ID: 1096717353

View in Genome Browser
Species Human (GRCh38)
Location 12:53499491-53499513
Sequence GAGGAGAAGGAGGAGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8983
Summary {0: 1, 1: 40, 2: 540, 3: 2070, 4: 6332}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096717353_1096717365 11 Left 1096717353 12:53499491-53499513 CCCGCCTCCTCCTCCTTCTCCTC 0: 1
1: 40
2: 540
3: 2070
4: 6332
Right 1096717365 12:53499525-53499547 CTCCCCCCGCTGCCCTCCACCGG 0: 1
1: 0
2: 3
3: 33
4: 412
1096717353_1096717371 17 Left 1096717353 12:53499491-53499513 CCCGCCTCCTCCTCCTTCTCCTC 0: 1
1: 40
2: 540
3: 2070
4: 6332
Right 1096717371 12:53499531-53499553 CCGCTGCCCTCCACCGGACCCGG 0: 1
1: 0
2: 0
3: 14
4: 387
1096717353_1096717372 18 Left 1096717353 12:53499491-53499513 CCCGCCTCCTCCTCCTTCTCCTC 0: 1
1: 40
2: 540
3: 2070
4: 6332
Right 1096717372 12:53499532-53499554 CGCTGCCCTCCACCGGACCCGGG 0: 1
1: 0
2: 0
3: 23
4: 189
1096717353_1096717373 19 Left 1096717353 12:53499491-53499513 CCCGCCTCCTCCTCCTTCTCCTC 0: 1
1: 40
2: 540
3: 2070
4: 6332
Right 1096717373 12:53499533-53499555 GCTGCCCTCCACCGGACCCGGGG 0: 1
1: 0
2: 0
3: 16
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096717353 Original CRISPR GAGGAGAAGGAGGAGGAGGC GGG (reversed) Intronic
Too many off-targets to display for this crispr