCTGG - Intronic
1002930604 6:1631987-1632009 TCATCACAGGAAGGCTCAGAGGG + Intronic
1003409576 6:5850831-5850853 GCTGGTCAGGAATGCTCCGGGGG - Intergenic
1004482760 6:16036912-16036934 TCTGGGCATGAATGTTCAGGTGG - Intergenic
1004912668 6:20301557-20301579 GCTCGTCAGGGAGGCTCAGGCGG - Intergenic
1006423642 6:33950537-33950559 TGTGGTCAGGACGGCACAGGAGG + Intergenic
1006973823 6:38077180-38077202 TCTGCCCAGGGAGGCTTAGGAGG + Intronic
1008901277 6:56619743-56619765 GCTGGAAAGGAAGGATCAGGCGG - Intronic
1009955521 6:70448176-70448198 TCTGGAAAGGAAAGATCTGGAGG + Intronic
1010311735 6:74394157-74394179 TATGGAAAGCATGGCTCAGGAGG - Intergenic
1010854994 6:80826657-80826679 TGTGGTCAGGAAGACTCAGGAGG - Intergenic
1011389419 6:86835752-86835774 TGGGTACAGGAGGGCTCAGGAGG - Intergenic
1011957210 6:93037749-93037771 TCTGCACAGGAAGGGTGGGGTGG + Intergenic
1012676091 6:102114988-102115010 TCTGCACAGGAAGGGCGAGGTGG + Intergenic
1013354706 6:109336558-109336580 CATGGGCAGGGAGGCTCAGGAGG + Intergenic
1013604045 6:111731712-111731734 TGGGGACAGAATGGCTCAGGAGG + Intronic
1015599935 6:134902240-134902262 TCAGCCCAGGAAGGCTCAGCTGG - Intergenic
1016220910 6:141668889-141668911 TCTGCACAGGAAAGGTGAGGTGG - Intergenic
1018610164 6:165640619-165640641 TCTGAACAGGAAGGTTTAGAAGG - Intronic
1019277051 7:181372-181394 TGTGGACAGGAAGGGGCCGGCGG - Intergenic
1019416958 7:932257-932279 GCTGGAGAGGAAGGCTGGGGAGG - Intronic
1019646887 7:2135612-2135634 GGTGCAGAGGAAGGCTCAGGTGG + Intronic
1021307026 7:19045239-19045261 TCTGCACAGGAAGGGTAGGGTGG - Intronic
1021386270 7:20035088-20035110 TCTGGTCAGGAAGGTTTGGGTGG + Intergenic
1024405102 7:48969975-48969997 TCTGCACAGGAATGGTGAGGTGG - Intergenic
1024579602 7:50791526-50791548 TCTGAAAACCAAGGCTCAGGAGG - Intronic
1024810276 7:53202918-53202940 TCTGGATAGGAATGCTGAGCTGG + Intergenic
1026444000 7:70468356-70468378 TCTGGACAGGAAGGTAGAGCAGG - Intronic
1026941177 7:74289023-74289045 GCTGGACAGAAAGGATGAGGAGG - Intergenic
1027716925 7:81684091-81684113 TCTTGAGAGCAAGGCTGAGGAGG - Intergenic
1029161055 7:98552213-98552235 TCTGGACACCAAGGCTCAGGTGG + Intergenic
1029210031 7:98900120-98900142 TCTGGAGATGAAGGCTGATGGGG - Intronic
1032555933 7:132835081-132835103 ACTGGGGAGGGAGGCTCAGGTGG - Intronic
1032663374 7:134010788-134010810 ACTGGCCAGGAAGGCTGAGAAGG - Intronic
1033431431 7:141293129-141293151 TCTGGACAGGAGGACTCATCTGG + Intronic
1033472383 7:141661709-141661731 TCTGGACACGAATTCTCTGGAGG - Exonic
1033555780 7:142487737-142487759 TCCTGACAGGAAGGCTCTGGGGG + Intergenic
1033965831 7:146974196-146974218 GCTGGGCAGGGAGGCTGAGGTGG + Intronic
1034429297 7:151033229-151033251 CCTGGACAGGAAGGGGCCGGGGG - Intronic
1034468822 7:151245295-151245317 TCTGGGGAGGTAGGCTTAGGGGG - Intronic
1037417529 8:18667735-18667757 ACTCGTCAGGGAGGCTCAGGCGG + Intronic
1037652832 8:20854981-20855003 TCTGGACAGGGATGGTAAGGAGG + Intergenic
1037749699 8:21673195-21673217 TCTGGGAGGGAAGGCTCAGATGG - Intergenic
1037933015 8:22894856-22894878 GCTGGAAAGGGAGGCTCAGCAGG - Intronic
1038992455 8:32883586-32883608 ACTGGATAGGAAGGATCAAGAGG - Intergenic
1039474650 8:37833316-37833338 TCTGCACAGGCAGGAACAGGAGG - Intronic
1039488740 8:37931776-37931798 TCTGGACACCAAGGCTTAGGGGG - Intergenic
1039719409 8:40146491-40146513 GTTGGTCAGGAAGGCTGAGGTGG - Intergenic
1039845565 8:41323285-41323307 TCTGGACAGGGATGCATAGGAGG + Intergenic
1040634043 8:49251661-49251683 TCTGCACAGGAAAGCACATGTGG + Intergenic
1041278786 8:56190687-56190709 TGCTGACAGGAAGGATCAGGTGG + Intronic
1042109651 8:65367329-65367351 TCTGCACAGGAAGGGTGGGGTGG - Intergenic
1044571141 8:93720317-93720339 ATGGGACAGGAAGGCTCAGAGGG - Intronic
1045320729 8:101080054-101080076 ACTGGACTGGAAGGGCCAGGAGG - Intergenic
1048299271 8:133239413-133239435 TGGGAACAGGGAGGCTCAGGGGG - Intronic
1049202743 8:141349912-141349934 TCTGGAGAGGATGGTTGAGGTGG + Intergenic
1049780074 8:144424850-144424872 TCAGGACAGCAAGCCCCAGGTGG + Intronic
1050619039 9:7433638-7433660 TCTGCACAGGAAGGGTGTGGTGG + Intergenic
1050619059 9:7433751-7433773 TCTGCACAGGAAGGGTGGGGTGG + Intergenic
1051359439 9:16269089-16269111 TCTGGCCAGGAAGGATTGGGAGG + Intronic
1051817951 9:21131913-21131935 TTTGAATAGGAAGTCTCAGGAGG + Intergenic
1053665254 9:40313059-40313081 TCTGGGCAGCAAAGCTCAAGAGG + Intronic
1053914838 9:42938106-42938128 TCTGGGCAGCAAAGCTCAAGAGG + Intergenic
1054376410 9:64453089-64453111 TCTGGGCAGCAAAGCTCAAGAGG + Intergenic
1054519361 9:66063225-66063247 TCTGGGCAGCAAAGCTCAAGAGG - Intergenic
1055451018 9:76431562-76431584 TCTGGTCATGGAGGCTCAGTGGG - Intronic
1055463027 9:76537217-76537239 TCTGGACTTGGAGCCTCAGGAGG + Intergenic
1055736539 9:79336651-79336673 TCTGCACAGGAAGGGCGAGGTGG + Intergenic
1056407349 9:86287433-86287455 TGTAGGCAGGGAGGCTCAGGGGG - Intergenic
1057047607 9:91898126-91898148 TCTGGAAAGAAAGTCTCAAGTGG + Intronic
1058143494 9:101383480-101383502 GCTGGAAAAGAAGGCTCAAGAGG - Exonic
1060230255 9:121820637-121820659 TGAGGAAAGGAAGGCCCAGGAGG - Intergenic
1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG + Intronic
1061812663 9:133171431-133171453 TCGGGCCAGGAAAGCTCAGCCGG - Intergenic
1061819986 9:133221949-133221971 TCTGCCCAGGCAGGTTCAGGGGG - Intergenic
1061876775 9:133547918-133547940 TCTGGAAATGGAGGCTCTGGTGG + Intronic
1062240663 9:135535996-135536018 TCTGCCCAGGCAGGTTCAGGGGG + Intergenic
1203779929 EBV:95722-95744 TCTGGACCAGAAGGCTCCGGCGG + Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1189081471 X:37977467-37977489 TCTGGAAATGAATGGTCAGGGGG + Intronic
1190477220 X:50840129-50840151 ACTGGGCAGGAAGGCTGGGGAGG - Intergenic
1190634721 X:52422504-52422526 TGTGGACAGCATGGCTGAGGAGG - Intergenic
1190653007 X:52584969-52584991 TGTGGACAGCATGGCTGAGGAGG - Intergenic
1192273675 X:69608780-69608802 TGTGGGCAGGCAGGGTCAGGAGG + Intergenic
1192800650 X:74461986-74462008 ACTGGGCTGAAAGGCTCAGGAGG - Intronic
1194157155 X:90404977-90404999 TCTGAACAGGAAGGGTGAGGTGG - Intergenic
1195246797 X:103002300-103002322 TCATGCCAGGAAGACTCAGGAGG + Intergenic
1195862333 X:109395417-109395439 TCTGGAGGGGCATGCTCAGGAGG + Exonic
1199859847 X:151791630-151791652 TCTGGATTGGAAGTCTCAGCTGG - Intergenic
1200144193 X:153917910-153917932 TCCAGACTGGAAGGCTCTGGGGG + Intronic
1200503485 Y:3981959-3981981 TCTGAACAGGAAGGGTGAGGTGG - Intergenic
1201145188 Y:11060701-11060723 TGTAGAGAGGAAAGCTCAGGAGG + Intergenic
1202056855 Y:20843441-20843463 GCGGGACAGGAGGCCTCAGGCGG - Intergenic